Appl Biochem Biotechnol (2016) 178:544–557

DOI 10.1007/s12010-015-1893-7

Physicochemical Biomolecular Insights into Buffalo

Milk-Derived Nanovesicles

Vijay Simha Baddela 1 & Varij Nayan 1 & Payal Rani 1 &
Suneel Kumar Onteru 1 & Dheer Singh 1

Received: 14 July 2015 / Accepted: 8 October 2015 /

Published online: 21 October 2015
# Springer Science+Business Media New York 2015

Abstract Milk is a natural nutraceutical produced by mammals. The nanovesicles of milk

play a role in horizontal gene transfer and confer health-benefits to milk consumers. These
nanovesicles contain miRNA, mRNA, and proteins which mediate the intercellular commu-
nication. In this work, we isolated and characterized the buffalo milk-derived nanovesicles by
dynamic light scattering (DLS), nanoparticle tracking analysis (NTA), scanning electron
microscopy (SEM), Western probing, and Fourier transform infrared (FTIR) spectroscopy.
The DLS data suggested a bimodal size distribution with one mode near 50 nm and the other
around 200 nm for the nanovesicles. The NTA and SEM data also supported the size of
nanovesicles within a range of 50–200 nm. The FTIR measurements of nanovesicles identified
some prominent absorption bands attributable to the proteins (1300–1700 cm−1, amide A and
amide B bands), lipids (2800–3100 cm−1), polysaccharides, and nucleic acids (900–
1200 cm−1). The comparative expression profiles of immune miRNA signatures (miR-15b,
miR-21, miR-27b, miR-125b, miR-155, and miR-500) in nanovesicles isolated from milk,
serum, and urine revealed that these miRNAs are present abundantly (P<0.05) in milk-derived

Vijay Simha Baddela and Varij Nayan are co-first authors and contributed equally to this work.

* Dheer Singh
drdheer.singh@gmail.com
Vijay Simha Baddela
chandu.vijaysimha@gmail.com
Varij Nayan
varij.biochem@gmail.com
Payal Rani
ranipayal09@gmail.com
Suneel Kumar Onteru
suneelvet@gmail.com

1
Molecular Endocrinology, Functional Genomics and Systems Biology Laboratory, Animal
Biochemistry Division, ICAR-National Dairy Research Institute (Deemed University),
Karnal 132001 Haryana, India
Appl Biochem Biotechnol (2016) 178:544–557 545

nanovesicles. Milk miRNAs (miR-21 and 500) that were also found stable under different
household storage conditions indicated that these could be biologically available to milk
consumers. Overall, nanovesicles are a new class of bioactive compounds from buffalo milk
with high proportion of stable immune miRNAs compared to urine and plasma of same
animals.

Keywords Milk . Nanovesicles . Exosomes . Dynamic light scattering . Nanoparticle tracking

analysis . FTIR . miRNA

Introduction

Nanovesicles/exosomes are multi-action biological structures, nanosized, secreted, and

double-layered lipid-vesicles of endocytic origin. These vesicles were earlier proven as
important intercellular communication agents [1]. Inward budding of late endosomes leads
to the formation of multivesicular bodies in cytoplasm. The fusion of these multivesicular
bodies (MVBs) with the plasma membrane leads to the release of exosomes out of the cell.
These nanovesicles consist of essential proteins, mRNA, and miRNA species to perform
various functions in signal transduction and posttranscriptional events. Exosomes were initial-
ly discovered as cellular garbage-discarded vesicles having roles in the mammalian reticulo-
cyte maturation [2]. Later, the important finding in the exosome research came from the report
of Raposo and coworkers, which indicated the direct activation of T lymphocytes by MHC-II-
enriched exosomes released by B lymphocytes [3]. Similar experiments using various immune
cells showed the importance of exosomal communication among immune cells [4–6]. The
protein content of exosomes may vary between different cells. But, most of them contain a
common set of conserved protein markers, like CD9, CD81, and heat shock proteins [7]. Once
the exosomes are released out from a parent cell, they fuse with the recipient cell membrane
based on the surface proteins viz ligands and receptors. Upon fusing, exosomes release their
inner content including miRNA, mRNA, and other proteins into the recipient cell [8].
Exosomal mRNA and miRNA were actively investigated in recent years as these manipulate
cellular physiological functions. Exosomal miRNAs are instrumental in the regulation of gene
expression at the posttranscriptional level in recipient cells [9]. The exosomes are present in
most of the body fluids, including blood, urine, milk, saliva, and amniotic fluids. These
exosomes, derived from various cell types, are involved in specific functions defined by the
parent cells [10]. The miRNA subset of exosomes isolated from serum and urine served as
biomarkers for various physiological and pathological conditions [11].
Milk nanovesicles have special significance because they have the capacity of horizontally
transferring genetic information. After milk consumption, the RNA present therein can stably
cross the stomach [12] and reach the intestine for absorption and subsequent health benefits to
milk consumers [13]. Scanning electron microscopy (SEM), atomic force microscopy (AFM),
dynamic light scattering (DLS), nanoparticle tracking analysis (NTA), and Western immuno-
blotting were used to characterize the size of exosomes derived from various cell types
[14–16]. The characterization by Fourier transform infrared (FTIR) spectroscopy analysis
applied only to pollenosomes of plants [17], and it is not yet performed for nanovesicles
derived from animal cells. The present study focused on the extensive surface characterization
of buffalo milk-derived nanovesicles by FTIR, NTA, DLS, SEM, and Western blot-based
methods. It also covered the comparative quantification of candidate immune miRNA species
546 Appl Biochem Biotechnol (2016) 178:544–557

among exosomes derived from milk, serum, and urine along with stability assessment of milk
exosomal miRNA under regular household storage conditions to understand the actual
horizontal transfer potential of milk exosomes.

Materials and Methods

Bio-Fluid Collection and Preparation

Milk, blood, and urine samples were collected from three healthy, nonpregnant, and early
lactating Murrah buffaloes of the National Dairy Research Institute, Karnal. The animals were
fed with similar diet and maintained in the same herd. Blood was collected from the jugular
vein by using BD serum tubes, kept undisturbed for about 2 h, and then centrifuged at 3000×g
for 5 min to eliminate the cells and cell debris. The supernatant or serum was stored at −80 °C
till use. The milk samples, after collection, were transferred to the laboratory on ice. Milk was
centrifuged at 2000×g for 30 min to pellet milk cells. The fat portion of the milk was carefully
eliminated. The supernatant was carefully taken into a separate tube and centrifuged twice at
20,000×g for 30 min to separate the whey fraction. The final milk whey fraction was stored at
−80 °C till use. Urine samples were collected from animals in 15 ml centrifuge tubes,
transported to the laboratory on ice, and centrifuged at 3000×g for 5 min. The supernatant
was carefully taken into cryotubes and stored at −80 °C till use.

Isolation of Nanovesicles from Serum, Milk, and Urine

ExoQuick™ (catalog number EXOQ5A-1) exosome precipitation reagents (System Biosci-

ences) were used for the isolation of nanovesicles from serum and milk, whereas ExoQuick-
TC™ (EXOTC10A-1) reagents were used for urinary nanovesicle isolation. For serum
exosome isolation, 500 μl of serum was mixed with 120 μl of exoquick reagent in a 1.5-ml
centrifuge tube. The milk whey and ExoQuick™ were mixed in 1:1 ratio, and the cell free urine
and ExoQuick-TC™ (EXOTC10A-1) reagents were mixed in 5:1 ratio. After the addition of
exoquick reagents, the serum, milk, and urine samples were inverted for 1 min and kept
undisturbed at 4 °C for overnight. Further, the mixtures were centrifuged at 1500×g for 30 min
to pellet the exosomes. The supernatant was discarded, and the centrifugation was repeated for
5 min to eliminate any residual supernatant. The exosomes were dissolved in phosphate-
buffered saline (PBS) and stored at −20 °C for further use.

Protein Isolation, Quantification, SDS-PAGE, and Western Blotting

The ExoQuick™ reagent-enabled precipitate of exosomes was directly dissolved in a lysis

buffer. This mixture was boiled at 100 °C for 5 min and transferred to ice for 2 min. The
samples were then spun at 12,000×g for 2 min. Supernatant-containing protein was transferred
to a new tube without disturbing the pellet and then stored at −80 °C till further use. Proteins
were separated by 12 % SDS-PAGE and transferred onto a PVDF membrane. After transfer,
the membrane was blocked with skim milk powder solution for 2 h. The membrane was
subjected to washing, and then bovine reactive cd-81 primary antibody (Santa Cruz-sc-9158)
was added over the membrane in 1:1000 dilutions overnight at 4 °C. The membrane was
washed again and subjected for HRP-labeled secondary anti-rabbit antibody incubation for 2 h
Appl Biochem Biotechnol (2016) 178:544–557 547

at room temperature. Then, the membrane was washed with PBST and visualized by using the
enhanced chemiluminescence solution.

SEM of Exosomes

SEM was carried out for PBS dissolved exosomes. Exosomes were plated to form a smear
over a cover slip and air dried. Exosomes were fixed with 2 % gluteraldehyde for 20 min and
serially dehydrated with 30, 50, 70, 90, and 100 % ethanol. The resulting cover slip was gold
coated and visualized using scanning electron microscope.

DLS Analysis of Buffalo Milk-Derived Vesicles

DLS measurement of milk nanovesicles or exosomes was conducted with a Malvern Zetasizer
nano series instrument—the Nano ZS (Malvern Instruments Limited, UK) with Zetasizer
software version 7.04—to confirm the isolation, size, and their zeta potential of milk-
derived nanovesicles. A 4-mW He-Ne gas laser of 632.8 nm wavelength was used during
measurement. The buffalo milk-derived nanovesicle samples were diluted to a concentration of
∼50 μg/ml, as determined by Nano Photometer (Implen GmbH, Germany), to yield an
optimum scattering intensity for dynamic light scattering measurements. Samples were studied
at a constant temperature of 25 °C with an equilibration time of 120 s. Light scattering from the
sample was detected by an avalanche photodiode detector (APD) at 173° and using noninva-
sive back scattering (NIBS) optics. The exosome size data were calculated as the intensity-,
volume-, and number-weighted size distributions by DLS. Three measurements were made,
and average result was created from these measurements.

NTA of Milk Vesicular Suspension

The nanovesicles and microvesicles in the isolated milk exosome suspension were analyzed
using a Malvern Nanosight NS300 (Malvern Instruments Limited, UK), equipped with
scientific complementary metal-oxide-semiconductor (sCMOS) camera. For the analysis, a
milk-derived exosome suspension of 50 μg/ml concentration was initially taken. It was again
diluted (∼1:1000 in sterile Milli-Q water) to provide particle concentrations in the range of
106–108 particles/ml. About 300 μl of diluted exosome suspensions was loaded into the
sample chamber of the Nanosight unit, and video was recorded for 9 s with a frame rate of
24.98 fps. The green laser source at 532 nm was applied to the diluted exosome suspension.
The particle movement was analyzed by NTA software (version 2.3 build 0027, NanoSight).
All the measurements were performed at 25 °C in light scatter mode. These were analyzed for
the mean, mode, and standard deviation of vesicle size together with cumulative data and an
estimate of the total concentration.

FTIR Spectroscopy of Milk Nanovesicles Containing Suspension

FTIR spectroscopy analyses of the exosome-containing suspension were performed by

IRAffinity-1 Fourier transform infrared spectrophotometer (Shimadzu Corporation, Japan),
equipped with a horizontal attenuated total reflection (ATR). The measurements were recorded
in the frequency range of 400–4000 cm−1 with a resolution of 2 cm−1. The instrument was
equipped with DLATGS detector with a temperature control system. The exosome-containing
548 Appl Biochem Biotechnol (2016) 178:544–557

suspension was coated on a glass slide and dried. The dried film was pressed against the
diamond crystal of ATR with a pressure applicator. For a sample, 30 scans were acquired and
averaged. The measurement files were saved in a format bearing the .smf extension. The files
were opened with the essential FTIR v3.10. 041 software (Operant LLC) and were averaged
and used for further analysis. The display limits were set from 600–3600 cm−1. The peaks
were manually picked, and the data were exported.

RNA Isolation, cDNA Synthesis, and miRNA Quantification

The ExoQuick™ reagent-enabled precipitate fractions of biofluids were directly taken

for RNA isolation. RNA was isolated using a mirVana miRNA isolation kit
(#AM1560). The lysis buffer was added to the precipitated fraction of the ExoQuick
reagent and further preceded by following the manufacturer’s instructions. The cDNA
was prepared by using Qiagen’s miScript RT II cDNA synthesis. Real-time PCR was
performed by using mirScript SYBR Green PCR Kit from Qiagen for all the miRNAs.
The 2× QuantiTect SYBR Green PCR Master Mix, 10× miScript universal primer and
miRNA specific primer (Table 1), 5 ng template cDNA and RNase-free water were
mixed in appropriate proportions to make the 10 μl of the reaction mixture. The
reaction mixture was subjected to real-time PCR by using BIORAD mini opticon
machine. The PCR steps contain an initial activation of 15 min at 95 °C followed by
40 cycle steps that include 15-s denaturation, 30-s annealing, and 30-s extension at
94, 55, and 70 °C, respectively, to obtain the fluorescent data.

Stability Analysis of Milk Exosomal miRNA

Milk was subjected to various storage and usage conditions, including boiling at 100 °C for
10 min, storing at 4 °C for 1 day, and freezing-thawing for five times. Fresh milk exosomal
RNA was considered as a reference. After implementing each condition, exosomes were
isolated from milk, RNA was isolated, cDNA was prepared, and real-time analysis was done
for two exosomal miRNAs, miR-21, and miR-500 to understand the stability of milk
exosomal RNA.

Statistical Analysis

The GraphPad prism 5.0 software was used for analyzing the results with one-way ANOVA
and Tukey’s post hoc test to find the significance among the variables. All the data were

Table 1 miRNA primers used for

this study Sl. no. miRNA Primer sequence

1 miR 15b CAGCACATCATGGTTTACA

2 miR 21 GCTTATCAGACTGATGTTGAC
3 miR 27b CACAGTGGCTAAGTTCTG
4 miR 125 TCCCTGAGACCCTTTAAC
5 miR 155 AATGCTAATCGTGATAGGG
6 miR 500 TAATCCTTGCTACCTGGG
Appl Biochem Biotechnol (2016) 178:544–557 549

presented as the mean±SEM of three independent experiments. Error bars with diverse letters
designate significant difference at the level of P<0.05.

Results

Characterization of Nanovesicles or Exosomes in Various Body Fluids

SEM and Western Blotting

Overnight incubation of the ExoQuick™ reagent with milk and serum and incubation of
ExoQuick™ with urine resulted in the precipitate, which was subjected to SEM and Western
probing with cd81 antibody. The SEM analysis revealed the presence of exosomes/
nanovesicles in serum, milk, and urine (Fig. 1) with a size range of 30–200 nm. The Western
probing resulted in positive signs (Fig. 2) for cd81 marker protein (∼26 kD) in exosomes of all
the three sources.

DLS Analysis of Buffalo Milk-Derived Vesicles

The exosome size distribution profile is represented as a bell-shaped curve. The calculated
intensity-, volume-, and number-weighted size distributions by DLS suggested a bimodal
(two peaks) size distribution with one mode near 50 nm, and the other one was at around
200 nm (Table 2 and Fig. 3). The size distribution did not follow the broad unimodal (single
peak) size distribution pattern. Since the exosomal preparation has carried a mixture of
vesicles with an obvious size difference (bimodal distribution), the calculated Z-average may
provide irrelevant size information. Therefore, we did not go for the Z-average values given
in the system-generated report as the Z-average should only be employed for the size if the
suspension/solution is monomodal, spherical, or monodisperse. The higher percentage of
larger-sized vesicles in the size distribution based on intensity can easily be ignored or
understood, as relatively few bigger particles will direct the intensity-weighted size distribu-
tion toward the right side (Fig. 3). Conversely, when the size distribution was read for the
number and volume-weighted distribution, the smaller particles were found to increase their
percent contributions. Malvern zetasizer also showed a negative zeta potential of −29.5±
6.1 mV for milk-derived nanovesicles. It is probably due to the negatively charged phos-
pholipid membrane of nanovesicles.

Fig. 1 Scanning electron microscopy of fixed and dehydrated and gold-coated exosomes on glass substrate from
a milk, b serum, and urine (c)
550 Appl Biochem Biotechnol (2016) 178:544–557

Fig. 2 Western probing of exosomes from serum, milk, and urine using cd81 antibody

Total Concentration of Vesicles and Their Size Distribution by NTA

The concentration-weighted size distribution of milk-derived exosomes from NTA was ob-
served with a mode of 37 nm, mean of 103.15 nm, and SD of 71.19 nm. The particle size
distribution in a typical experiment was D10, 37; D50, 88; D90, 186; D70, 121 nm. The size
distribution of these unfractionated milk vesicles ranged from approximately 15 to 900 nm in
diameter (Fig. 4a–d). Since the few larger particles can cause overestimation, the focus should
be on vesicles of <400 nm. The NTA identified and measured particles in the expected single
exosome size range of 30–100 nm. The area under the particle size versus the concentration
curve for particles in the 15–100 nm range (AUC15−100) was approximately 60 % of the total
AUC for the 0–400 nm curve.

FTIR Spectroscopy for the Characterization of Milk-Derived Nanovesicles

The FTIR spectrum of milk nanovesicle/exosome (Fig. 5) indicated that several mid-infrared
spectral regions, such as the amide I, II, and III band (1300–1700 cm−1) and C-H regions
(2700–3500 cm−1) are of interest for proteins and lipids. Similarly, the FTIR spectral bands
within 900–1200 cm−1 seem to be mainly due to phosphodiester groups of nucleic acids and
phospholipids and to the C-O absorption of some carbohydrates. The details of different
regions are elaborated in the discussion section.

Stability of Milk Exosomal miRNA and Comparative Quantification of Immune

miRNA Signatures

Expression analysis of miR-21 and miR-500 under different storage conditions (Fig. 6)
revealed that boiling milk at 100 °C for 10 min results in no significant loss of exosomal
miRNA when compared to fresh milk. Storing milk at 4 °C for 1 day and subjecting it for five
freeze-thaw cycles resulted in significant (P<0.05), but not complete, loss of exosomal RNA
compared to fresh milk. The immune miRNA expressions were quantified in the exosomes
isolated from serum, milk, and urine (Fig. 7). All the studied miRNAs (miR-15b, miR-21,
miR-27b, miR-125b, miR-155, and miR-500) were found to be significantly (P<0.05) higher
in milk compared to urinary exosomes. The miR-21 and miR-155 levels were not significantly

Table 2 Size distribution by DLS

of milk-derived exosomes Weighted by Peak 1 Peak 2 Ratio

Intensity 48.27 nm/17.8 % 208.9 nm/82.2 % 4.32:1

Volume 43.57 nm/78.2 % 212.5 nm/21.8 % 4.87:1
Number 40.46 nm/99.7 % 190.9 nm/0.3 % N.A.
Appl Biochem Biotechnol (2016) 178:544–557 551

Fig. 3 Size distribution of milk-

derived vesicles by DLS in terms of
intensity, number, and volume

different between milk and serum exosomes, whereas the other four immune miRNAs were
found at significantly (P<0.05) lower concentration in serum compared to milk.

Discussion

Milk is believed to be one of the most valuable nutritional sources. Milk has already been
known to have bioactive peptides [18]. The present study found the presence of bioactive
vesicles in buffalo milk. This study also reports the presence of nanovesicles or exosomes in
buffalo milk, serum, and urine for the first time. The nanovesicles or exosomes in buffalo
biofluids lied in a specific size range as of reported exosomes and found to have cd81 marker
protein in it. The buffalo milk-derived nanovesicles or exosomes were phenotypically and
structurally characterized through DLS, NTA, FTIR, SEM, and Western probing with cd81
antibody. Instead of transmission electron microscopy (TEM), SEM analysis was preferably
performed to understand the topography and the size of exosomes. Recognizing the number of
recent publications [19–23] using SEM, we used the SEM with an understanding that SEM
can sufficiently address the present issue. In addition, it is well accepted and published that
SEM has certain added advantage over TEM in the case of exosomes. For instances, a recent
report of Wu et al. (2015) says that SEM of exosomes has greater advantage of identifying the
552 Appl Biochem Biotechnol (2016) 178:544–557

Fig. 4 Nanoparticle tracking analysis of buffalo milk-derived vesicles (nanovesicles/exosomes and

microvesicles). a The concentration-weighted size distribution from NTA measurements of buffalo milk-
derived vesicles (0–400 nm diameter). The concentration is expressed as the number of particles (×106) per
milliliters suspension. The size is expressed in nanometer (nm) scale. The area under the particle size versus
concentration curve for particles in the 15–100 nm range (AUC15-100) comprises approximately 60 % of the
total AUC for the 0–400 nm curve. b Screen shot from diluted milk-derived vesicles (exosomes and
microvesicles) revealing a range of particle sizes. c, d Particle (exosomes and microvesicles) distribution profile
in terms of size versus intensity versus concentration. d 3D plot of c

contaminants and size compared to TEM. Nawas et al. (2014) showed that there was no added
advantage of doing the TEM compared to SEM for exosome analysis as both the techniques
only gives information regarding size and marker detection. In addition, we have also
employed the DLS and NTA in our current study as they became powerful techniques in
analyzing the exosome (nanoparticle) size distribution [21, 24]. The DLS measurements
indicated a bimodal (two peaks) size distribution of milk-derived exosomes with one mode
around 50 nm and the other around 200 nm. This was further strengthened by SEM and NTA,
which also indicated that nanovesicles are in the expected size range of 30–100 nm.
Uses of FTIR measurement in the characterization of nanovesicles or exosomes are rare.
We employed FTIR to get valuable insight in the structural details of milk-derived
nanovesicles. Through FTIR measurements, it was revealed that the vesicular suspension from
buffalo milk has some prominent absorption bands attributable to proteins, lipids, polysaccha-
rides, and nucleic acids. Some mid-infrared spectral regions, especially of amide I, II, and III
bands (1300–1700 cm−1) for proteins and C-H regions (2700–3500 cm−1), are of interest. The
shoulder at and around the region of 2800–3100 cm−1 may reflect the contents of lipid residues
containing unsaturated hydrocarbon chains. The FTIR spectral bands within 900–1200 cm−1
also may be mainly due to phosphodiester groups of nucleic acids and phospholipids and to the
Appl Biochem Biotechnol (2016) 178:544–557 553

Fig. 5 FTIR spectra of milk-derived nanovesicles containing a suspension showing the contribution of lipids,
proteins, carbohydrates, and nucleic acids. a Synthetic spectrum derived from averaging the three original
spectrums in the wavenumber ranges from 4000–400 cm−1. b Synthetic spectrum derived from averaging the
three original spectrums in the wave number ranges from 3600–600 cm−1 with band assignments to the identified
regions

C-O absorption of some carbohydrates. In the FTIR spectrum, the peaks within 3565 to
3505 cm−1 may correspond to the stretching O-H/O-H bonds. The N-H stretching (symmetric
and asymmetric) is evident in the peaks between 3400–3000 cm−1. The primary amide NH2
asymmetric stretching was observed with peaks at 3339, 3355, and 3360 cm−1. The secondary
amide N-H stretching could be assigned to peaks at 3252, 3277, 3290, and 3296 cm−1. The
primary amide NH2 symmetric stretching was attributed to the bands at 3183 and 3190 cm−1.
Secondary amide II overtone was seen at 3068, 3080, and 3082 cm−1. Thus, amide A and
amide B infrared bands of peptide linkages could be assigned to this spectral region. The
amide I band (1600–1700 cm−1), which is majorly due to the C=O stretch vibrations of the
peptide linkages, could also be located in the FTIR spectrum. The amide I band consist of
several unresolved substructures belonging to protein secondary structural elements. The band
at 1654 and 1680 cm−1 may be attributed to amide I (mainly secondary amide C=O stretching)
of alpha helical structure, and the region around 1643 cm−1 may be attributable to beta sheet or
random coil. The peak around 1679 cm−1 may represent beta-turn conformation. The amide II
band (1480–1575 cm−1), that derives from in-plane NH bending and the CN stretching
vibration, is also visible with peak at 1496 and 1514 cm−1. Since, the most intense vibrations
in the IR spectra of lipids are the CH2 symmetric/asymmetric and stretching vibrations, which
give rise to bands in the region of 2800–3100 cm−1. Therefore, in the FTIR spectrum, the
554 Appl Biochem Biotechnol (2016) 178:544–557

Fig. 6 Milk samples were subjected to different household conditions, and exosomes were isolated. The miR-21 was
analyzed by performing qRT-PCR. (The F and T for 5C represent the subjected condition of freezing and thawing for
five times)

shoulder near this region may reflect the contents of lipid residues containing unsaturated
hydrocarbon chains. The C–H stretching band due to unsaturated acyl chains is ascribed at
3012 cm−1. The bands of 1375–1460 cm−1 indicate CH3 symmetric and asymmetric bending.
Based on these observations, FTIR can be easily implemented and adapted for characterizing
the nanovesicles derived from the cells of animal origin.

Fig. 7 The comparative expressions of miRNAs miR-15b (a), miR21 (b), miR-27b (c), miR-125 (d), miR-155
(e), and miR-500 (f) in the exosomes isolated from serum, milk, and urine
Appl Biochem Biotechnol (2016) 178:544–557 555

Early-lactation milk or colostrum is well known to have higher pro-immunity agents

compared to late-lactation milk [25]. Our findings revealed that the pro-immune
miRNA concentrations in the exosomes derived from early-lactation buffalo milk were
higher than the serum and urine counterparts of the same animal. It further suggests a
new dimension in biological research as the independent activities of different body
fluids might be depending on the needs of physiological systems and functions allotted
to them. According to the previous reports [12, 13], it was affirmed that miRNA milk
are stable enough to pass through the acidic conditions existing in stomach and reach
the intestine where they might be absorbed. Once miRNA are absorbed, they could be
involved in the manipulation of gene expression in the milk consumer. As the majority
of miRNA in milk have immune functions, they might be involved in the development
of the infant immune system. The promising question in this context is whether these
miRNAs in ruminant milk would be involved in gene expression manipulation of
humans or not. The possibility of such a kind of regulation is more because of the
higher conservation of mature miRNA among animal species [26]. Moreover, miRNAs
are not perfectly commentary to the respective target mRNA strand [27] in most of the
cases. Prior to the exploration of such horizontal gene transfer effects on milk con-
sumers, it is needed to address the stability of buffalo milk exosomal RNA under
regular household storage and processing conditions. Our results support that boiling at
100 °C for 10 min, storing at 4 °C for 24 h, and subjecting milk to repeated freezing
and thawing led to no complete loss of exosomal miRNA. It further delineates that
exosomal RNA species remain present in milk even after regular storage and household
storage and processing conditions. So, the milk consumers will receive the exosomal
miRNAs in a stable form and may act as bioactive nucleic acids, regulating the gene
expression of milk consumers.
The present study identified that milk nanovesicles are sufficiently stable with a zeta
potential of −29.5±6.1. Hence, these can be used for various applications without loosing
their properties. Exosomes of milk increase the value of dairy products beyond nutrition by
offering various health benefits to consumers. Lack of immunogenicity and capability of
delivering specific molecules to target cells attributes exosomes with a number of biomed-
ical applications like disease diagnosis, therapy, and drug delivery [28]. Exosomes have
been successfully used for the entrapment of molecules like curcumin and also for treating
brain diseases [29]. Milk exosomes were found to contain significant fraction of miRNA
species essential for developmental and immunological processes in infants. Therefore, the
supplementation of formula of milk powders and other dairy products with milk exosomes
will definitely increase the nutritional and commercial value of dairy products. Further, it is
the demand of the present time to address the increased resistance in pathogens toward
conventional drugs. Since the milk is known to contain antibacterial compounds, the
potential applications of milk exosomes in place of antibiotics could also be further studied.
In this context, the research has to be extended for the value addition of milk by enriching
the nanovesicles with drugs or miRNA species for the benefit of human and animal health.

Acknowledgments The authors are very grateful to Director NDRI, Karnal, for providing the necessary
facilities for this study. The authors thank Dr. S. K. Tomar for providing the SEM facility to BV and Dr. Rajan
Sharma for allowing VN to use FTIR spectroscopy, and Mark Ware, Kartick Padmanabhan, and Namrata Jain of
Malvern Instruments for facilitating the NTA at NDRI.
556 Appl Biochem Biotechnol (2016) 178:544–557

Compliance with Ethical Standards

Funding This work was financially supported by the National Agricultural Science Fund (NASF), formerly
known as National Fund for Basic, Strategic, and Frontier Application Research in Agriculture (NFBSFARA)
(NFBSFARA/BSA-4006/2013-14) and CRP – Nanotechnology of ICAR, India.

Conflict of Interest The authors declare that they have no conflict of interest.

Ethical Approval Authors have taken approval of institute ethical committee for the collection of blood, urine,
and milk from the buffaloes of NDRI cattle and buffalo herd for the sake of research work.

References

1. Rani, S., O'Brien, K., Kelleher, F. C., Corcoran, C., Germano, S., Radomski, M. W., Crown, J., &
O'Driscoll, L. (2011). Isolation of exosomes for subsequent mRNA, MicroRNA, and protein
profiling. Methods in Molecular Biology, 784, 181–95.
2. Johnstone, R. M., Bianchini, A., & Teng, K. (1989). Reticulocyte maturation and exosome release:
transferrin receptor containing exosomes shows multiple plasma membrane functions. Blood, 74,
1844–51.
3. Raposo, G., Nijman, H. W., Stoorvogel, W., Liejendekker, R., Harding, C. V., Melief, C. J., &
Geuze, H. J. (1996). B lymphocytes secrete antigen-presenting vesicles. The Journal of
Experimental Medicine, 183, 1161–72.
4. Bodey, B., Bodey, B., & Jr Kaiser, H. E. (1997). Dendritic type, accessory cells within the mammalian
thymic microenvironment. Antigen presentation in the dendritic neuro-endocrine-immune cellular network.
In Vivo, 11, 351–70.
5. Blanchard, N., Lankar, D., Faure, F., Regnault, A., Dumont, C., Raposo, G., & Hivroz, C. (2002).
TCR activation of human T cells induces the production of exosomes bearing the TCR/CD3/zeta
complex. Journal of Immunology, 168, 3235–41.
6. Andre, F., Schartz, N. E., Movassagh, M., Flament, C., Pautier, P., Morice, P., Pomel, C., Lhomme, C.,
Escudier, B., Le Chevalier, T., Tursz, T., Amigorena, S., Raposo, G., Angevin, E., & Zitvogel, L. (2002).
Malignant effusions and immunogenic tumour derived exosomes. Lancet, 360, 295–305.
7. Mathivanan, S., Ji, H., & Simpson, R. J. (2010). Exosomes: extracellular organelles important in intercellular
communication. Journal of Proteomics, 73, 1907–20.
8. Raposo, G., & Stoorvogel, W. (2013). Extracellular vesicles: exosomes, microvesicles, and friends. The
Journal of Cell Biology, 200, 373–83.
9. Okoye, I. S., Coomes, S. M., Pelly, V. S., Czieso, S., Papayannopoulos, V., Tolmachova, T., Seabra, M. C., &
Wilson, M. S. (2014). MicroRNA-containing T-regulatory-cell-derived exosomes suppress pathogenic T
helper1 cells. Immunity, 41, 89–103.
10. Weber, J. A., Baxter, D. H., Zhang, S., Huang, D. Y., Huang, K. H., Lee, M. J., Galas, D. J., &
Wang, K. (2010). The microRNA spectrum in 12 body fluids. Clinical Chemistry, 56(11), 1733–
41.
11. Keller, S., Ridinger, J., Rupp, A. K., Janssen, J. W., & Altevogt, P. (2011). Body fluid derived
exosomes as a novel template for clinical diagnostics. Journal of Translational Medicine, 9, 86.
12. Kosaka, N., Izumi, H., Sekine, K., & Ochiya, T. (2010). microRNA as a new immune-regulatory agent in
breast milk. Silence, 1, 7.
13. Baier, S. R., Nguyen, C., Xie, F., Wood, J. R., & Zempleni, J. (2014). MicroRNAs are absorbed in
biologically meaningful amounts from nutritionally relevant doses of cow milk and affect gene expression
in peripheral blood mononuclear cells, HEK-293 kidney cell cultures, and mouse livers. The Journal of
Nutrition, 144, 1495–500.
14. Sokolova, V., Ludwig, A. K., Hornung, S., Rotan, O., Horn, P. A., Epple, M., & Giebel, B.
(2011). Characterisation of exosomes derived from human cells by nanoparticle tracking analysis
and scanning electron microscopy. Colloids and Surfaces. B, Biointerfaces, 87, 146–50.
15. Sharma, S., Rasool, H. I., Palanisamy, V., Mathisen, C., Schmidt, M., Wong, D. T., & Gimzewski, J. K.
(2010). Structural-mechanical characterization of nanoparticle exosomes in human saliva, using correlative
AFM FESEM, and force spectroscopy. ACS Nano, 4, 1921–6.
Appl Biochem Biotechnol (2016) 178:544–557 557

16. Atay, S., Gercel-Taylor, C., Kesimer, M., & Taylor, D. D. (2011). Morphologic and proteomic
characterization of exosomes released by cultured extravillous trophoblast cells. Experimental Cell
Research, 317(8), 1192–202.
17. Prado, N., Alché, J. D., Casado-Vela, J., Mas, S., Villalba, M., Rodríguez, R., & Batanero, E. (2014).
Nanovesicles are secreted during pollen germination and pollen tube growth: a possible role in fertilization.
Molecular Plant, 7, 573–7.
18. Clare, D. A., & Swaisgood, H. E. (2000). Bioactive milk peptides: a prospectus. Journal of Dairy Science,
83(6), 1187–95.
19. de Carvalho, J. V., De Castro, R. O., Da Silva, E. Z., Silveira, P. P., Da Silva-Januário, M. E., Arruda, E.,
Jamur, M. C., Oliver, C., Aguiar, R. S., & daSilva, L. L. (2014). Nef neutralizes the ability of exosomes from
CD4+ T cells to act as decoys during HIV-1 infection. PloS One, 9, e113691.
20. Im, H., Shao, H., Park, Y., Peterson, V. M., Castro, C. M., Weissleder, R., & Lee, H. (2014). Label-free
detection and molecular profiling of exosomes with a nano-plasmonic sensor. Nature Biotechnology, 32,
490–5.
21. Mehdiani, A., Maier, A., Pinto, A., Barth, M., Akhyari, P., & Lichtenberg, A. (2015). An innovative method
for exosome quantification and size measurement. Journal of Visualized Experiments, 95, 50974.
22. Nawaz, M., Camussi, G., Valadi, H., Nazarenko, I., Ekström, K., Wang, X., Principe, S., Shah, N., Ashraf, N.
M., Fatima, F., Neder, L., & Kislinger, T. (2014). The emerging role of extracellular vesicles as biomarkers
for urogenital cancers. Nature Reviews. Urology, 11(12), 688–701.
23. Wu, Y., Deng, W., & Klinke Ii, D. J. (2015). Exosomes: improved methods to characterize their morphology,
RNA content, and surface protein biomarkers. Analyst, 140, 6631–42.
24. Filipe, V., Hawe, A., & Jiskoot, W. (2010). Critical evaluation of nanoparticle tracking analysis (NTA) by
NanoSight for the measurement of nanoparticles and protein aggregates. Pharmaceutical Research, 27, 796–
810.
25. Gu, Y., Li, M., Wang, T., Liang, Y., Zhong, Z., Wang, X., Zhou, Q., Chen, L., Lang, Q., He, Z., Chen, X.,
Gong, J., Gao, X., Li, X., & Lv, X. (2012). Lactation-related microRNA expression profiles of porcine breast
milk exosomes. PloS One, 7(8), e43691.
26. Lee, C. T., Risom, T., & Strauss, W. M. (2007). Evolutionary conservation of microRNA regulatory circuits:
an examination of microRNA gene complexity and conserved microRNA-target interactions through
metazoan phylogeny. DNA and Cell Biology, 26(4), 209–18.
27. Lim, L. P., Lau, N. C., Garrett-Engele, P., Grimson, A., Schelter, J. M., Castle, J., Bartel, D. P., Linsley, P. S.,
& Johnson, J. M. (2005). Microarray analysis shows that some microRNAs downregulate large numbers of
target mRNAs. Nature, 433(7027), 769–73.
28. Qin, J., & Xu, Q. (2014). Functions and application of exosomes. Acta Poloniae Pharmaceutica, 71(4), 537–
43.
29. Sun, D., Zhuang, X., Xiang, X., Liu, Y., Zhang, S., Liu, C., Barnes, S., Grizzle, W., Miller, D., & Zhang, H.
G. A. (2010). A novel nanoparticle drug delivery system: the anti-inflammatory activity of curcumin is
enhanced when encapsulated in exosomes. Molecular Therapy, 18(9), 1606–14.