Molecular Ecology (1998) 7, 933Ð944

Microsatellite analysis of demographic genetic structure

in fragmented populations of the tropical tree
Symphonia globulifera
P R E S T O N R . A L D R I C H , * à J . L . H A M R I C K , PA U L C H AVA R R I A G A , * a n d G A RY K O C H E RT *
*Botany Department, University of Georgia, Athens, GA 30605, USA, Botany and Genetics Departments, University of Georgia,
Athens, GA 30605, USA

Abstract

We developed genetic markers for three microsatellite loci in the tropical tree Symphonia
globulifera and used them to examine the demographic genetic consequences of forest
fragmentation. High levels of genetic variation were revealed in samples of adults,
saplings, and seedlings. The more-variable loci exhibited less stability in allelic composi-
tion across sites and stages. The number of alleles per hectare (ha) of forest was similar
when continuous forest plots were compared to plots from fragmented forest for all three
stages. This pattern also held for the number of unique multilocus adult and sapling
genotypes, but the number of unique seedling genotypes per ha of fragmented forest
greatly exceeded expectations based on continuous forest data, probably due to the con-
centration of seeds into remnant forest patches by foraging bats. Significant inbreeding
and genetic differentiation were most often associated with the fragmented forest and the
seedlings. Finally, principal component analysis reaffirmed that a bottleneck, acting in
concert with pre-existing genetic structure in the adults, had led to enhanced and rapid
divergence in the seedlings following deforestation, a result that is of central interest for
landscape management.
Keywords: demography, fragmentation, genetic diversity, genetic structure, microsatellites,
tropical trees

Received 9 September 1997; revision received 7 January 1998; accepted 7 January 1998

Introduction maintain substantial amounts of genetic variation, most

Numerous studies have documented the influence of
tropical deforestation on community and ecosystem pro-
cesses (Laurance & Bierregaard 1997). A smaller amount
of empirical evidence exists regarding the genetic conse-
quences of fragmentation for populations in the physiog-
nomically dominant portion of tropical forests, the trees
(reviewed by Nason et al. 1997). Until recently, research on
the genetics of tropical trees was confined largely to
allozyme studies of the genetic structure of adults in con-
tinuous forest (e.g. Hamrick & Loveless 1989; Hamrick &
Murawski 1991). These indicated that tropical tree species
Correspondence: P. R. Aldrich.
àPresent address: Botany Department, NHB-166, National
Museum of Natural History, Smithsonian Institution, Washington,
D.C. 20560, USA. Fax: +01-202-786-2563; E-mail: aldrich.preston@
nmnh.si.edu
of which resides within, rather than among, populations.
More recently, a few studies have sought to determine
the influence of forest fragmentation on tropical tree
genetic structure. For example, Hall et al. (1994) found
indirect evidence for limited gene flow in Pentaclethra
macroloba among sites in a fragmented terrain, and Prober
& Brown (1994) linked levels of genetic variation to patch
size in Eucalyptus albens. If the time since deforestation is
much less than the lifespan of the tree species, however,
data from adult cohorts will reveal less about current rates
of differentiation and more about pre-existing genetic
structure. Nonetheless, this may prove critical in deter-
mining population genetic trajectories (Nason et al. 1997).
The influence of fragmentation on genetic structure at
the gametophytic stage has been addressed through
mating-system studies (e.g. Murawski et al. 1994; James
et al. 1998) and through estimates of pollen dispersal (e.g.
Nason et al. 1996). These studies are sensitive to short-term

© 1998 Blackwell Science Ltd

934 P. R . A L D R I C H E T A L .
perturbations in the pollination system, a critical portion
of the life cycle. However, the estimates fail to incorporate
the influence of seed dispersal and may misrepresent long-
term patterns of effective fecundity, inbreeding, and gene
flow in a population (Aldrich 1997; Aldrich & Hamrick
1998).
Very few studies have explored the genetic structure of
tropical tree populations from a multistage, demographic
perspective involving adults as well as advanced recruit-
ment (seedlings and saplings). The existing research
reveals that genetic structure can develop as dispersal
interacts with population structure, such as adult density,
or forest structure, such as light gaps. Hamrick et al. (1993)
examined multiple stage classes of several species in con-
tinuous forest revealing that adult density and mode of
seed dispersal interacted to determine levels of allozyme
genetic structure in seedlings (low density and limited
dispersal produced the most structure). This genetic
structure was most pronounced in the young stages and
decayed in the adults for Platypodium elegans and Alseis
blackiana. Swartzia simplex var. ochnacea, which occurred at
higher densities and had a more-even size distribution
(i.e. presumably a lower mortality rate), departed from
this pattern. The authors concluded that random mortal-
ity was a sufficient explanation for the signal reduction in
the two species. Forest structure also can be important.
For example, patchy recruitment in gaps appeared to
influence the partitioning of allozyme genetic variation in
the gap-colonizing species Cecropia obtusifolia (Alvarez-
Buylla et al. 1996), although, as Hamrick et al. (1993)
found, genetic structure decreased in the older cohorts.
This level of demographic genetic resolution has not
been attained for tropical trees in fragmented landscapes.
Although evidence exists that deforestation can reduce
levels of genetic diversity (e.g. Prober & Brown 1994), the
relative importance of different causal processes remains
largely unexplored. Most evidence relates to the direct
loss of genotypes during deforestation which depends on
an interaction between the scale of fragmentation and that
of pre-existing genetic structure (Nason et al. 1997). More
ambiguous is the relative importance of a fragmentation-
induced bottleneck vs. subsequent cycles of genetic drift.
Gene flow among remnant forest populations could miti-
gate the effects of physical isolation, as revealed by
microsatellite analysis of pollen movement in fragmented
populations of Pithecellobium elegans (Chase et al. 1996b)
and Gliricidia sepium (Dawson et al. 1997). Three temperate
fragmentation studies (Fore et al. 1992; Young et al. 1993;
Ballal et al. 1994) on Acer saccharum revealed diminished
allozyme genetic differentiation among patches relative to
continuous forest, suggesting that deforestation may
facilitate gene flow via wind dispersal of pollen. Young
et al. (1996) postulated that the creation of genetic bottle-
necks, as opposed to the continued action of genetic drift,
could be a significant factor in the loss and redistribution
of genetic variation following fragmentation of plant pop-
ulations. Changes in genetic composition during a severe
bottleneck event could have pervasive, long-lasting
effects on a population even if it rebounded shortly after
fragmentation, although evidence is limited.
The present study provides a detailed view of the
demographic genetic structure of a tropical tree species
following forest fragmentation. We developed microsatel-
lite markers for the tropical tree Symphonia globulifera and
used them to examine the development of spatial genetic
structure within and among fragmented and continuous
forest, and temporal genetic structure within and among
four stage classes: adults, saplings, and two size-classes of
seedlings. This study is part of a larger effort to under-
stand the fragmentation biology of S. globulifera (Aldrich
1997; P. R. Aldrich and J. L. Hamrick, unpublished). These
additional data include natural-history information on
landscape-level patterns of fecundity, gene flow by pollen
and seed, mating system, effective population size, and
population dynamics, providing an unprecedented con-
text within which to interpret results.
Materials and methods
Species
Symphonia globulifera L. (Clusiaceae) is a canopy tree
characteristic of primary tropical forests throughout the
Neotropics (Croat 1978; Hartshorn 1983) and Africa,
although its 17 congeners are restricted to Madagascar.
The species is hermaphroditic with bright red flowers that
are visited by monkeys and bananaquits (Leck 1983;
Garber 1988), although it is pollinated primarily by
hummingbirds (Croat 1978; Bawa et al. 1985; Kress &
Beach 1994; Bittrich & Amaral 1996). Although individu-
als typically outcross in undisturbed forests, selfing rates
increase with forest fragmentation (Aldrich & Hamrick
1998) despite elevated abortion rates which can be associ-
ated with self-pollinations (Bittrich & Amaral 1996). At
our site, bats appear to be the primary dispersal agent for
the 4Ð5 cm diameter, single-seeded, green fruits (Aldrich
1997), although birds, monkeys, and even ruminants have
been reported as potential vectors elsewhere (Gautier-
Hion et al. 1985).
Field site
Field research was conducted in premontane rainforest in
the Coto Brus region of southern Costa Rica, an area expe-
riencing extensive deforestation over the past several
decades. The 235-ha Las Cruces Reserve (LCR) of the
Organization for Tropical Studies is one of the few
remaining protected areas in the vicinity and was selected
© 1998 Blackwell Science Ltd, Molecular Ecology, 7, 933Ð944
 M I C R O S AT E L L I T E D E M O G R A P H Y O F F R A G M E N T E D T R O P I C A L T R E E P O P U L AT I O N S
as a control site for remnant continuous forest. A series of
smaller (1Ð20 ha) remnant forest patches formed in the
past 10Ð30 years (Gomez 1995) extends for about 1 km
from the LCRÕs edge. These patches have been the focus
of recent research on fragmentation effects on insect
diversity (Daily & Ehrlich 1995) and bird population
dynamics (Borgella 1995), and several of these patches
were selected to assess short-term effects of fragmentation
on the demographic genetics of tree species.
From 1993 to 1996 we established study plots in the
fragmented and continuous forest at this site. The Patch
Dynamics Plot (PDP; Fig. 1) is a 38.5-ha circular plot (350-
m radius) encompassing three 1-ha remnant forest
patches (UGS, LGS, and LOB), several thin riparian corri-
dors (UVC, LGC, and LRC), and pasture. Non-native
grasses dominate the pasture, which also contains occa-
sional remnant forest trees that are integral to S. globulifera
recruitment in the area (Aldrich & Hamrick 1998). Two
control plots, LCR1 (3.2 ha) and LCR2 (1 ha), were estab-
lished in the continuous forest of the Las Cruces Reserve.
Although the total area of the PDP (38.5 ha) greatly
exceeded the combined area of the two LCR plots (4.2 ha),
the area of the PDP in remnant forest (patches and corri-
dors, 4.3 ha) was quite similar.
Sampling
All stems of S. globulifera > 2 m in height (adults and
saplings) and < 30 cm (seedlings) were located and
Fig. 1 Map of the Patch Dynamics Plot (PDP) encompassing
38.5 ha of recently disturbed premontane rainforest. The 350-m-
radius circular plot encompasses pasture with free-standing pri-
mary forest trees (trees not shown), three ≈ 1-ha remnant forest
patches (UGS, LGS, and LOB), thin riparian corridors emanating
from each patch (UVC, LGC, and LRC), and a seasonal swamp.
© 1998 Blackwell Science Ltd, Molecular Ecology, 7, 933Ð944
935
mapped in the PDP and both LCR plots. Each stage-class
is probably a composite of numerous cohorts due to the
longevity of many tropical tree species and the ability of
individuals to persist in the understory for several years
(Lieberman et al. 1985). Diameters at breast height (d.b.h.)
were taken for the > 2 m class; the smallest flowering
adult in the study (8.5 cm) formed the cut-off between the
adults and saplings. Leaf tissue was collected from each
specimen, although for a few large adults bark tissue was
substituted, because it is more accessible and yields suffi-
cient DNA for PCR-based genotyping (Terauchi 1994).
Tissue samples were lyophyllised for 2 days at the field
station, sealed in freezer bags with desiccant, and shipped
to the University of Georgia, USA. Collecting some speci-
mens in duplicate (leaf and bark tissue) and eliminating
the lyophyllization phase for a subset of these samples
tested the robustness of this protocol.
Seedlings were mapped, leaf tissue was collected, and
individuals were aged. New seedlings had a swollen
hypocotyl (P. Stevens, personal communication) that per-
sisted for the first year or two; older seedlings lacked this
character. Surveys were conducted in the two LCR plots
(a 1-ha core area was sampled in the larger LCR1 plot), in
each patch of the PDP, and along 10-m-wide belt transects
along the interior of each riparian corridor. Seedlings
were also subsampled in a cumulative area of 0.5 ha of
pasture, including four 20 × 20 m plots in open pasture,
six 10 × 10 m plots including an adult S. globulifera, and
3.5-m-wide belt transects along either side of each corri-
dor 5 m into pasture.
Microsatellite development
Nuclear DNA was extracted for library construction using
a modification of Murray & Thompson (1980). Leaf tissue
(20 g) was homogenized with sodium bisulphite (0.57 g)
and chilled extraction buffer (150 mL) (0.5 M Tris-HCl,
0.03 M EDTA, 9 mM sorbitol, pH 7.5). The homogenate was
filtered, centrifuged (2000 rpm, 15 min), and the pellet
resuspended in extraction buffer (5 mL), nuclei lysis
buffer (5 mL) (NLB; 5 M Tris-HCl, 1.13 M EDTA, 50 M NaCl,
0.27 M CTAB, pH 7.5), and 10% sarkosyl (1 mL), and incu-
bated (60 ¡C, 20 min). DNA was purified with chloro-
form/isoamyl alcohol (24:1) and precipitated with chilled
isopropanol. DNA was restricted with Sau3AI and size
fractioned. Fragments (400Ð800 bp) were excised, purified
(Qiaquick Gel Extraction Columns, Qiagen), and ligated
into the BamHI site of a lambda vector (ZAP Express,
Stratagene). The library was plated onto host XL1-Blue
MRF' (Stratagene) and grown (37 ¡C, 24 h). Plaques were
transferred to nitrocellulose membranes (Protran), which
were processed for 5 min in the following solutions: 5×
SSC; 0.5 M NaOH, 1.5 M NaCl; 0.5 M Tris-HCl, 1.5 M NaCl,
pH 8.0; and 0.2 M Tris-HCl, 2× SSC, pH 7.5. Filters were
936 P. R . A L D R I C H E T A L .

baked (2 h, 90 ¡C) and prehybridized (2Ð3 h, 50 ¡C, 6× SSC, F-statistics for sites and stages
0.1% SDS, 50 rpm). Oligonucleotide probes (GA)10 were 5'
F-statistics were calculated according to the formula of
end-labelled with [γ32P]-ATP using T4 polynucleotide
Weir & Cockerham (1984), that measures genetic structure
kinase, purified on Sephadex columns, and hybridized to
by partitioning variation in an analysis of variance frame-
filters overnight. Filters were washed once (50 ¡C, 6× SSC,
work. Analogous to FST (Wright 1951), θ measures diver-
0.1% SDS, 200 rpm, 15 min) and exposed to film. Positive
gence in allele frequencies among populations, whereas f
clones were selected, and the screening process was
(similar to FIS) and F (similar to FIT) measure heterozygote
repeated at higher stringency (56 ¡C, 2× SSC). Positive
excess (< 0) and deficit (> 0) relative to HardyÐWeinberg
clones were isolated, and inserts were PCR-amplified
expectations in the local populations and the total set of
using M13 primers. Amplification product was purified
populations, respectively. Estimates were obtained using
(Qiaquick PCR Purification Columns) and sequences were
the program F S TAT (Goudet 1995), which provides stan-
generated at the Molecular Genetics Instrumentation
dard deviations by jackknifing across loci (250 replicates
Facility (MGIF), University of Georgia, USA. Unique
were generated). Estimates were obtained across study
primers were selected from sequence data using the pro-
sites (e.g. UGS vs. LGS vs. LOB patches) for each life
gram PRIMER (version 0.5, Whitehead Institute of
stage, sample size permitting, and across life stages for
Biomedical Research) and synthesized at the MGIF.
the broadest spatial scales (LCR and PDP). Similar to θ,
Sample DNAs were extracted for PCR amplification as
RST (Slatkin 1995) was also calculated among sites and
follows: tissue (20Ð40 mg) was pulverized with liquid
stages. It is the fraction of the total variance of allele size
nitrogen, incubated (1 h, 65 ¡C) in NLB (750 µL) and 10%
occurring among populations. RST estimates were
sarkosyl (100 µL), purified with chloroform/isoamyl alco-
obtained using the program M I C R O S AT (Minch et al.
hol (600 µL), and precipitated with chilled isopropanol
1996), which provides standard deviations by bootstrap-
(500 µL). Recalcitrant samples were repurified using
ping over loci (250 replicates).
Qiaquick PCR Purification Columns. PCR conditions
involved 20 cycles of 94 ¡C for 1 min, 58 ¡C for 45 s, and
72 ¡C for 30 s. PCR reactions had 10 µL final volumes con- Ordination of gene pools
taining template DNA (1Ð10 ng/µL) PCR Buffer (1×,
An ordination technique was applied to assess the overall
Perkin Elmer), MgCl2 (1.2 mM), dNTPs (0.2 mM for dATP,
genetic similarity of the different geographical and life-
dCTP, dGTP, dTTP), Amplitaq DNA polymerase
stage gene pools. Principal component analysis was con-
(0.1 U/µl, Perkin Elmer), 3' primer (0.3 pM), and 5' primer
ducted using SAS (SAS Institute) and was based on the
(0.3 pM) labelled separately with [γ32P]-dATP. Data bands
varianceÐcovariance matrix of allele frequencies for all
were resolved in 7.6% acrylamide gels run at 45 ¡C.
three loci in 19 site stages.

Diversity within loci, sites, and stages

Patterns of allelic diversity at each locus were examined
in each of the stage classes (adults, saplings, seedlings) in
each site and at the broader spatial scale (LCR, PDP). The
observed number of alleles (AO), the effective number of
alleles (AE = 1/Σ pi2 where pi is the frequency of the ith
allele), and the three most common alleles occurring in
each sample were calculated for the three loci, separately.
Estimates of genetic diversity within life stages and
study sites were made by averaging across the three loci.
Statistics estimated included the mean number of alleles
observed per locus (AOL) and per locus per ha (AOL/ha),
the number of distinct multilocus genotypes observed
(GO), and the number observed per ha (GO/ha). The
probability of sampling a distinct multilocus genotype
was estimated as the cumulative frequency of the
observed distinct genotypic classes. Observed (HO) and
expected (HE) heterozygosities averaged over loci also
were estimated, and sources of heterozygote deficiency
were evaluated on a per-sample and per-locus basis,
measured as FIS = 1 Ð HO/HE.
Results
Sampling
In total, 74 adults (LCR1, 23; LCR2, 8; PDP, 43), 152
saplings (LCR1, 69; LCR2, 15; PDP, 68), and 688 seedlings
(old seedlings: LCR1, 38; LCR2, 5; PDP, 375; new
seedlings: LCR1, 7; LCR2, 0; PDP, 263) were mapped, col-
lected, and genotyped for the three loci. It is noteworthy
that, although the PDP pasture held 22 adults, the pasture
plots and casual observations over the course of the study
revealed only two seedlings and no saplings in the pas-
tures (Aldrich & Hamrick 1998).
Microsatellite development
Screens of ≈ 10 000 recombinant plaques for (GA)n repeats
revealed 72 positives. Of these, 20 were sequenced in both
directions using T3 and T7 primers to obtain both flank-
ing sequences and, in the case of locus sgC4 which resided
on a large insert, an additional internal primer was con-
structed. Unique primers were constructed for 10 loci, of

© 1998 Blackwell Science Ltd, Molecular Ecology, 7, 933Ð944

 M I C R O S AT E L L I T E D E M O G R A P H Y O F F R A G M E N T E D T R O P I C A L T R E E P O P U L AT I O N S 937

which one proved monomorphic in sample tissue and
three were selected for use (sgC4, sgI9, and sgF7; Table 1)
based on the ease of scoring and number of alleles
(Table 2). Amplification products for sgC4 and sgI9
involved one or two bands separated by 2-bp steps inter-
preted as distinct alleles. The most variable locus, sgF7,
produced one or two dark bands associated with lighter
stutter bands at 2-bp intervals. Typically these dark bands
were resolved easily and scored as alleles, except for
longer repeats (GA38 to GA53) which were assigned to five
separate bins, three-repeats wide.
Direct examination of marker inheritance was hindered
by use of dispersed progeny (seedlings and saplings) with
uncertain parentage; seeds were uncommon in canopies
due to low pollination, high abortion rates (Aldrich &
Hamrick 1998), and rapid removal by frugivores (Aldrich
1997). Instead, seeds were collected from seed shadows of
two pasture trees (n1 = 30, n2 = 5 seeds) in the PDP, and
progeny genotypes were compared to the putative par-
ents. Inheritance patterns were consistent with Mendelian
transmission, given the biology of the system. Seeds car-
ried at least one allele of the putative parent at each locus
in 16 (53%) and five (100%) of the cases, respectively. The
remaining genotypes were characterized as follows: one
seed resulted from diploid gene flow from off the plot,
while the remaining 93% was consistent with having been
produced by matings involving at least one (two seeds,
14%) or two (11 seeds, 79%) adults residing in the PDP.
Such seed shadow contamination is consistent with the
dispersal syndrome (Aldrich 1997) wherein bats remove
Symphonia globulifera seeds from the parent tree and carry
them away before consumption.
Leaf and bark tissue proved equally appropriate for
genotyping, revealing identical genotypes at each locus for
tissue collected from the same individual. Similarly, no dif-
ference was noted in the ability to resolve bands in tissue
that had not been lyophyllized prior to sealing material in
freezer bags with desiccant compared to lyophyllized tis-
sue. This was true for a 1Ð2-month time span; longer peri-
ods of storage might provide different results.
Diversity within loci
Altogether, the three loci carried 55 alleles in the total
sample (Table 2). The most variable locus was sgF7
(AO = 22), followed closely by sgC4 (AO = 20), and more

Table 1 Locus names, primer sequences

Repeat Size range
listed 5′ to 3′, repeat sequences of clones,
Locus Primer sequences (5' to 3') Sequence (bp)
and size ranges (bp) of observed
amplification products
sgC4 CGGTGATTAGCGTGTCCTTT (GT)19(GA)13 162Ð210
AACTGGCAAGCGTATAGGACC
sgF7 AACATATCAAGCAACATTTAACCC (GA)35 79Ð161
AAATGAAATGCATACTAGAACGAGA
sgI9 TCGGTCTTGGACTTTGTCTC (GA)21 181Ð211
CTCAAGTTCTGGCATCCCAT

Table 2 Patterns of allelic diversity at each locus over major life stages and spatially separated study sites. Sample size (n) and the
observed (AO) and effective (AE) number of alleles per locus are reported, as are the three most common alleles at each locus in order to
gauge compositional changes across the different site stages. Alleles were assigned letters according to their relative frequency in the total
sample, ordered from most to least abundant

AO AE Three most common alleles

Site stage (n) sgC4 sgF7 sgI9 sgC4 sgF7 sgI9 sgC4 sgF7 sgI9

All Samples (914) 20 22 13 6.46 11.02 3.15 a, b, c a, b, c a, b, c

LCR (165) 17 20 10 7.88 9.31 3.96 g, b, c i, h, e a, b, e
Adults (31) 11 16 9 6.16 12.16 3.97 b, g, i h, f, m a, b, e
Saplings (84) 16 18 10 8.51 7.50 3.48 g, b, e i, h, n a, b, e
Seedlings (50) 12 14 9 7.13 7.31 4.72 g, c, b b, i, e a, b, c
PDP (749) 17 22 11 5.42 9.05 2.93 a, b, c a, c, b b, a, c
Adults (43) 12 20 7 7.27 10.48 3.81 a, b, c e, b, c b, a, c
Saplings (68) 13 18 8 6.23 9.24 3.67 b, a, h b, a, c b, a, c
Seedlings (638) 16 21 11 5.11 8.42 2.77 a, b, c a, d, c a, b, d

© 1998 Blackwell Science Ltd, Molecular Ecology, 7, 933Ð944

938 P. R . A L D R I C H E T A L .

distantly by sgI9 (AO = 13). The sgF7 locus had the largest
effective number of alleles in the total sample (AE = 11.02)
and in adults of both the LCR (AE = 12.16) and the PDP
(AE = 10.48) (Table 2). The saplings and seedlings were not
a simple subset of the adults, however, when allelic com-
position was considered at the two sites. In the LCR,
saplings had the largest number of alleles at all three loci
(16, 18, and 10 alleles, respectively) whereas seedlings had
the most alleles at each locus in the PDP (16, 21, and 11
alleles, respectively), although seedlings also had the low-
est AE estimates for all loci in the PDP (5.11, 8.42, and 2.77
alleles, respectively).
The three most common alleles accounted for more of
the genetic composition at the least-variable locus (sgI9,
cumulative frequency = 0.80) compared to the other more
variable loci (sgC4, 0.58; sgF7, 0.48) (Table 2). Both sgI9-a
and sgI9-b alleles occurred as two of the three most com-
mon alleles in all of the site stages surveyed, although
they switched in dominance between the LCR and the
PDP (Table 2). In contrast, the allelic composition of the
two most-variable loci changed substantially between site
stages. Only one allele, sgC4-b, occupied one of the top
three positions in all site stages, and at sgF7, only sgF7-c
was abundant in adults, saplings, and seedlings of the
PDP, though not in LCR specimens (Table 2).
Diversity within sites and stages
The observed number of alleles averaged over loci (AOL)
was compared for different sites (Table 3). Of particular
interest are comparisons (Fig. 2) between the LCR plots
(4.2 ha) and the PDP at the scale of forested area (4.3 ha)

Table 3 Levels of genetic diversity within life stages and sites. Area of habitat (ha) and sample size (n) are reported for each site-stage as
are the following diversity statistics: the mean observed number of alleles per locus (AOL) and per locus per ha (AOL/ha); the observed
number of unique multilocus genotypes (GO) and the observed number per ha (GO/ha); the probability of sampling a unique multilocus
genotype (P(GO)); and the observed (HO) and expected (HE) heterozygosities, averaged over loci

Stage site Area n AOL AOL/ha GO GO/ha P(GO) HO HE

Adults 42.7 74 14.667 0.343 74 1.733 1.000 0.797 0.854

LCR 4.2 31 12 2.857 31 7.381 1.000 0.774 0.834
LCR1 + B 3.2 23 10.667 3.333 23 7.188 1.000 0.754 0.813
LCR2 1 8 7.333 7.333 8 8 1.000 0.833 0.800
PDP 38.5 43 13 0.338 43 1.117 1.000 0.814 0.835
Forest 4.3 21 11.667 2.713 21 4.884 1.000 0.794 0.819
UGS 1.0 5 6.333 6.333 5 5 1.000 0.867 0.800
LGS 1.3 5 6 4.615 5 3.846 1.000 0.867 0.807
LOB 1.1 5 4.667 4.243 5 4.545 1.000 0.800 0.740
Corridors 0.9 6 5 5.556 6 6.667 1.000 0.667 0.718
Pasture 34.2 22 11.667 0.341 22 0.643 1.000 0.833 0.827

Saplings 42.7 152 16.333 0.383 152 3.56 1.000 0.732 0.848
LCR 4.2 84 14.667 3.492 84 20 1.000 0.726 0.821
LCR1 1 69 14 14 69 69 1.000 0.739 0.815
LCR2 1 15 10.333 10.333 15 15 1.000 0.667 0.813
PDP 38.5 68 13 0.338 68 1.766 1.000 0.740 0.820
Forest 4.3 66 13 3.023 66 15.349 1.000 0.748 0.823
UGS 1.0 34 9.333 9.333 34 34 1.000 0.784 0.804
LGS 1.3 13 8 6.154 13 10 1.000 0.667 0.792
LOB 1.1 14 9.667 8.788 14 12.727 1.000 0.738 0.806
Corridors 0.9 5 5.667 6.297 5 5.556 1.000 0.733 0.760

Seedlings 42.7 688 16.667 0.390 500 11.71 0.727 0.620 0.788
LCR 4.2 50 11.667 2.778 49 11.667 0.980 0.733 0.837
LCR1 1.0 45 11 11 44 44 0.978 0.741 0.830
LCR2 1.0 5 3.667 3.667 5 5 1.000 0.667 0.667
PDP 38.5 638 16 0.416 451 11.714 0.707 0.611 0.775
Forest 4.3 638 16 3.721 451 104.884 0.707 0.611 0.775
UGS 1.0 220 12.667 12.667 150 150 0.682 0.602 0.697
LGS 1.3 131 10.667 8.205 93 71.538 0.710 0.527 0.707
LOB 1.1 212 14.333 13.030 199 180.909 0.939 0.675 0.807
Corridors 0.9 75 10.333 11.481 66 73.333 0.880 0.604 0.775

© 1998 Blackwell Science Ltd, Molecular Ecology, 7, 933Ð944

 M I C R O S AT E L L I T E D E M O G R A P H Y O F F R A G M E N T E D T R O P I C A L T R E E P O P U L AT I O N S 939

respectively). This trend was somewhat more pronounced

in the PDP (0.61, 0.74, 0.81, respectively). This reflects a gen-
eral deficit of heterozygotes relative to HardyÐWeinberg
expectations in all stage classes, with the mean inbreeding
coefficient (FIS) over loci ranging from 0.02 to 0.20 for the
primary site-stage categories. Considering the total sample,
the heterozygote deficit was most pronounced at the most
variable locus (sgF7, FIS = 0.39) while FIS for sgC4 (0.10) was
greater than for sgI9 (0.06). This ordering also reflects the
rank of loci by variability.

Fig. 2 Allelic and genotypic diversity in the seedlings, saplings,
and adults of the LCR and PDP. The mean number of unique alle-
les observed per locus and the observed number of unique multi-
locus genotypes are reported for each site stage on a per-ha of
forest and per-ha of plot basis.
F-statistics
Evaluating F-statistics across geographical regions, the
most pronounced genetic structure occurred between the
PDP and the LCR (Fig. 3, Table 4). A significant level of
inbreeding was detected only in the seedlings at this level
of comparison (F = 0.270), but all stage classes exhibited
significant genetic differentiation between the LCR and

and total plot area (38.5 ha). There was generally little dif-
ference in AOL when comparisons were made per ha of for-
est area surveyed for the PDP (adult AOL/ha = 2.71, sapling
AOL/ha = 3.02, and seedling AOL/ha = 3.72, respectively)
and LCR (2.86, 3.49, and 2.78, respectively). When total plot
area was used, however, AOL/ha in the LCR (2.86, 3.49, and
2.78, respectively) was consistently greater than in the PDP
(0.34, 0.34, and 0.42, respectively) for all life stages.
Similar comparisons of the numbers of unique multilo-
cus genotypes (GO) revealed markedly different results
(Fig. 2). The PDP held a similar number of distinct sapling
(15.35) and adult (4.88) genotypes per ha of forest com-
pared to the LCR (20.00 and 7.38, respectively), but 9.2-
times as many seedling genotypes per ha of forest (PDP,
104.88; LCR, 11.67). When GO was estimated against total
plot area, however, the pattern of relative abundance was
reversed, and the numbers of unique multilocus seedling
genotypes per ha of total plot were nearly identical
between the PDP (11.67) and LCR (11.71). On the other
hand, the LCR had greater diversity at this level of com-
parison for saplings (LCR, 20.00; PDP, 1.77) and adults
(LCR, 7.38; PDP, 1.12).
All of the multilocus genotypes in the adults and
saplings were distinct (Table 3). Only in the seedlings
were there multilocus genotypes that occurred in more
than one individual. This redundancy was less common
in the LCR, where 98.0% of the seedling genotypes were
unique vs. 70.7% of the PDP seedlings.
Fig. 3 Plots of spatial genetic structure between the LCR and
Expected heterozygosities did not vary much over the
PDP seedlings, saplings, and adults. Estimates of genetic differ-
primary categories of adults, saplings and seedlings in the
entiation (RST and θ) and local (f) and total (F) inbreeding are
LCR and PDP (0.78Ð0.85, Table 3). There was a tendency, reported (heavy line) as are 95% confidence intervals (thin lines)
however, for observed heterozygosity to increase from the generated by bootstrapping over loci (RST; M I C R O S AT program)
seedling to the adult stage in the LCR (0.73, 0.73, 0.77, and jackknifing over loci (θ, f, F; F S TAT program).

© 1998 Blackwell Science Ltd, Molecular Ecology, 7, 933Ð944

940 P. R . A L D R I C H E T A L .

Table 4 Spatial genetic structure within and among sites for the different life stages of Symphonia globulifera as revealed by the three
microsatellite loci. F-statistics are calculated according to Weir & Cockerham (1984) using the program F S TAT (Goudet 1995), which pro-
vides standard deviations (SD) by jackknifing over loci. The RST statistic, which assesses among-population differentiation in allele size,
was calculated using the program M I C R O S AT (Minch et al. 1996), which provides standard deviations by bootstrapping over loci. Values
that are significantly different from zero are indicated at the 0.05 (*) and 0.01 (**) alpha levels. RST estimates of patch differentiation are
reported as three values, as the M I C R O S AT program generates as many tests for three-way comparisons

Site by stage F ± SD f ± SD θ ± SD RST ± SD

PDP vs. LCR

Adults 0.091 ± 0.052 0.061 ± 0.053 Ð 0.031 ± 0.007 ** Ð 0.056 ± 0.010 **
Saplings 0.169 ± 0.112 0.117 ± 0.111 Ð 0.058 ± 0.008 ** Ð 0.038 ± 0.020
Seedlings 0.270 ± 0.108 * 0.214 ± 0.117 Ð 0.071 ± 0.003 ** Ð 0.238 ± 0.037 **

LCR1 vs. LCR2 in LCR

Adults 0.054 ± 0.084 0.023 ± 0.066 Ð 0.031 ± 0.021 Ð 0.027 ± 0.013 *
Saplings 0.124 ± 0.099 0.124 ± 0.099 Ð 0.000 ± 0.005 Ð 0.024 ± 0.014

Pasture vs. Forest in PDP

Adults 0.091 ± 0.052 0.061 ± 0.053 Ð 0.031 ± 0.007 ** Ð 0.017 ± 0.002 **

UGS vs. LGS vs. LOB Patches

Adults 0.019 ± 0.105 0.033 ± 0.081 Ð 0.016 ± 0.025 Ð 0.044 (*, ns, ns)
Saplings 0.105 ± 0.128 0.095 ± 0.129 Ð 0.011 ± 0.002 ** Ð 0.066 (**, **, **)
Old Seedlings 0.231 ± 0.102 * 0.195 ± 0.096 * Ð 0.044 ± 0.013 ** Ð 0.024 (*, ns, ns)
New Seedlings 0.190 ± 0.143 0.161 ± 0.134 Ð 0.033 ± 0.016 * Ð 0.097 (**, **, ns)

the PDP. Adults showed small, but significant, differentia-
tion both in allele state (θ = 0.031) and allele size
(RST = 0.056). Saplings in the LCR were significantly dif-
ferentiated from the PDP saplings according to θ (0.058),
although not according to RST. Unlike adults, differentia-
tion between the LCR and PDP seedling gene pools was
significantly > 0 (θ = 0.071, RST = 0.238).
Other levels of spatial comparisons also revealed
genetic structure. The two LCR plots did not exhibit sig-
nificant inbreeding or genetic differentiation in allelic
state, but they did show a small but significantly negative
RST value (Ð 0.027; Table 4) in the adults. A small, negative
RST value (Ð 0.017) was also found for the comparison of
adults in pasture vs. forested areas in the PDP, samples
that were also significantly different in allelic state (θ =
0.031). Considering the three remnant patches, adults
exhibited no significant inbreeding or genetic differentia-
tion, whereas saplings were significantly differentiated
among patches (θ = 0.011, RST = 0.066). Older seedlings
had inbreeding values (F = 0.231 and f = 0.195) signifi-
cantly > 0 and were differentiated among patches
(θ = 0.044), whereas newer seedlings were primarily dif-
ferentiated among patches (θ = 0.033, mean RST = 0.097).
Levels of genetic differentiation were also calculated
across life stages (Table 5) in the PDP and LCR. Significant
differentiation (θ = 0.020, RST = 0.210) was detected in the
PDP when considering all three stages, but not in the
LCR. Adults were not significantly differentiated from
saplings at either site except for a small, negative RST
value (Ð 0.007) in the PDP. Adults and saplings were sig-
nificantly different from seedlings in the PDP (θ = 0.015,
RST = 0.114 and θ = 0.024, respectively) but again this was
not found in the LCR. Finally, θ (0.052) among old and
new seedlings was significantly > 0 in the PDP; RST was
not significant and sample sizes precluded a similar com-
parison within the seedlings of the LCR.
Ordination of gene pools
Principal component analysis (Fig. 4) is presented with the
first two axes explaining 54.7% of the variation in allele fre-
quencies and separating the 19 site stages into three distinct
groups. The first principal component, explaining 39.2% of
the variation, separates the PDP samples from the LCR
samples, the latter of which clustered in the upper left of
the plot. The second principal component explains 15.5%
and separates the PDP into two groups. In the lower centre
of the plot were all of the older cohorts in the PDP, includ-
ing adults from remnant forest and corridors (FOR), adults
from pasture (PAS), and the saplings from the three patches
that fall between the adult samples on the plot. The
seedling samples in the lower centre are the new and old
collections from the LOB patch and its adjacent corridor
(LRC). The third group is comprised entirely of old and
new PDP seedlings originating in the two other patches
(UGS, LGS) and their adjacent corridors (UVC, LGC).

© 1998 Blackwell Science Ltd, Molecular Ecology, 7, 933Ð944

 M I C R O S AT E L L I T E D E M O G R A P H Y O F F R A G M E N T E D T R O P I C A L T R E E P O P U L AT I O N S 941

Table 5 Temporal genetic structure

Stage by Site θ ± SD RST ± SD
among life stages of Syphonia globulifera
within the LCR and PDP. Genetic
Adults vs. Saplings vs. Seedlings
differentiation as measured by θ and RST is
LCR 0.008 ± 0.006 Ð 0.005 (ns, ns, ns)
reported, along with standard deviations
PDP 0.020 ± 0.003 ** Ð 0.210 (**, *, *)
generated by jackknifing (θ, F S TAT ) and
Adults vs. Saplings bootstrapping (RST, M I C R O S AT ) over loci
LCR 0.004 ± 0.006 Ð 0.004 ± 0.008
PDP 0.004 ± 0.004 Ð 0.007 ± 0.001 **
Adults vs. Seedlings
LCR 0.010 ± 0.008 Ð 0.015 ± 0.010
PDP 0.015 ± 0.006 * Ð 0.114 ± 0.048 *
Saplings vs. Seedlings
LCR 0.009 ± 0.007 Ð 0.004 ± 0.002
PDP 0.024 ± 0.004 ** Ð 0.103 ± 0.054
Old Seedlings vs. New Seedlings
PDP 0.052 ± 0.016 ** Ð 0.026 ± 0.018

Fig. 4 First two axes from a principal component analysis of allele
frequency composition for 19 site stages of Symphonia globulifera in
the study area. Symbol shape indicates life stage: rectangle
(adults), triangle (saplings), oval (old seedlings), circle (new
seedlings), and oval + circle (old and new seedlings). Dark-shaded
symbols indicate samples taken from LCR plots; light-shaded
symbols indicate PDP samples. Plot names are as follows: Las
Cruces Reserve Plots (LCR1, LCR2), PDP pasture (PAS), PDP
forested area (FOR), PDP remnant forest patches (UGS, LGS, LOB)
and their adjacent corridors (UVC, LGC, LRC, respectively).
Discussion
Diversity within loci, sites and stages
The sapling and seedling gene pools were not a simple
subset of the adult pool of alleles, a pattern that can be
explained by sample size differences and high rates of
gene flow. In the LCR, the saplings had more alleles than
the other life stages because saplings were numerically
the most abundant (n = 84), were comprised of numerous
size cohorts, and had historically experienced appreciable
rates of gene flow into the large LCR plot (m > 0.5, Aldrich
& Hamrick 1998). In the PDP, the seedlings had the most
alleles, probably because they were locally most abundant
(n = 638) and had experienced moderate rates of gene
flow (m > 0.1). The evenness of allelic diversity was typi-
cally very low in the PDP seedlings, however, probably
due to the highly skewed distribution of adult fecundities
in the PDP (Aldrich & Hamrick 1998).
Much less continuity in allelic composition was
observed across sites and life stages for the more variable
two loci vs. the least variable locus. This pattern is unlike
that revealed by most allozyme loci in plant species,
which typically involve a single most-common allele pre-
sent at each locus across broad geographical and temporal
scales (Hamrick & Godt 1990; Aldrich et al. 1992).
The mean number of alleles per locus per ha of forested
area was not substantially different in the PDP compared
to the LCR forest. The large deficit in AOL/ha of total plot
area, however, probably reflects a diminishing return of
alleles per ha of forest surveyed, although a loss of alleles
commensurate with fragmentation is also possible
(Nason et al. 1997). A similar pattern was observed regard-
ing the abundance of unique multilocus sapling and adult
genotypes.
In contrast, the number of distinct multilocus seedling
genotypes in the PDP was much greater than expected
per ha of forest based on LCR data, but it matched the
LCR expectations almost precisely when total plot area
was considered. This result is not unlikely, given that
Aldrich (1997) provided evidence that bats preferentially
deposit fruits from pasture trees into remnant forest. This

© 1998 Blackwell Science Ltd, Molecular Ecology, 7, 933Ð944

942 P. R . A L D R I C H E T A L .
mechanism of concentrating recruitment from pasture
trees would result in remnant forest receiving a broad
spectrum of seed genotypes; in this case, practically the
full spectrum of genotypes expected from 38.5 ha of for-
est. Still, a greater proportion of the PDP seedlings had
redundant genotypes (1 Ð P(GO) = 0.293, Table (3) com-
pared to the LCR seedlings (1 Ð P(GO) = 0.02).
Observed heterozygosities tended to increase with
class age which corroborates several studies of allozyme
variation in trees (Mitton & Grant 1984). This was not
matched by any apparent increase in expected heterozy-
gosity; the younger size classes exhibited the largest het-
erozygote deficits in the PDP seedlings (FIS = 0.196). This
is expected for this site stage, as the PDP seedlings result
from a high selfing rate (Aldrich & Hamrick 1998) and
incorporate a spatial Wahlund effect between patches
and a temporal Wahlund effect between the old and
young seedlings, all of which should generate a heterozy-
gote deficit.
The inbreeding coefficient was typically larger for the
more variable loci. This could result from an increased
propensity to score heterozygotes as homozygotes when
alleles are close in size and confused with stutter bands or
are not distinguished as falling into separate bins, as
might occur with the sgF7 locus. The more-variable loci
may also have contained null alleles that would reduce
the observed heterozygosities, although it was not possi-
ble to detect segregation distortion with the dispersed
progeny, as one might with seeds of known maternal ori-
gin, and progeny arrays were small. Nonetheless, the
magnitudes of departure from HardyÐWeinberg expecta-
tions are comparable to those observed at other
microsatellite loci developed for tropical trees (e.g. Chase
et al. 1996a), and their direction of deviation is consistent
with the natural history of this species at this site (e.g. self-
ing and Wahlund effects).
Spatial and temporal genetic structure
Most of the heterozygote deficit detected in Symphonia
globulifera at the various geographical levels of comparison
was not significant according to jackknife estimates of the
variance. The exception was the PDP seedlings, in which
local and total inbreeding (f and F, respectively) was sub-
stantial in magnitude and significance. This was not sur-
prising as a large proportion of the PDP seedlings resulted
from selfing (s = 0.246), whereas the LCR seedlings
(s = 0.098) along with other site stages incorporated much
less selfing (Aldrich & Hamrick 1998).
As fragmentation in the PDP is fairly recent, genetic dif-
ferentiation among sites in the adults (θ, RST) probably
results from pre-existing genetic structure (in both allele
state and size) developed over an extended time period.
This also may be true, to a lesser extent, of the saplings
which were differentiated for θ, although not RST, as
many saplings probably predated fragmentation (Aldrich
& Hamrick 1998). Genetic differences between the LCR
and the PDP (θ, RST) were greatest in the seedlings which
were differentiated significantly beyond the structure
revealed in adults. Only minor differences between θ and
RST were noted throughout, suggesting that allele state
and size had not diverged substantially at this spatial and
temporal scale.
At a smaller geographical scale, however, less spatial
and temporal genetic structure was detected within the
LCR than within the PDP, suggesting a fragmentation
response, although differences in the scale of sampling at
the two sites might also be a factor. Both LCR plots failed
to reveal significant inbreeding or genetic differentiation.
This agrees with other data (Aldrich & Hamrick 1998)
indicating that S. globulifera in these plots have remained
largely outcrossed and that genetic drift has played a less-
dominant role than has gene flow.
Within the PDP, saplings exhibited significant genetic
differentiation (θ, RST) among patches, which may reflect
pre-existing genetic structure contained in seed shadows,
if fragmentation occurred at or below this spatial scale
(Hamrick et al. 1993; Nason et al. 1997). Aldrich &
Hamrick (1998) also found that more recent recruitment
in each patch typically is dominated by a different subset
of adults, which would have led to further differentiation
among patches for saplings produced subsequent to frag-
mentation. An inbreeding effect was not detected in the
saplings, which is consistent with many of the saplings
having been produced prior to fragmentation when the
breeding structure within the PDP was more similar to
that currently observed in the LCR. This lack of inbreed-
ing also may be due to inbreeding depression, which may
have eliminated many selfed saplings produced follow-
ing fragmentation. The selfing rate estimated from the
PDP seedlings was higher than that estimated from PDP
saplings, and saplings were numerically less abundant in
remnant forest of the PDP compared to the LCR (P. R.
Aldrich, unpublished).
The seedlings consistently showed the most genetic
structure in comparisons within and among sites and life
stages within the PDP. The older seedlings were signifi-
cantly differentiated among patches (θ) and carried a sig-
nificant inbreeding effect (F, f), which may result from
substantial spatial and temporal Wahlund effects. The
younger seedlings were primarily differentiated among
patches (θ, RST), but lacked a significant inbreeding
effect, which might be due to a diminished temporal
Wahlund effect, if the new seedlings included fewer
cohorts than the old seedlings.
A negative θ, or RST, may arise through error in estima-
tion when θ is small and positive. If the true value is nega-
tive, it represents a negative intraclass correlation,
© 1998 Blackwell Science Ltd, Molecular Ecology, 7, 933Ð944
 M I C R O S AT E L L I T E D E M O G R A P H Y O F F R A G M E N T E D T R O P I C A L T R E E P O P U L AT I O N S
indicating that alleles are more related between individu-
als than within individuals (Weir 1996). This may arise in
mating systems involving an avoidance of self-matings
(Cockerham 1973). All significantly negative estimates of
θ and RST revealed in this study were small in magnitude
and involved the adults which had the smallest sample
size and were most likely to have experienced prolonged
periods of outcrossing in the LCR and in the PDP prior to
fragmentation.
Finally, principal component analysis revealed the com-
bined effects of a genetic bottleneck superimposed upon
pre-existing genetic structure in the adults. In the LCR,
seedlings and saplings were genetically similar to the
adults, whereas all saplings but only the seedlings from
one patch clustered with adults in the PDP. These
seedlings, from the LOB and its adjacent corridor, derive
from a number of adults in nearby pasture (Aldrich &
Hamrick 1998) thus largely conforming to the overall
genetic composition of the adults. In contrast, seedlings
from the UGS and LGS patches and adjacent corridors
derive primarily from just two pasture adults and thus
deviate strongly from the PDP adults, and even more so
from the LCR samples. Thus, reductions in the number of
adult donors can lead to rapid changes in genetic compo-
sition following fragmentation when these changes occur
in conjunction with pre-existing genetic structure, as pre-
dicted by Nason et al. (1997).
These data provide compelling evidence that forest
fragmentation may induce changes in the genetic struc-
ture of tropical tree populations. Pre-existing genetic
structure is shown to exist between collections of adults
separated by ≈ 1 km and this level of genetic differentia-
tion among sites, and genetic similarity within sites,
appears to have been passed on to the saplings.
Nevertheless, seedlings in two of the remnant patches
and adjacent corridors have diverged substantially in
genetic composition at these loci. It is possible that genetic
divergence in the seedlings is normal and that selection
will ultimately force convergence toward the adult gene
pool, but this scenario is not supported by the LCR data,
which indicate that saplings and seedlings should resem-
ble the adults genetically. It is more likely that a dramatic
change in the breeding structure has occurred following
fragmentation and that the current seedling cohorts differ
from the adult and sapling stages as a result.
In summary, human-mediated sampling involved in
deforestation may interact with pre-existing genetic
structure to generate genetic differences among forest
remnants. Subsequently, natural sampling processes such
as pollen and seed dispersal events, which may change in
character upon fragmentation (Aldrich & Hamrick 1998),
can exacerbate this genetic bottleneck, leading populations
on substantially different trajectories in fairly short periods
of time. Thus, genetic drift over numerous generations of
© 1998 Blackwell Science Ltd, Molecular Ecology, 7, 933Ð944
943
small population size is sufficient but not necessary for the
development of significant changes in the genetic composi-
tion of fragmented tropical tree populations.
Acknowledgements
We thank P. Chavarriaga and G. Kochert for assistance in SSR
development and J. Burke, M. Jimenez, A. Jones, and S. Kresovich
for technical advice; D. Hinrichs, L. Rieseberg, R. Wyatt, and two
anonymous reviewers for comments; and V. Apsit, M. Arnold, C.
R. Carroll, J. Doebley, and J. Nason for discussions. Logistical sup-
port in the field was graciously provided by Luis Diego Gomez,
Gail Hewson, Las Cruces, the Organization for Tropical Studies
and the Stanford Center for Conservation, as well as R. Menjivar,
D. Biggs, and D. Hinrichs. Financial support was provided by an
NSF Training Grant and an NSF Doctoral Dissertation
Improvement Grant awarded to P.R.A, as well as grants from
Sigma Xi, OTS, and the UGA Botany Department.
References
Aldrich PR (1997) Dispersal and the Scale of Fragmentation in
Tropical Tree Populations, PhD Thesis, Botany Department,
University of Georgia, Athens.
Aldrich PR, Hamrick JL (1998) Reproductive dominance of
pasture trees in a fragmented tropical forest mosaic. Science,
in press.
Aldrich PR, Doebley J, Schertz KF, Stec A (1992) Patterns of
allozyme variation in cultivated and wild Sorghum bicolor.
Theoretical Applied Genetics, 85, 451Ð460.
Alvarez-Buylla ER, Chaos A, Pinero D, Garay AA (1996)
Demographic genetics of a pioneer tropical tree species: patch
dynamics, seed dispersal, and seed banks. Evolution, 50,
1155Ð1166.
Ballal SR, Fore SA, Guttman SI (1994) Apparent gene flow and
genetic structure of Acer saccharum subpopulations in forest
fragments. Canadian Journal of Botany, 72, 1311Ð1315.
Bawa KS, Bullock SH, Perry DR, Coville RE, Grayum MH (1985)
Reproductive biology of tropical lowland rain forest trees. II.
Pollination systems. American Journal of Botany, 72, 346Ð356.
Bittrich V, Amaral CE (1996) Pollination biology of Symphonia globu-
lifera (Clusiaceae). Plant Systematics and Evolution, 200, 101Ð110.
Borgella R (1995) Population Size, Survivorship, and Movement
Rates of Resident Birds in Costa Rican Forest Fragments. MSc
Thesis. Cornell University.
Chase M, Kesseli R, Bawa K (1996a) Microsatellite markers for
population and conservation genetics of tropical trees.
American Journal of Botany, 83, 51Ð57.
Chase MR, Moller C, Kesseli R, Bawa KS (1996b) Distant gene
flow in tropical trees. Nature, 383, 398Ð399.
Cockerham CC (1973) Analyses of gene frequencies. Genetics, 74,
679Ð700.
Croat TB (1978) Flora of Barro Colorado Island. Stanford University
Press, Stanford.
Daily G, Ehrlich PR (1995) Preservation of biodiversity in small
rainforest patches: rapid evaluations using butterfly trapping.
Biodiversity and Conservation, 4, 35Ð55.
Dawson IK, Waugh R, Simons AJ, Powell W (1997) Simple
sequence repeats provide a direct estimate of pollen-medi-
ated gene dispersal in the tropical tree Gliricidia sepium.
Molecular Ecology, 6, 179Ð183.
944 P. R . A L D R I C H E T A L .
Fore SA, Hickey RJ, Vankat JL, Guttman SI, Schaefer RL (1992)
Genetic structure after forest fragmentation: a landscape ecol-
ogy perspective on Acer saccharum. Canadian Journal of Botany,
70, 1659Ð1668.
Garber PA (1988) Foraging decisions during nectar feeding by
tamarin monkeys (Saguinus mystax and Saguinus fuscicollis,
Callitrichidae, Primates) in Amazonian Peru. Biotropica, 20,
100Ð106.
Gautier-Hion A, Duplantier J-M, Quris R, Feer F, Sourd C,
Decoux J-P, Dubost G, Emmons L, Erard C, Hecketsweiler P,
Moungazi A, Roussilhon C, Thiollay J-M (1985) Fruit charac-
ters as a basis of fruit choice and seed dispersal in a tropical
forest vertebrate community. Oecologia, 65, 324Ð337.
Gomez LD (1995) White Paper, Brunca Conservation Biology
Workshop, University of Kansas.
Goudet J (1995) FSTAT (Version 1.2): a computer program to calcu-
late F-statistics. Journal of Heredity, 86, 485Ð486.
Hall P, Chase MR, Bawa KS (1994) Low genetic variation but high
population differentiation in a common tropical forest
species. Conservation Biology, 8, 471Ð482.
Hamrick JL, Loveless MD (1989) The genetic structure of tropical
tree populations: associations with reproductive biology. In.
The Evolutionary Ecology of Plants (eds Bock JH, Linhart YB),
pp. 129Ð146. Westview Press, San Francisco.
Hamrick JL, Godt MJ (1990) Allozyme diversity in plant species.
In: Plant Population Genetics, Breeding, and Genetic Resources
(eds Brown AHD, Clegg MT, Kahler AL, Weir BS), pp. 43Ð63.
Sinaeur, Sunderland, MA.
Hamrick JL, Murawski DA (1991) Levels of allozyme diversity in
populations of uncommon neotropical tree species. Journal of
Tropical Ecology, 7, 395Ð399.
Hamrick JL, Murawski DA, Nason JD (1993) Influence of seed
dispersal mechanisms on the genetic structure of tropical tree
populations. Vegetation, 107Ð108, 281Ð297.
Hartshorn GS (1983) Plants. In: Costa Rican Natural History (ed.
Janzen D), pp. 118Ð350. University of Chicago Press,
Chicago.
James T, Vege S, Aldrich P, Hamrick JL (1998) Mating systems of
three tropical dry forest tree species. Biotropica, in press.
Kress WJ, Beach JH (1994) Flowering plant reproductive systems
at La Selva Biological Station. In La Selva: Ecology and Natural
History of a Neotropical Rain Forest (eds McDade LA, Bawa KS,
Hespenheide H, Hartshorn G), pp. 161Ð182. University of
Chicago Press, Chicago.
Laurance WF, Bierregaard RO (eds) (1997) Tropical Forest
Remnants: Ecology, Management, and Conservation of Fragmented
Communities. University of Chicago Press, Chicago.
Leck CF (1983) Coereba flaveola. In Costa Rican Natural History (ed.
Janzen DH), University of Chicago Press, Chicago.
Lieberman D, Lieberman M, Hartshorn G, Peralta R (1985)
Growth rates and age-size relationships of tropical wet forest
trees in Costa Rica. Journal of Tropical Ecology, 1, 97Ð109.
Minch E, Ruiz-Linares A, Goldstein D, Feldman M, Cavalli-
Sforza LL (1996) MICROSAT (Version 1.5): a Computer Program for
Calculating Various Statistics on Microsatellite Allele Data.
Stanford University Medical Center.
Mitton JB, Grant MC (1984) Associations among protein het-
erozygosity, growth rate, and developmental homeostasis.
Annual Review of Ecology and Sysematics, 15, 479Ð500.
Murawski DA, Gunatilleke IAU, Bawa KS (1994) The effect of
selective logging on inbreeding in Shorea megistophyll (Dip-
terocarpaceae) from Sri Lanka. Conservation Biology, 8,
997Ð1002.
Murray M, Thompson WF (1980) Rapid isolation of high-molecu-
lar-weight plant DNA. Nucleic Acids Research, 8, 4321Ð4325.
Nason JD, Herre EA, Hamrick JL (1996) Paternity analysis of the
breeding structure of strangler fig populations: evidence for
substantial long-distance wasp dispersal. Journal of
Biogeography, 23, 501Ð512.
Nason JD, Aldrich PR, Hamrick JL (1997) Dispersal and the
dynamics of genetic structure in fragmented tropical tree
populations. In Tropical Forest Remnants: Ecology, Management
and Conservation of Fragmented Communities (eds Laurance WF,
Bierregaard RO), pp. 304Ð320. University of Chicago Press,
Chicago.
Prober SM, Brown AHD (1994) Conservation of the grassy white
box woodlands: population genetics and fragmentation of
Eucalyptus albens. Conservation Biology, 8, 1003Ð1013.
Slatkin M (1995) A measure of population subdivision based on
microsatellite allele frequencies. Genetics, 139, 457Ð462.
Terauchi R (1994) A polymorphic microsatellite marker from the
tropical tree Dryobalanops lanceolata (Dipterocarpaceae).
Japanese Journal of Genetics, 69, 567Ð576.
Weir BS (1996) Genetic Data Analysis II. Sinauer Association,
Sunderland, MA.
Weir BS, Cockerham CC (1984) Estimating F-statistics for the
analysis of population structure. Evolution, 38, 1358Ð1370.
Wright S (1951) The genetical structure of populations. Annals of
Eugenics, 15, 323Ð354.
Young A, Boyle T, Brown T (1996) The population genetic conse-
quences of habitat fragmentation for plants. Tree, 11, 413Ð418.
Young AG, Merriam HG, Warwick SI (1993) The effects of forest
fragmentation on genetic variation in Acer saccharum Marsh.
(sugar maple) populations. Heredity, 71, 277Ð289.
These results are part of P. R. AldrichÕs PhD thesis on the frag-
mentation biology of S. globulifera. He has received an NSF
Postdoctoral Fellowship to study the fragmentation genetics of
Amazonian trees and is currently in the Botany Department at
the Smithsonian Institution. J. L. HamrickÕs laboratory uses
allozyme markers to study genetic structure and gene flow in
natural plant populations, recently focusing on fragmentation of
tropical tree populations. P. Chavarriaga is a graduate student
applying molecular markers to the evolution and conservation of
Cassava. G. KochertÕs laboratory uses molecular markers for
genome mapping, plant breeding, and evolutionary studies.
© 1998 Blackwell Science Ltd, Molecular Ecology, 7, 933Ð944