0013-7227/06/$15.
00/0
Printed in U.S.A.
Isoform-Specific Regulation of Uridine Diphosphate-
Glucuronosyltransferase 2B Enzymes in the Human
Prostate: Differential Consequences for Androgen and
Bioactive Lipid Inactivation
Sarah Chouinard, Georges Pelletier, Alain Bélanger, and Olivier Barbier
Oncology and Molecular Endocrinology Research Center (S.C., G.P., A.B., O.B.), Centre Hospitalier de l’Université Laval
Research Center, and Faculties of Medicine (S.C., G.P., A.B.) and Pharmacy (O.B.), Laval University, Québec, Canada
G1V 4G2
Androgens as well as monohydroxy-fatty acids are implicated
in the pathogenesis of prostate cancer. Like a huge variety of
endo- and xenobiotics, they are eliminated as glucuronide
conjugates formed by uridine diphosphate-glucuronosyl-
transferase (UGT) enzymes. In the present study, we observe
that treatment of the prostate cancer cells LNCaP with nat-
ural and synthetic androgens, IL-1␣, or epidermal growth factor
(EGF) differently modulates the glucuronidation of androgen
and bioactive lipid metabolites. Indeed, glucuronidation of
5␣-androstane-3␣,17␤-diol and 13-hydroxyoctadecadienoic
acid was drastically reduced, whereas 12-hydroxyeicosatet-
raenoic acid conjugation by UGT was increased after andro-
gen treatment. These effects reflected the reduction of
UGT2B10, -B15, and -B17 enzyme expression, and the activa-
tion of the UGT2B11 gene. In human prostate epithelial cells,
only UGT2B11 and -B15 mRNAs are detected and are regu-
T HE MAJOR ROLE that androgens play in the physiology
of normal prostate as well as in the initiation and de-
velopment of prostate cancer has been widely documented
(for review see Ref. 1). More recently, evidence suggested
that hydroxy-fatty acids, such as linoleic acid (LA) and ar-
achidonic acid (AA) metabolites, are also implicated in the
pathogenesis of prostate cancer. Indeed, overexpression of
the 12-lipoxygenase (LOX) enzyme, which converts AA into
12-hydroxyeicosatetraenoic acid (12-HETE) has been ob-
served in prostate cancers and tends to correlate with the
aggressive tumor behavior (2– 4). Consistently, urinary levels
of 12-LOX metabolites are increased in patients with pros-
tatic diseases (5). On the other hand, expression of the 15-
LOX type 1 enzyme, which catalyzes the transformation of
LA into 13-hydroxyoctadecadienoic acid (HODE), is also
correlated with a high grade of prostate cancer (6, 7). These
First Published Online August 3, 2006
Abbreviations: AA, Arachidonic acid; AR, androgen receptor; Ct, cycle
threshold; DHT, dihydrotestosterone; 3␣-Diol, 5␣-androstane-3␣,17␤-diol;
EGF, epidermal growth factor; HETE, hydroxyeicosatetraenoic acid;
HODE, hydroxyoctadecadienoic acid; LA, linoleic acid; LC-MS/MS, liquid
chromatography coupled with mass spectrometry; LOX, lipoxygenase;
PrEC, prostate epithelial cells; UDPGA, uridine 5⬘-diphosphoglucuronic
acid; UGT, uridine diphosphate-glucuronosyltransferase.
Endocrinology is published monthly by The Endocrine Society (http://
www.endo-society.org), the foremost professional society serving the
endocrine community.
5431
Downloaded from endo.endojournals.org by on December 3, 2007
Endocrinology 147(11):5431–5442
Copyright © 2006 by The Endocrine Society
doi: 10.1210/en.2006-0229
lated by androgens in a similar manner as in LNCaP cells. In
LNCaP cells, IL-1␣ and EGF also regulate UGT2B expression
in an isoform-specific manner; IL-1␣ induced UGT2B10 and
reduced UGT2B17, while having no effects on UGT2B11 mRNA
levels. EGF treatment resulted in a decreased UGT2B17 ex-
pression, whereas UGT2B10 and -B11 mRNA remained at their
basal levels. Overall, these results demonstrate that in the
human prostate, androgens do not only affect their own in-
activation but also influence the levels of monohydroxy-fatty
acids by regulating the expression of UGT2B enzymes in an
isoform-specific manner. These differential effects of andro-
gens, IL-1␣, and EGF on lipid metabolism likely constitute an
additional mechanism by which these endogenous factors
promote prostate cancer development. (Endocrinology 147:
5431–5442, 2006)
recent observations suggest that such monohydroxy-fatty
acids promote prostate cancer development by activating
cellular proliferation and angiogenesis (8). Interestingly, re-
cent findings also indicate that androgens and monohy-
droxy-fatty acids share an inactivating metabolic pathway
called glucuronidation (9 –11).
Uridine diphosphate-glucuronosyltransferase (UGT) en-
zymes represent a family of microsomal enzymes that cat-
alyze the transfer of glucuronic acid from uridine 5⬘-diphos-
phoglucuronic acid (UDPGA) to endogenous and exogenous
molecules with oxygen, nitrogen, and sulfur functional
groups (12). Glucuronidation renders aglycon substrates wa-
ter soluble and more easily excretable from the body (12, 13).
Based on evolutionary divergences, human UGT enzymes
have been classified into two subfamilies, UGT1 and UGT2;
the latter was further subdivided into UGT2A and -2B (12).
The seven UGT2B enzymes isolated to date, UGT2B4, -B7,
-B10, -B11, -B15, -B17, and -B28, are encoded by different
genes clustered on chromosome 4 (4q13– 4q21.1) (12).
UGT2B4 and -B7 conjugate bile acids, whereas the latter also
glucuronidates androgen, estrogen, mineralocorticoid, and
glucocorticoid hormones (14 –18). The only substrates iden-
tified to date for UGT2B10 and -B11 are the metabolites of LA
and AA, namely 13-HODE, 12-HETE, and 15-HETE (10). In
addition to UGT2B7, the group of androgen-conjugating en-
zymes also comprises UGT2B15, -B17, and -B28; and
UGT2B7, -B15, and -B17 are less specific for hydroxy-fatty
5432 Endocrinology, November 2006, 147(11):5431–5442
acids but also conjugate some metabolites of LA and AA (9,
10, 14).
Expression of the seven human UGT2B enzymes has been
detected in various androgen target tissues such as prostate
and skin where the glucuronidation of dihydrotestosterone
(DHT), and its metabolites 5␣-androstane-3␣,17␤-diol (3␣-
Diol) and androsterone has been reported (9, 17, 19). These
observations suggest that androgens are inactivated locally
before being released into the circulation. Indeed, high levels
of androgen glucuronides were measured in human prostate
(20), whereas the proportion of unconjugated vs. glucu-
ronidated 3␣-Diol and androsterone is relatively low in
blood (21).
The local inactivation of biologically active endobiotics
constitutes an efficient mechanism to control their effects (9,
22–24). Recent observations indicate that expression of
UGT2B15 and -B17 enzymes in LNCaP cells, an androgen-
dependent prostate cancer cell line, is modulated by endog-
enous factors such as androgens, cytokines, and growth fac-
tors (25–27). Furthermore, the down-regulation of UGT2B15
and -B17 expression and activity in LNCaP cells cultured in
the presence of androgens has been correlated to increased
concentrations of DHT in the cell media, to induced cell
growth, and to elevated prostate-specific antigen secretion
(21, 25). Sun et al. (28) also reported that isoflavone treatment
of LNCaP cells resulted in an increased inactivation of DHT
by glucuronidation, which caused lower prostate-specific
antigen production.
In addition to the androgen-conjugating enzymes
UGT2B15 and -B17, UGT2B11 is also expressed in the human
prostate (17). Regulation of UGT2B15 and -B17 expression
and activity has been previously studied, whereas the rela-
tive limited number of substrates for UGT2B11 reduced the
interest of investigators for this isoform. However, Turgeon
et al. (10) recently reported that UGT2B10 and -B11 catalyze
the glucuronidation of HODE and HETE substrates. Con-
sidering the emerging role that such LA and AA metabolites
play in the development of prostate cancer, the present study
was aimed at analyzing the global effect of androgens, IL-1␣,
and epidermal growth factor (EGF) on the expression and
androgen- and hydroxy-fatty-acid-conjugating activity of
UGT2B enzymes in the classical prostate cell model, LNCaP
and in normal human prostate epithelial cells (PrEC).
Materials and Methods
Materials
R1881 was purchased from DuPont NEN Life Science Products (Bos-
ton, MA). Protein assay reagents were obtained from Bio-Rad Labora-
tories Inc. (Marnes-la-Coquette, France). IL-1␣ and EGF were purchased
from Sigma (Oakville, Ontario, Canada). UDPGA was obtained from
Sigma Chemical Co. (St. Louis, MO). 13-HODE, 12-HETE, and 5-HETE
were purchased from Cayman Chemicals (Ann Arbor, MI). 3␣-Diol was
purchased from Steraloids (Newport, RI). Standards of 3␣-Diol-glucu-
ronides and Casodex were provided by Endorecherche (Medicinal
Chemistry Division of our laboratory). The positional isomers of 3␣-Diol
and the regioselectivity of the glucuronidated metabolites were ascertain
using proton-nuclear magnetic resonance analysis. Ammonium formate
was from Aldrich Chemical Co. (Milwaukee, WI), and HPLC-grade
methanol was provided by VWR Canlab (Montreal, Quebec, Canada).
Human embryonic kidney (HEK293) and human prostate cancer (LN-
CaP) cells were obtained from the American Type Culture Collection
(Rockville, MD). PrEC and related culture medium were obtained from
Downloaded from endo.endojournals.org by on December 3, 2007
Chouinard et al. • Androgens Regulate UGT2B in Prostate Cells
Cambrex (Walkersville, MD), and human liver microsomes were ob-
tained from the Human Cell Culture Center (Laurel, MD). SyBr Green
PCR Mix 2⫻ was obtained from Applied Biosystems (Foster City, CA).
The slide of prostate tissue was obtained from US Biomax Inc. (Toronto,
Ontario, Canada).
Cell culture
HEK293 and LNCaP cells were grown as previously described (10,
26). PrEC were grown in PrEC basal medium as recommended by the
supplier (Cambrex, Walkersville, MD). HEK293 cell lines stably express-
ing UGT2B enzymes were obtained as previously reported (10). For
treatments with androgen receptor (AR) agonists, Casodex (5 ␮m), IL-1␣
(2 ng/ml), EGF (10 ng/ml), cycloheximide (20 ␮g/ml), and actinomycin
D (1 ␮g/ml), LNCaP cells were precultured for 24 h in serum-free media,
and all treatments were performed in the absence of serum for the
indicated duration and at the indicated concentrations. For cyclohexi-
mide treatment, LNCaP cells were incubated for 24 h in the presence or
absence of R1881 (10 nm), and for actinomycin D, LNCaP cells were
pretreated with actinomycin D for 2 h and then media were changed to
novel media containing or not R1881 (10 nm) for 24 h. AR agonists and
Casodex were dissolved in ethanol, and the volume added to media
never exceeded 0.1% ethanol (vol/vol). For longer treatments, fresh
medium was added every 48 h.
Production of the anti-UGT2B10-B11 antibody
A 34.8-kDa fragment of the UGT2B11 protein (amino acids 60 –140)
fused to the glutathione S-transferase protein has been constructed as
previously described (26, 29). Production and purification of the fusion
protein and immunization procedures were performed as fully de-
scribed elsewhere (30). Briefly, three rabbits were injected at multiple
sites with 300 ␮g purified fusion protein, in the presence of 300 ␮l
complete Freund’s adjuvant. Subsequently, two booster injections were
given at 4-wk intervals with the same quantity of protein in the presence
of incomplete Freund’s adjuvant. The production of antibodies was
checked 14 d after each injection on blood collected by ear puncture.
Rabbit sera were tested for the presence of antibodies against UGT2B by
Western blot using microsomal extracts from human liver and HEK293
cells stably expressing each human UGT2B protein. Whereas all three
sera were reactive with UGT2B proteins, serum 1845 recognized only
UGT2B10 and -B11.
Western blot experiments
Microsomal preparations of UGT2B-HEK293 and LNCaP cells were
obtained by differential centrifugation, as previously described (10), and
were resuspended in homogenization buffer at 20 ␮g/␮l and stored at
⫺80 C. Total PrEC and LNCaP proteins from R1881 treated or control
cells were purified according to the Tri-Reagent acid phenol protocol as
specified by the supplier (Molecular Research Center, Cincinnati, OH).
For Western blot experiments, 10 ␮g microsomal proteins or 30 ␮g total
proteins were separated by 10% SDS-polyacrylamide gel. The gel was
transferred onto nitrocellulose membrane and probed with the 1845
anti-UGT2B10-B11 (1:6000 dilution), 1849 anti-UGT2B15 (1:1500 dilu-
tion), or anti-calnexin (1:5000 dilution) antibodies (Stressgen, Victoria,
British Columbia, Canada). An antirabbit IgG horse antibody conjugated
with peroxidase (Amersham, Oakville, Ontario, Canada) was used as the
second antibody, and the resulting immunocomplexes were visualized
using a chemiluminescence kit (ECL) (Renaissance, Quebec, Canada)
and exposed on hyperfilm (Kodak Corp., Rochester, NY) for 15– 60 sec.
Immunohistochemical analyses
Immunohistochemical analyses were performed as previously de-
scribed (20, 29). Briefly, immunostaining was performed by using anti-
UGT2B10-B11 (1845) antisera diluted 1:500 in Tris saline (pH 7.6) for 1 h
at room temperature. Sections were subsequently washed with PBS and
incubated with a peroxidase-labeled goat antirabbit ␥-globulin diluted
1:200 for 10 min (Hyclone Laboratories, Inc., Logan, UT). After incuba-
tion, the peroxidase complex was revealed with diaminobenzidine after
exposure for 2 min. The intensity of the staining was controlled under
the microscope. The sections were then counterstained with hematox-
Chouinard et al. • Androgens Regulate UGT2B in Prostate Cells Endocrinology, November 2006, 147(11):5431–5442 5433

ylin. Control experiments were performed on consecutive sections using Results

preimmune rabbit serum (1:500) or antisera anti-UGT2B10-B11 prein-
cubated with the corresponding preparation of stably transfected HK293
cells (20 ␮m).
Glucuronidation assay
Enzymatic assays were conducted using 30 – 40 ␮g microsomal pro-
teins or 30 – 80 ␮g proteins from cells homogenized in Tris-buffered
saline (pH 7.4; 50 mm) with dithiothreitol (0.5 mm) in the presence of 1
mm UDPGA, 10 mm MgCl2, 100 ␮g/ml phosphatidylcholine, 8.5 mm
saccharolactone, and 200 ␮m of the different aglycons in a glucuronida-
tion assay buffer (10). Assays were incubated at 37 C for 2 h and
terminated by adding 100 ␮l methanol with 0.02% butylated Hydroxy-
toluene followed by centrifugation at 14,000 ⫻ g for 10 min, as previously
described (30). The formation of glucuronide conjugates was measured
by using liquid chromatography coupled with mass spectrometry (LC-
MS/MS) as previously described (10).
RNA isolation, reverse transcription, and real-time PCR
Total RNA was isolated from LNCaP cells or PrEC according to the
Tri-Reagent acid phenol protocol as specified by the supplier (Molecular
Research Center). The RT reaction was performed using 200 U Super-
script II (Invitrogen, Burlington, Ontario, Canada) with 1 ␮g total RNA
and 7.5 ng random hexamers (Roche, Laval, Quebec, Canada) at 42 C for
50 min. The real-time PCR were performed using an ABI Prism 7000
instrument from Applied Biosystems (Foster City, CA). For each gene,
the amplification efficiency was tested using 2–5 log of concentrations
of cDNA produced from LNCaP-cell purified mRNA. The conditions for
real-time PCR are described in Table 1. For each reaction, the final
volume of 20 ␮l comprised 10 ␮l SyBr Green PCR mix, 2 ␮l of each primer
(Table 1), and 6 ␮l of a RT product (1/100 dilution for LNCaP cells and
1/20 for PrEC). Conditions for real-time PCR were 95 C for 10 min, 95
C for 15 sec, and 56 C (36B4, AR, UGT2B10, UGT2B15, UGT2B28 and 28S)
or 62 C (36B4, UGT2B4, UGT2B7, UGT2B11, and 28S) for 60 sec for 40
cycles. Cycle threshold (Ct) values were calculated by normalizing
UGT2B mRNA expression with 36B4 or with 28S. Treatment with ac-
tinomycin D and cycloheximide affected the Ct values of the house-
keeping gene 36B4; therefore, the UGT expression was normalized with
the unaffected 28S for these analyses.
Statistical analyses
A nonparametric Student’s t test was used to analyze for significant
differences between the experimental groups, by using the JMP version
5.0.2 software (SAS Institute, Cary, NC).
LC-MS/MS analyses of glucuronides formed from 3␣-Diol,
5-HETE, 12-HETE, and 13-HODE in LNCaP cells
Although the formation of 3␣-Diol-glucuronide has been
previously reported (31, 32), the position of the glucuronide
group on the steroid molecule remains to be clarified. In the
present study, the formation of 3␣-Diol-3-glucuronide and
3␣-Diol-17-glucuronide by microsomal proteins extracted
from LNCaP cells was investigated by LC-MS/MS using
synthetic standards. Furthermore, because the ability of LN-
CaP to form glucuronide conjugates of 12-HETE, 5-HETE,
and 13-HODE has never been investigated, similar experi-
ments were performed using these fatty acids as substrates.
As shown in Fig. 1, the major proportion of glucuronides
detected by LC-MS/MS corresponded to 3␣-Diol-17-gluc-
uronide, a metabolite specifically formed by microsomal
preparations of UGT2B15 and -B17 proteins (Fig. 1). By con-
trast, 3␣-Diol-3-glucuronide formation was minor in the
presence of microsomes from LNCaP cells, while being
the major glucuronidation product of 3␣-Diol formed by the
UGT2B7 isoform (Fig. 1). Interestingly, the production of
these two 3␣-Diol-glucuronide conjugates correlates to the
previously reported low levels of UGT2B7 and high levels of
UGT2B15 and -B17 expressions in LNCaP cells (30, 32). In the
presence of LNCaP cell extracts, 12-HETE and 13-HODE
were converted to polar metabolites that were detected by
LC-MS/MS at m/z and retention times corresponding to
their glucuronide derivatives (data not shown). However,
the formation of 5-HETE-glucuronide was below the limit of
detection.
R1881 treatment reduces 3␣-Diol and 13-HODE
glucuronidation but increases 12-HETE-glucuronide
formation in LNCaP cells
The effects of androgens on the metabolism of 3␣-Diol
and hydroxy-fatty acids were investigated by treating LN-
CaP cells with R1881. Previous studies demonstrated that

TABLE 1. Primers and conditions used in real-time PCR analyses

Genes Primers (5⬘–3⬘) Product (bp) Final concentration (nM) Melting temperature (C)
36B4 CCCATGTGAAGTCACTGTGC 231 125 56 or 62
GGTTGTAGATGCTGCCATTG
UGT2B4 CTGTTGTTATGTCAGAAC 140 300 62
TTCCTAGAACTTCACTGTAG
UGT2B7 CCTGCCTAAGGAAATGGAAGAC 243 125 62
AACCTTTTGTGGGATCTGGGCC
UGT2B10 ATCCCACAAAAGGTTCTT 243 125 56
GCCTTCATGTGAGCAATA
UGT2B11 AAAGGTTCTGTGGAGATTTGAC 263 125 62
GACATTGTGTTGAAGTCCAAT
UGT2B15 GTGTTGGGAATATTATGACTACAGTAAC 157 125 56
GGGTATGTTAAATAGTTCAGCCAGT
UGT2B17 TGACTTTTGGTTTCAAGC 220 300 62
TTCCATTTCCTTAGGCAA
UGT2B28 GATGGCTCTGAAG 104 300 56
GGCTGTATTCACC
AR GAAGCCATTGAGCCAGGTGT 163 125 56
TCGTCCACGTGTAAGTTGCG
28S AAACTCTGGTGGAGGTCCGT 304 125 56 or 62
CTTACCAAAAGTGGCCCACTA
The first primer is the forward and the second is the reverse.

Downloaded from endo.endojournals.org by on December 3, 2007

5434 Endocrinology, November 2006, 147(11):5431–5442 Chouinard et al. • Androgens Regulate UGT2B in Prostate Cells

FIG. 1. Gene specificity and regiospecificity of 3␣-Diol glucuronidation. Shown is a representation of the regiospecificity of glucuronidation on
3␣-Diol by LNCaP cells and stably UGT2B7-, -B15-, and -B17-transfected HEK293 cells. Chromatographic separation was performed by HPLC,
and glucuronidated metabolites were detected in the multiple reaction monitoring mode of the mass spectrometer. G, Glucuronide.

in contrast to DHT, R1881 is not a substrate for human
UGTs and is less susceptible to other metabolic pathways
(33). As expected (25–27), we observe that this treatment
resulted in a 2-fold lower formation of 3␣-Diol-17-gluc-
uronide compared with control cells (Fig. 2A). Interest-
ingly, we also observed that the glucuronidation of 13-
HODE was decreased by 3-fold (28 to 8 pmol/min/mg
proteins) in R1881-treated compared with control cells
(Fig. 2B), whereas a 2-fold increase of 12-HETE conjuga-
tion was measured (Fig. 2C). These results indicate that
R1881 differentially regulates the expression of the UGT
enzymes involved in the glucuronidation of androgens
and monohydroxy-fatty acids.
Treatment of LNCaP cells with R1881 reduces UGT2B10,
-B15, and -B17 mRNA levels but stimulates UGT2B11
gene expression
Whereas the expression and regulation of the UGT2B15
and -B17 genes in LNCaP cells are well documented (25, 26),
the presence or absence of other UGT2B members as well as
the effects of AR agonists on these enzymes were not inves-
tigated. To address this point, LNCaP cells were cultured in
the presence or absence of R1881 (10 nm) for 24 h, and the
mRNA levels of all human UGT2B enzymes were quantified
by using real-time PCR. UGT2B4, -B7, and -B28 mRNAs were
extremely low in both control and R1881-treated cells (see
Table 2), indicating that these genes are minimally expressed
in this cell line. Similarly to the drastic reduction in both
UGT2B15 and -B17 transcript concentrations (78 and 62%
reduction, respectively) (Fig. 3, A and B), UGT2B10 mRNA
levels were significantly reduced (56%) by the treatment with
R1881 (Fig. 3C). By contrast, we found that treatment with the
synthetic AR agonist resulted in 4-fold higher UGT2B11
mRNA levels compared with control cells (Fig. 3D). Inci-
dentally, LNCaP cells treated with the natural AR activator
DHT also exhibited a down-regulation of UGT2B10, -B15,
and -B17 genes and a similar induction of the UGT2B11 gene
expression (data not shown). Because previous studies in-
vestigated the negative effects that androgens exert on the
expression of androgen-conjugating UGT (25, 26, 33, 34), the

Downloaded from endo.endojournals.org by on December 3, 2007

Chouinard et al. • Androgens Regulate UGT2B in Prostate Cells Endocrinology, November 2006, 147(11):5431–5442 5435

FIG. 2. R1881 differently affects the glucuronidation of endogenous molecules in LNCaP cells. LNCaP cells were incubated in the presence or
absence of R1881 (10 nM) for 48 h, and glucuronidation assays were performed with 3␣-Diol (A), 13-HODE (B), and 12-HETE (C) and homogenized
cells as described in Materials and Methods. Relative activities were calculated with 3␣-Diol-17-glucuronide as standard or with the peak area
of glucuronide metabolite for the other aglycons and corrected according to the time of incubation and quantity of proteins. Values are means ⫾
SEM (n ⫽ 6; two experiments in triplicate). Statistically significant differences between vehicle- and R1881-treated cells are indicated: *, P ⬍
0.05; **, P ⬍ 0.01; ***, P ⬍ 0.001 (Student’s t test).

present study was aimed at characterizing the positive reg- ses, using specific antibodies. Although the anti-UGT2B15
ulation of UGT2B11, which was then compared with the antiserum was previously characterized (29), the specificity
reduction in UGT2B15 expression. of the antibody raised against the UGT2B11 peptide re-
Time-course and dose-response experiments were per- mained to be established. For this purpose, 10 ␮g microsomal
formed by incubating LNCaP cells in the presence of R1881 proteins of HEK293 cells stably expressing human UGT2B4,
(10 nm) for 6, 12, 18, 24, 48, and 72 h or in the presence of -B7, -B10, -B11, -B15, or B17 proteins were size separated by
R1881 at different concentrations (0.1, 0.5, 1, 2, 5, and 10 nm) SDS-PAGE and immunoblotted with the anti-UGT2B15 or
for 24 h (Fig. 4). These experiments reveal that the induction -2B11 antisera (Fig. 5, B and C). As expected, the anti-
of UGT2B11 mRNA levels occurred as early as 6 h of treat- UGT2B15 specifically bound the corresponding protein (26,
ment to reach a maximal activation (⬎150-fold) after 72 h 29). By contrast, the anti-UGT2B11 antiserum recognized
(Fig. 4A). On the other hand, inhibition of UGT2B15 expres- both UGT2B10 and -B11 proteins but remained specific for
sion started only after 12 h of treatment and reached unde- these isoforms because no binding was detected with other
tectable levels at 72 h of R1881 treatment (Fig. 4B). In addi- UGT2B enzymes (Fig. 5B). Equal loading of each lane was
tion, the induction of the UGT2B11 mRNA level occurred at ensured by immunoblotting the same membrane with the
0.5 nm R1881 to reach a maximal activation at 2 nm (Fig. 4C). anti-calnexin antibody as a control (Fig. 5A). Subsequently,
For UGT2B15, the inhibition was detected in the presence of microsomal proteins from LNCaP cells treated with R1881
a very low concentration of R1881 (0.1 nm), with a maximal for 48 h were probed with these antibodies. The expression
effect at 0.5 nm (Fig. 4D). of calnexin remained unchanged within treated cells,
whereas the protein levels of UGT2B15 were drastically de-
R1881 also affects UGT2B11 and -B15 protein levels in creased (Fig. 5, A, and C). By contrast, the anti-UGT2B10-B11
LNCaP cells antibody revealed an accumulation of proteins in microso-
The effect of the R1881 treatment on UGT2B11 and -B15 mal fractions from treated compared with control cells (Fig.
protein expression was investigated by Western blot analy- 5B, treatments 1 and 2). Considering that R1881 treatment
resulted in a 50% reduction of UGT2B10 mRNA levels after
TABLE 2. Expression levels of UGT2B enzymes in LNCaP cells
24 h (Fig. 3), this protein accumulation likely reflects higher
and PrEC concentrations of the UGT2B11 protein. These analyses dem-
onstrate that activation of AR with the synthetic agonist
Genes LNCaP PrEC differently affects UGT2B expression at both mRNA and
UGT2B4 ⫾ ⫺ protein levels.
UGT2B7 ⫾ ⫺
UGT2B10 ⫹⫹ ⫺
UGT2B11 ⫹⫹⫹ ⫹ UGT2B11 expression is found in epithelial cells of the
UGT2B15 ⫹⫹⫹ ⫹ human prostate and R1881 dose-dependently regulates
UGT2B17 ⫹⫹ ⫺ UGT2B11 and -B15 gene expression in PrEC
UGT2B28 ⫺ ⫺
AR ⫹⫹⫹ ⫹ Previous analyses showed that UGT proteins are ex-
Ct values are designated as follows: ⫺, Ct ⱖ 40; ⫾, 40 ⬍ Ct ⱖ 37; pressed in a cell-type-specific manner in the human prostate
⫹, 37 ⬍ Ct ⱖ 34; ⫹⫹, 34 ⬍ Ct ⱖ 31; ⫹⫹⫹, 31 ⬍ Ct. epithelium, with UGT2B17 found in basal and UGT2B15 in

Downloaded from endo.endojournals.org by on December 3, 2007

5436 Endocrinology, November 2006, 147(11):5431–5442 Chouinard et al. • Androgens Regulate UGT2B in Prostate Cells

FIG. 3. R1881 treatment reduces

UGT2B15 (A), -B17 (B), and -B10 (C)
mRNA levels but strongly induces
UGT2B11 (D) expression in LNCaP
cells. LNCaP cells were incubated in the
presence or absence of R1881 at 10 nM
for 24 h, and the UGT2B mRNA content
was quantified using real-time PCR as
described in Materials and Methods.
UGT2B mRNA levels were normalized
with the 36B4 mRNA concentration.
Values are means ⫾ SEM (n ⫽ 6; two
experiments in triplicate). Statistically
significant differences between vehicle-
and R1881-treated cells are indicated:
**, P ⬍ 0.01 (Student’s t test).

luminal cells (29). Therefore, immunohistochemical analyses
were performed with the specific antibody against
UGT2B10-B11 to determine in which cells of the human
prostate UGT2B11 is expressed. Considering that the
UGT2B10 enzyme is not found in the human prostate (17),
the results demonstrate that UGT2B11 is localized in both
luminal and basal epithelial cells of the human prostate (Fig.
6A). The absence of signal when the anti-UGT2B10-B11 was
preincubated with the corresponding protein demonstrates
the specificity of the binding.
Subsequently and to determine whether the androgen-
dependent regulation of UGT2B11 and -B15 expression also
occurs in noncarcinogenic cells, we analyzed the effects of
R1881 (0.1, 1, and 10 nm) on UGT2B expression in human
primary PrEC (Fig. 6). As shown in Table 2, of the seven
enzymes, only UGT2B11 and -B15 were found to be ex-
pressed in this preparation of prostate cells. Furthermore, a
significant expression of the androgen receptor was detected
in these cells (Table 2). We also observed that R1881 dose-
dependently increased the concentration of UGT2B11 tran-
scripts, whereas the UGT2B15 gene expression was inhibited
(Fig. 6, B and C). In addition, as in LNCaP cells, the con-
centration of UGT2B11 protein was induced in R1881-treated
PrEC (1 nm for 48 h), whereas the same treatment resulted
in a drastic reduction of the UGT2B15 protein contents (Fig.
6D). These observations demonstrate that androgens act as
regulators of UGT2B11 and -B15 genes in both proliferative
LNCaP cells and noncancer PrEC.
AR controls UGT2B11 and -B15 genes expression
Upon ligand-dependent activation, AR positively regu-
lates gene expression through direct binding to DNA (35).
We ascertained the involvement of AR in the R1881-depen-
dent regulation of UGT2B enzymes by using the pure AR
antagonist Casodex, and we investigated whether R1881-
activated AR modulates UGT2B mRNA levels by acting di-
rectly on the corresponding gene by using inhibitors of gene
transcription (actinomycin D) or of protein synthesis (cyclo-
heximide) (Fig. 7). As expected, incubation of LNCaP in the
presence of R1881 resulted in reduced UGT2B15 and in-
creased UGT2B11 mRNA levels (Fig. 7, A and B). However,

Downloaded from endo.endojournals.org by on December 3, 2007

Chouinard et al. • Androgens Regulate UGT2B in Prostate Cells Endocrinology, November 2006, 147(11):5431–5442 5437

FIG. 4. R1881 treatment induces UGT2B11 mRNA levels (A and C) but reduces the UGT2B15 gene expression (B and D) in a time-dependent
(A and B) and dose-dependent (C and D) manner. LNCaP cells were incubated either in the presence or absence of R1881 (10 nM) for different
durations (6, 12, 18, 24, 48, and 72 h) (A and B) or in the presence or absence of increasing amounts of R1881 (0.1, 0.5, 1, 2, 5, and 10 nM) for
48 h (C and D) and mRNA content was quantified using real-time PCR as described in Materials and Methods. UGT2B mRNA levels were
normalized with the 36B4 mRNA concentration. Values are means ⫾ SEM (n ⫽ 6; two experiments in triplicate). Statistically significant
differences between vehicle- and R1881-treated cells are indicated: *, P ⬍ 0.05; **, P ⬍ 0.01; ***, P ⬍ 0.001 (Student’s t test).

coincubation with Casodex significantly affected the re-
sponse of both UGT2B15 (Fig. 7A) and UGT2B11 (Fig. 7B)
genes to R1881, indicating that AR mediates the differential
FIG. 5. R1881 increases UGT2B11 protein levels while reducing
other UGT2B protein contents in LNCaP cells. LNCaP cells were
incubated in the presence or absence of R1881 at 10 nM for 48 h, and
microsomal proteins were subsequently purified and immunoblotted
using anti-calnexin (A, internal control), anti-UGT2B10-B11 (B), and
anti-UGT2B15 (C) antibodies. Specificities of the antibodies were
assessed by using microsomal proteins from HEK293 cells stably
expressing UGT2B4, -B7, -B10, -B11, -B15, and -B17 proteins.
regulation of these genes in the presence of natural or syn-
thetic androgens. Furthermore, we also observed that pre-
incubation with actinomycin D also abolished the R1881-
dependent regulation of UGT2B15 and UGT2B11 genes
expression (Fig. 7, C and D). By contrast, in the presence of
cycloheximide, R1881 retained its inducing effect on the
UGT2B11 gene expression (Fig. 7D) but failed to significantly
reduce UGT2B15 mRNA levels (Fig. 7C). Together these ob-
servations indicate that R1881 regulates UGT2B11 and
UGT2B15 genes in a transcriptional manner that involves
AR. Despite that this regulatory effect is direct in the case of
UGT2B11, it requires de novo protein synthesis in the case of
UGT2B15.
Effects of IL-1␣ and EGF on UGT2B11 expression in
LNCaP cells
It was previously shown that IL-1␣ and EGF exert op-
posite effects on LNCaP cell proliferation; a stimulation is
observed with EGF treatment, whereas IL-1␣ inhibits the
growth of these prostate cancer cells (26, 27). Both factors

Downloaded from endo.endojournals.org by on December 3, 2007

5438 Endocrinology, November 2006, 147(11):5431–5442 Chouinard et al. • Androgens Regulate UGT2B in Prostate Cells

FIG. 6. UGT2B11 protein is localized in luminal and basal cells of the human prostate (A), and R1881 dose-dependently regulates UGT2B11
(B) and -B15 (C) mRNA levels as well as quantity of UGT2B11 and -B15 proteins (D) in PrEC in the same manner as in LNCaP cells. A,
Immunohistochemistry analysis (⫻20 magnification) using the preimmune serum, the specific anti-UGT2B10-B11 antibody, or antisera
anti-UGT2B10-B11 preincubated with the corresponding microsomal preparation of stably transfected HEK293 cells performed on a slide of

Downloaded from endo.endojournals.org by on December 3, 2007

Chouinard et al. • Androgens Regulate UGT2B in Prostate Cells Endocrinology, November 2006, 147(11):5431–5442 5439

FIG. 7. AR agonist differently modulates UGT2B gene expression in LNCaP cells via a direct or indirect transcriptional mechanism. A and B,
LNCaP cells were treated for 48 h with ethanol (vehicle) or R1881 (1 nM) in the presence or absence of Casodex (5 ␮M). C and D, LNCaP cells
were incubated for 24 h with ethanol (vehicle) or R1881 (10 nM) in the absence or presence of cycloheximide (20 ␮g/ml) or after a pretreatment
(2 h) with actinomycin D (1 ␮g/ml). mRNA was extracted and analyzed by real-time PCR using specific oligonucleotides for UGT2B15 (A and
C) and -B11 (B and D). UGT mRNA levels were normalized with 36B4 (A and B) or 28S (C and D). Values are means ⫾ SEM (n ⫽ 6; two experiments
in triplicate). In A and B, values followed by different letters are statistically significantly different at P ⬍ 0.05 (Student’s t test). In C and D,
statistically significant differences are indicated by asterisks: *, P ⬍ 0.05; **, P ⬍ 0.01 (Student’s t test).

induce, however, a marked down-regulation in UGT2B17
expression without affecting the level of UGT2B15 tran-
scripts (26, 27), suggesting that the modulation of the two
androgen-conjugating enzymes is dissociated from the
modulation in cell proliferation. In the present study, the
effects of IL-1␣ and EGF treatments were investigated on
UGT2B10, -B11, and -B17 (positive control) gene expres-
sion. As expected (26, 27), IL-1␣ and EGF treatments di-
minished the levels of UGT2B17 transcripts (Fig. 8A).
However, the UGT2B11 transcripts concentration re-
mained unaffected (Fig. 8C), and UGT2B10 expression was
significantly stimulated by IL-1␣ treatment while being
not affected in the presence of EGF (Fig. 8B). These ob-
servations also indicate dissociation between modulation
of cell proliferation and action of IL-1␣ and EGF on UGT2B
transcripts in LNCaP cells.
Discussion
In the present study, we report that activation of LNCaP
cancer cells with synthetic or natural androgens affects the
metabolism of not only 5␣-reduced C19 steroids but also of

human prostate revealed that the UGT2B11 is expressed in both basal (arrowhead) and luminal (arrow) cells of the prostate epithelium. B and
C, PrEC were incubated either in the absence or presence of increasing amounts of R1881 (0.1, 1, and 10 nM) for 48 h, and total RNA was extracted
and analyzed by real-time PCR for UGT2B11 (B) and -B15 (C) expression. UGT2B mRNA levels were normalized with 36B4. Values are means ⫾
SEM (n ⫽ 6; two experiments in triplicate). Statistically significant differences are indicated: **, P ⬍ 0.01; ***, P ⬍ 0.001 (Student’s t test). D,
Total proteins (30 ␮g) from PrEC treated or not with R1881 (1 nM) for 48 h were immunoblotted with the anti-calnexin (a, internal control),
anti-UGT2B10-B11 (b), or anti-UGT2B15 (c) antibodies.

Downloaded from endo.endojournals.org by on December 3, 2007

5440 Endocrinology, November 2006, 147(11):5431–5442 Chouinard et al. • Androgens Regulate UGT2B in Prostate Cells

FIG. 8. IL-1␣ and EGF differently affect UGT2B expression in LNCaP cells. LNCaP cells were incubated in the presence or absence of IL-1␣
(2 ng/ml) or EGF (10 ng/ml) for 24 h. mRNA was extracted and analyzed by real-time PCR using specific oligonucleotides for UGT2B17 (A),
-B10 (B), and -B11 (C). mRNA expression was normalized with 36B4. Values are means ⫾ SEM (n ⫽ 6; two experiments in triplicate). Statistically
significant differences are indicated: ***, P ⬍ 0.001 (Student’s t test).

monohydroxy-fatty acids. Treatment of LNCaP cells with
androgens resulted in a drastic reduction of 3␣-Diol and
13-HODE glucuronidation but in an enhanced formation of
12-HETE-glucuronide. Numerous studies established the
importance of androgen glucuronidation as a major meta-
bolic pathway of androgen inactivation in normal and can-
cerous prostate tissues, thus suggesting glucuronidation as a
protective mechanism against prostate cancer (9, 26, 34, 36 –
40). By contrast, the role of LA and AA glucuronidation in
this tissue is poorly understood. In fact, only recent studies
revealed the presence in prostate cells of 12- and 15-LOX-1
enzymes capable of converting LA and AA into biologically
active hydroxylated metabolites (41). In this tissue, the lo-
cally produced 13-HODE displays mitogenic effects,
whereas 12-HETE induces angiogenesis (7, 42– 44). The
present study indicates that these active monohydroxy-fatty
acids that are formed in the human prostate are also inac-
tivated as glucuronide derivatives in a prostate cancer cell
line.
Among the UGT enzymes expressed in LNCaP cells (Table
2), only UGT2B10, -B11, and -B17 catalyze the glucuronide
conjugation of 13-HODE (10). Thus, the decrease in glucu-
ronidation of this substrate by R1881-treated LNCaP cells
suggests that this molecule is mainly conjugated by
UGT2B10 and -B17, whereas UGT2B11 (the expression of
which is strongly induced upon androgen treatment) is less
efficient for glucuronidating this substrate. By contrast, the
conjugation of 12-HETE, which is a substrate for UGT2B10,
-B11, and -B15, was increased in treated compared with con-
trol cells, which may reflect the accumulation of the
UGT2B11 protein. Overall, these observations indicate that
the inhibitory effect on 13-HODE glucuronidation is a result
of the reduction in UGT2B10 and -B17 activity, whereas the
relatively small stimulatory effect observed for 12-HETE re-
flects both the reduction of UGT2B10 and -B15 expression
and the induction of the UGT2B11 enzyme. Furthermore, it
is interesting to note that UGT2B10 expression, like that of
-B15 and -B17, is drastically reduced in the presence of an-
drogens (25). Considering the high nucleotide sequence ho-
mology between coding regions of the UGT2B10 and -B11
genes (45) and their similar substrate specificity, which is
restricted to hydroxy-fatty acids (10), it could have been
anticipated that both enzymes would be regulated in a sim-
ilar manner, as observed with UGT2B15 and -B17, two highly
homologous proteins (30). Therefore, the differential regu-
lation of UGT2B10 and -B11 by androgens indicates that the
high sequence homology of these genes may not be extended
to the 5⬘-flanking regions or that minor nucleotide changes
in these regions may alter their responding property to an-
drogens. Nevertheless, the results of the present study clearly
demonstrate that androgens regulate differently the expres-
sion of the four UGT2B genes expressed in LNCaP cells. In
addition, the data indicate that UGT2B11 is modulated by a
direct action of the androgen receptor in its gene, whereas
regulation of UGT2B15 transcripts by androgen necessitated
the synthesis of intermediary protein. However, the impli-
cation of AR in the regulation of both genes is consistent with
their cellular localization into luminal secretory cells of the
prostate epithelium, where AR is expressed (20, 46).
Previous studies established that androgens reduce the
expression and activity of androgen-conjugating UGT en-
zymes, i.e. UGT2B15 and -B17, in prostate carcinoma cells
(25–27, 33, 34). Those negative regulatory effects were closely
associated with an increased growth and proliferation of
prostate cancer LNCaP cells (25). Here, we observe that the
androgen-dependent regulation of UGT2B gene expression
resulted in a reduced glucuronidation of 13-HODE and in
increased production of 12-HETE-glucuronide. Kelavkar et
al. (44) recently demonstrated that the 15-LOX-1 metabolite
of LA, 13-HODE, is a strong stimulator of prostate cancer cell
proliferation. It is therefore tempting to speculate that the
reduced glucuronidation of this compound may increase the
cellular concentration of unconjugated 13-HODE, thus fur-
ther enhancing its proliferative activity. In addition, these

Downloaded from endo.endojournals.org by on December 3, 2007

Chouinard et al. • Androgens Regulate UGT2B in Prostate Cells
observations also suggest that reduction of 13-HODE glu-
curonidation in the presence of AR agonists is part of the
complex manner in which androgens stimulate prostate can-
cer cell proliferation and tumor growth. Interestingly, treat-
ment of LNCaP cells with EGF, which stimulates LNCaP cell
proliferation, has no effect on the expression of conjugating
UGT2B10 and -B11 enzymes, whereas UGT2B17 expression
is markedly inhibited, thus suggesting a diminution in 13-
HODE glucuronidation. It is therefore possible that the in-
crease in endogenous 13-HODE levels caused by the EGF
treatment may also facilitate the action of EGF on MAPK
activity, on peroxisome proliferator-activated receptor-␥
phosphorylation, and finally, on cell proliferation as recently
demonstrated by Hsi et al. (47). By contrast, the slight increase
in UGT2B10 expression observed in the presence of IL-1␣
may contribute to the previously reported inhibitory effect of
the cytokine on LNCaP cell proliferation. We also observe
that R1881-treated LNCaP cells produce higher concentra-
tions of 12-HETE glucuronide. Although this effect was less
marked than the reduction of 13-HODE glucuronidation, this
would also mean that androgens, by stimulating 12-HETE
glucuronidation, reduce the angiogenic and metastatic ef-
fects of 12-LOX metabolite (48). IL-1␣, which stimulates the
level of UGT2B10 transcript, may also exert the same effect
on 12-HETE levels. Whereas the pathophysiological conse-
quences of such findings remain to be fully understood, the
present study is the first reporting that the metabolism of
hydroxy-fatty acids is under the control of androgens in
prostate cells. However, additional analyses on the role of
UGT2B enzymes in the control of the biological activity of AA
and LA metabolites are required to fully understand the
consequences of the androgen-, cytokine-, and growth-fac-
tor-dependent regulation of UGTs for the carcinogenicity of
these hydroxy-fatty acids.
In summary, the present data establish that treatments of
normal and prostate cancer cells with androgens influence
the expression of UGT2B enzymes in an isoform-specific
manner. These enzymes are implicated in the local inacti-
vation of endogenous substrates, namely androgens and mo-
nohydroxy-fatty acids, and this may contribute to alter their
intracellular concentrations and actions. Finally, this study
reveals for the first time a physiological link between an-
drogens and hydroxy-fatty acids in prostate cells during
carcinogenesis.
Acknowledgments
We thank Patrick Caron and David Poisson-Paré for technical assis-
tance with liquid chromatography and immunostaining analysis, re-
spectively. We also thank Dr. Virginie Bocher for the critical reading of
this manuscript.
Received February 23, 2006. Accepted July 17, 2006.
Address all correspondence and requests for reprints to: Olivier Bar-
bier or Alain Bélanger, Oncology and Molecular Endocrinology Re-
search Center, CHUL Research Center, 2705 Laurier Boulevard Bloc
T3-67, Québec, Canada G1V 4G2. E-mail: olivier.barbier@pha.ulaval.ca
or alain.belanger@ap.ulaval.ca.
This work was supported by the Canadian Institutes of Health Re-
search (CIHR; MOP-64273) and the Fonds de la Recherche en Santé du
Québec. S.C. is holder of a scholarship from the Fonds de la Recherche
en Santé du Québec. O.B. is granted by the Health Research Foundation
of Rx&D-CIHR.
Downloaded from endo.endojournals.org by on December 3, 2007
Endocrinology, November 2006, 147(11):5431–5442 5441
Disclosure statement: The authors have nothing to disclose.
References
1. Soronen P, Laiti M, Torn S, Harkonen P, Patrikainen L, Li Y, Pulkka A,
Kurkela R, Herrala A, Kaija H, Isomaa V, Vihko P 2004 Sex steroid hormone
metabolism and prostate cancer. J Steroid Biochem Mol Biol 92:281–286
2. McCarty MF 2004 Targeting multiple signaling pathways as a strategy for
managing prostate cancer: multifocal signal modulation therapy. Integr Can-
cer Ther 3:349 –380
3. Matsuyama M, Yoshimura R, Mitsuhashi M, Hase T, Tsuchida K, Takemoto
Y, Kawahito Y, Sano H, Nakatani T 2004 Expression of lipoxygenase in human
prostate cancer and growth reduction by its inhibitors. Int J Oncol 24:821– 827
4. Gao X, Grignon DJ, Chbihi T, Zacharek A, Chen YQ, Sakr W, Porter AT,
Crissman JD, Pontes JE, Powell IJ, Honn KV 1995 Elevated 12-lipoxygenase
mRNA expression correlates with advanced stage and poor differentiation of
human prostate cancer. Urology 46:227–237
5. Nithipatikom K, Isbell MA, See WA, Campbell WB 2006 Elevated 12- and
20-hydroxyeicosatetraenoic acid in urine of patients with prostatic diseases.
Cancer Lett 233:219 –225
6. Kelavkar UP, Cohen C, Kamitani H, Eling TE, Badr KF 2000 Concordant
induction of 15-lipoxygenase-1 and mutant p53 expression in human prostate
adenocarcinoma: correlation with Gleason staging. Carcinogenesis 21:1777–
1787
7. Kelavkar U, Cohen C, Eling T, Badr K 2002 15-Lipoxygenase-1 overexpression
in prostate adenocarcinoma. Adv Exp Med Biol 507:133–145
8. Catalano A, Procopio A 2005 New aspects on the role of lipoxygenases in
cancer progression. Histol Histopathol 20:969 –975
9. Bélanger A, Pelletier G, Labrie F, Barbier O, Chouinard S 2003 Inactivation
of androgens by UDP-glucuronosyltransferase enzymes in humans. Trends
Endocrinol Metab 14:473– 479
10. Turgeon D, Chouinard S, Bélanger P, Picard S, Labbe JF, Borgeat P, Bélanger
A 2003 Glucuronidation of arachidonic and linoleic acid metabolites by human
UDP-glucuronosyltransferases. J Lipid Res 44:1182–1191
11. Jude AR, Little JM, Bull AW, Podgorski I, Radominska-Pandya A 2001
13-Hydroxy- and 13-oxooctadecadienoic acids: novel substrates for human
UDP-glucuronosyltransferases. Drug Metab Dispos 29:652– 655
12. Mackenzie PI, Walter Bock K, Burchell B, Guillemette C, Ikushiro SI, Iy-
anagi T, Miners JO, Owens IS, Nebert DW 2005 Nomenclature update for the
mammalian UDP glycosyltransferase (UGT) gene superfamily. Pharmaco-
genet Genomics 15:677– 685
13. Dutton GJ 1980 Glucuronidation of drugs and other compounds. Boca Raton,
FL: CRC Press
14. Radominska-Pandya A, Little JM, Czernik PJ 2001 Human UDP-glucurono-
syltransferase 2B7. Curr Drug Metab 2:283–298
15. Lévesque E, Beaulieu M, Hum DW, Bélanger A 1999 Characterization and
substrate specificity of UGT2B4(E458): a UDP-glucuronosyltransferase en-
coded by a polymorphic gene. Pharmacogenetics 9:207–216
16. King CD, Rios GR, Green MD, Tephly TR 2000 UDP-glucuronosyltrans-
ferases. Curr Drug Metab 1:143–161
17. Turgeon D, Carrier J-S, Lévesque E, Hum DW, Bélanger A 2001 Relative
enzymatic activity, protein stability and tissue distribution of human steroid
metabolizing UGT2B subfamily members. Endocrinology 142:778 –787
18. Little JM, Kurkela M, Sonka J, Jantti S, Ketola R, Bratton S, Finel M,
Radominska-Pandya A 2004 Glucuronidation of oxidized fatty acids and
prostaglandins B1 and E2 by human hepatic and recombinant UDP-glucu-
ronosyltransferases. J Lipid Res 45:1694 –1703
19. Chen F, Ritter JK, Wang MG, McBride OW, Lubet RA, Owens IS 1993
Characterization of a cloned human dihydrotestosterone/androstanediol
UDP-glucuronosyltransferase and its comparison to other steroid isoforms.
Biochemistry 32:10648 –10657
20. Barbier O, Lapointe H, El Alfy M, Hum DW, Bélanger A 2000 Cellular
localization of uridine diphosphoglucuronosyltransferase 2B enzymes in the
human prostate by in situ hybridization and immunohistochemistry. J Clin
Endocrinol Metab 85:4819 – 4826
21. Guillemette C, Hum DW, Bélanger A 1996 Evidence for a role of glucurono-
syltransferase in the regulation of androgen action in the human prostatic
cancer cell line LNCaP. J Steroid Biochem Mol Biol 57:225–231
22. Koh E, Kanaya J, Namiki M 2001 Adrenal steroids in human prostatic cancer
cell lines. Arch Androl 46:117–125
23. Little JM, Williams L, Xu J, Radominska-Pandya A 2002 Glucuronidation of
the dietary fatty acids, phytanic acid and docosahexaenoic acid, by human
UDP-glucuronosyltransferases. Drug Metab Dispos 30:531–533
24. Kester MH, Bulduk S, van Toor H, Tibboel D, Meinl W, Glatt H, Falany CN,
Coughtrie MW, Schuur AG, Brouwer A, Visser TJ 2002 Potent inhibition of
estrogen sulfotransferase by hydroxylated metabolites of polyhalogenated
aromatic hydrocarbons reveals alternative mechanism for estrogenic activity
of endocrine disrupters. J Clin Endocrinol Metab 87:1142–1150
25. Guillemette C, Hum DW, Bélanger A 1996 Regulation of steroid glucurono-
syltransferase activities and transcripts by androgen in the human prostatic
cancer LNCaP cell line. Endocrinology 137:2872–2879
26. Guillemette C, Lévesque E, Beaulieu M, Turgeon D, Hum DW, Bélanger A
5442 Endocrinology, November 2006, 147(11):5431–5442
1997 Differential regulation of two uridine diphospho-glucuronosyltrans-
ferases, UGT2B15 and UGT2B17, in human prostate LNCaP cells. Endocri-
nology 138:2998 –3005
27. Lévesque E, Beaulieu M, Guillemette C, Hum DW, Bélanger A 1998 Effect
of interleukins on UGT2B15 and UGT2B17 steroid uridine diphosphate-glu-
curonosyltransferase expression and activity in the LNCaP cell line. Endocri-
nology 139:2375–2381
28. Sun XY, Plouzek CA, Henry JP, Wang TT, Phang JM 1998 Increased UDP-
glucuronosyltransferase activity and decreased prostate specific antigen pro-
duction by biochanin A in prostate cancer cells. Cancer Res 58:2379 –2384
29. Chouinard S, Pelletier G, Bélanger A, Barbier O 2004 Cellular specific ex-
pression of the androgen-conjugating enzymes UGT2B15 and UGT2B17 in the
human prostate epithelium. Endocr Res 30:717–725
30. Beaulieu M, Lévesque E, Hum DW, Bélanger A 1996 Isolation and charac-
terization of a novel cDNA encoding a human UDP-glucuronosyltransferase
active on C19 steroids. J Biol Chem 271:22855–22862
31. Guillemette C, Hum DW, Bélanger A 1995 Specificity of glucuronosyltrans-
ferase activity in the human cancer cell line LNCaP, evidence for the presence
of at least two glucuronosyltransferase enzymes. J Steroid Biochem Mol Biol
55:355–362
32. Bélanger G, Beaulieu M, Marcotte B, Lévesque E, Guillemette C, Hum DW,
Bélanger A 1995 Expression of transcripts encoding steroid UDP-glucurono-
syltransferases in human prostate hyperplastic tissue and the LNCaP cell line.
Mol Cell Endocrinol 113:165–173
33. Beaulieu M, Lévesque E, Tchernof A, Beatty BG, Bélanger A, Hum DW 1997
Chromosomal localization, structure, and regulation of the UGT2B17 gene,
encoding a C19 steroid metabolizing enzyme. DNA Cell Biol 16:1143–1154
34. Turgeon D, Carrier JS, Lévesque E, Beatty BG, Bélanger A, Hum DW 2000
Isolation and characterization of the human UGT2B15 gene, localized within
a cluster of UGT2B genes and pseudogenes on chromosome 4. J Mol Biol
295:489 –504
35. Heinlein CA, Chang C 2002 The roles of androgen receptors and androgen-
binding proteins in nongenomic androgen actions. Mol Endocrinol 16:2181–
2187
36. Hajdinjak T, Zagradisnik B 2004 Prostate cancer and polymorphism D85Y in
gene for dihydrotestosterone degrading enzyme UGT2B15: frequency of DD
homozygotes increases with Gleason score. Prostate 59:436 – 439
37. Kanaya J, Takashima M, Koh E, Namiki M 2003 Androgen-independent
Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the
endocrine community.
Downloaded from endo.endojournals.org by on December 3, 2007
Chouinard et al. • Androgens Regulate UGT2B in Prostate Cells
growth in LNCaP cell lines and steroid uridine diphosphate-glucuronosyl-
transferase expression. Asian J Androl 5:9 –13
38. MacLeod SL, Nowell S, Plaxco J, Lang NP 2000 An allele-specific polymerase
chain reaction method for the determination of the D85Y polymorphism in the
human UDP-glucuronosyltransferase 2B15 gene in a case-control study of
prostate cancer. Ann Surg Oncol 7:777–782
39. Park J, Chen L, Shade K, Lazarus P, Seigne J, Patterson S, Helal M, Pow-Sang
J 2004 Asp85tyr polymorphism in the UDP-glucuronosyltransferase (UGT)
2B15 gene and the risk of prostate cancer. J Urol 171:2484 –2488
40. Lévesque E, Beaulieu M, Green MD, Tephly TR, Bélanger A, Hum DW 1997
Isolation and characterization of UGT2B15(Y85): a UDP-glucuronosyltrans-
ferase encoded by a polymorphic gene. Pharmacogenetics 7:317–325
41. Nie D, Che M, Grignon D, Tang K, Honn KV 2001 Role of eicosanoids in
prostate cancer progression. Cancer Metastasis Rev 20:195–206
42. Pidgeon GP, Tang K, Cai YL, Piasentin E, Honn KV 2003 Overexpression of
platelet-type 12-lipoxygenase promotes tumor cell survival by enhancing ␣v␤3
and ␣v␤5 integrin expression. Cancer Res 63:4258 – 4267
43. Shappell SB, Gupta RA, Manning S, Whitehead R, Boeglin WE, Schneider
C, Case T, Price J, Jack GS, Wheeler TM, Matusik RJ, Brash AR, Dubois RN
2001 15S-Hydroxyeicosatetraenoic acid activates peroxisome proliferator-acti-
vated receptor ␥ and inhibits proliferation in PC3 prostate carcinoma cells.
Cancer Res 61:497–503
44. Kelavkar U, Glasgow W, Eling TE 2002 The effect of 15-lipoxygenase-1 ex-
pression on cancer cells. Curr Urol Rep 3:207–214
45. Beaulieu M, Lévesque E, Hum DW, Bélanger A 1998 Isolation and charac-
terization of a human orphan UDP-glucuronosyltransferase, UGT2B11. Bio-
chem Biophys Res Commun 248:44 –50
46. Leav I, McNeal JE, Kwan PW, Komminoth P, Merk FB 1996 Androgen
receptor expression in prostatic dysplasia (prostatic intraepithelial neoplasia)
in the human prostate: an immunohistochemical and in situ hybridization
study. Prostate 29:137–145
47. Hsi LC, Wilson LC, Eling TE 2002 Opposing effects of 15-lipoxygenase-1 and
-2 metabolites on MAPK signaling in prostate. Alteration in peroxisome pro-
liferator-activated receptor ␥. J Biol Chem 277:40549 – 40556
48. Nie D, Nemeth J, Qiao Y, Zacharek A, Li L, Hanna K, Tang K, Hillman GG,
Cher ML, Grignon DJ, Honn KV 2003 Increased metastatic potential in human
prostate carcinoma cells by overexpression of arachidonate 12-lipoxygenase.
Clin Exp Metastasis 20:657– 663