ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, July 2010, p. 2830–2839 Vol. 54, No.

7
0066-4804/10/$12.00 doi:10.1128/AAC.01602-09
Copyright © 2010, American Society for Microbiology. All Rights Reserved.

Glycosylation Steps during Spiramycin Biosynthesis in

Streptomyces ambofaciens: Involvement of Three
Glycosyltransferases and Their Interplay
with Two Auxiliary Proteins䌤
Hoang Chuong Nguyen,1,2† Fatma Karray,1†‡ Sylvie Lautru,1 Josette Gagnat,1 Ahmed Lebrihi,3
Thuy Duong Ho Huynh,2 and Jean-Luc Pernodet1*
Université Paris-Sud 11, CNRS, UMR 8621, Institut de Génétique et Microbiologie, 91405 Orsay Cedex, France1; University of
Science, Vietnam National University at Ho Chi Minh City, 227 Nguyen Van Cu Street, District 5, Ho Chi Minh City,
Vietnam2; and Université de Toulouse, Laboratoire de Génie Chimique UMR 5503 (CNRS/INPT/UPS),

Downloaded from http://aac.asm.org/ on July 7, 2019 by guest

ENSAT-INP de Toulouse, 1 Avenue de l’Agrobiopôle, Castanet-Tolosan Cedex, France3
Received 11 November 2009/Returned for modification 2 January 2010/Accepted 23 April 2010

Streptomyces ambofaciens synthesizes spiramycin, a 16-membered macrolide antibiotic used in human med-
icine. The spiramycin molecule consists of a polyketide lactone ring (platenolide) synthesized by a type I
polyketide synthase, to which three deoxyhexoses (mycaminose, forosamine, and mycarose) are attached
successively in this order. These sugars are essential to the antibacterial activity of spiramycin. We previously
identified four genes in the spiramycin biosynthetic gene cluster predicted to encode glycosyltransferases. We
individually deleted each of these four genes and showed that three of them were required for spiramycin
biosynthesis. The role of each of the three glycosyltransferases in spiramycin biosynthesis was determined by
identifying the biosynthetic intermediates accumulated by the corresponding mutant strains. This led to the
identification of the glycosyltransferase responsible for the attachment of each of the three sugars. Moreover,
two genes encoding putative glycosyltransferase auxiliary proteins were also identified in the spiramycin
biosynthetic gene cluster. When these two genes were deleted, one of them was found to be dispensable for
spiramycin biosynthesis. However, analysis of the biosynthetic intermediates accumulated by mutant strains
devoid of each of the auxiliary proteins (or of both of them), together with complementation experiments,
revealed the interplay of glycosyltransferases with the auxiliary proteins. One of the auxiliary proteins
interacted efficiently with the two glycosyltransferases transferring mycaminose and forosamine while the other
auxiliary protein interacted only with the mycaminosyltransferase.

Macrolide antibiotics consist of a polyketide macrolactone
ring to which one or more deoxysugars are attached. They
inhibit protein synthesis by binding to the large subunit of the
ribosome and can also, in some cases, interfere with the as-
sembly of the large subunit (reviewed in reference19). As with
many other natural products, glycosylation of macrolides is
essential for their biological activity. The determination of the
three-dimensional structure of the 50S ribosomal unit in com-
plex with various macrolides showed that the sugar moieties
are involved in specific interactions with the 23S rRNA (11,
38). All macrolides block the ribosomal peptide exit tunnel,
thus preventing peptide chain elongation. In addition to their
role in binding, the sugars are also important for steric hin-
drance in the tunnel. For instance, it was shown that the C-5
disaccharide moieties of some 16-membered macrolides, such
as spiramycin or tylosin, extend in the tunnel toward the pep-
tidyl transferase center, and a correlation could be established
* Corresponding author. Mailing address: Institut de Génétique et
Microbiologie, Bâtiment 400, Université Paris-Sud 11, F-91405 Orsay
Cedex, France. Phone: 33 169154641. Fax: 33 169154629. E-mail: jean
-luc.pernodet@igmors.u-psud.fr.
‡ Present address: Centre de Biotechnologie de Sfax, BP 1177 3018
Sfax, Tunisie.
† H.C.N and F.K. contributed equally to this work.
䌤
Published ahead of print on 3 May 2010.
between the length of the macrolide saccharide side chain and
the number of amino acids which could be incorporated before
peptide chain elongation was blocked (11).
One of the most common resistance mechanisms to mac-
rolide antibiotics encountered in pathogenic bacteria in-
volves target modification. These modifications could in-
clude mutation or methylation of the 23S residues involved
in the interaction with macrolide antibiotics (30, 35, 40).
Molecular modeling helped to explain how these modifica-
tions could hamper the binding of macrolides to modified
ribosomes (11, 22). Taken together, these studies suggested
that modification of the glycosylation pattern of macrolides
was a way to obtain new macrolides with enhanced or mod-
ified affinities for their targets, which could help to circum-
vent some resistance mechanisms. As a consequence, many
studies were undertaken to characterize the biosynthetic
pathways of the sugars present in macrolides and the glyco-
syltransferases involved in their attachment to the macro-
lactone ring (for a review, see references 23, 26, and 36).
The resulting knowledge was applied for the generation of
novel compounds by combinatorial biology (34, 36). To be
successful, these approaches rely on the availability of mac-
rolide glycosyltransferases with a certain degree of substrate
flexibility regarding the sugar donor and/or the aglycone
acceptor. In this perspective, it is interesting to characterize

2830
VOL. 54, 2010 GLYCOSYLATION STEPS IN SPIRAMYCIN BIOSYNTHESIS
FIG. 1. (A) The spiramycin molecules. (B) The spiramycin biosynthetic gene cluster. Genes encoding putative glycosyltransferases are
represented by dashed arrows, and those encoding putative auxiliary proteins are represented by black arrows.
the glycosyltransferases involved in the glycosylation of var-
ious macrolide antibiotics.
It was recently discovered that some glycosyltransferases
require an auxiliary activator protein for full activity. This was
determined during the study of DesVII, a glycosyltransferase
that catalyzes the attachment of desosamine onto 12- and 14-
membered macrolactone rings during the biosynthesis of the
macrolide antibiotics methymycin and pikromycin in Strepto-
myces venezuelae. For glycosylation to proceed efficiently, the
presence of an auxiliary protein, DesVIII, was found to be
necessary in vivo as well as in vitro (2, 3, 12, 13). Since the
discovery of the role of DesVIII in glycosylation, other pairs of
glycosyltransferases and auxiliary proteins have been identified
and characterized, and most of these are involved in macrolide
biosynthesis (14, 24, 25). However, the mechanistic role of
these auxiliary proteins remains unclear. Auxiliary proteins are
most probably not involved in the transfer itself. Indeed, it
has been observed that the auxiliary protein is required for
the initial activation of the glycosyltransferase, but then the
activated glycosyltransferase can catalyze the glycosyltrans-
fer alone. It was thus proposed that auxiliary proteins induce
a one-time conformational change of the glycosyltransferase
to its active form (2).
Spiramycin is a macrolide antibiotic used in human medi-
cine. It is synthesized by Streptomyces ambofaciens and consists
of a 16-membered polyketide lactone ring (platenolide) with
two amino deoxyhexoses (mycaminose and forosamine) and
one neutral deoxyhexose (mycarose) attached (Fig. 1A). As the
result of several studies (reference 18 and references therein),
the complete sequence and organization of the gene cluster
directing the biosynthesis of spiramycin have been determined
(Fig. 1B). It was therefore possible to address the question of
glycosylation in spiramycin biosynthesis by inactivating genes
putatively involved in glycosylation and then characterizing the
resulting mutant strains.
2831
Downloaded from http://aac.asm.org/ on July 7, 2019 by guest
We report here the identification of the three genes encod-
ing the glycosyltransferases responsible for sugar attachment in
spiramycin biosynthesis, the determination of the sugar at-
tached by each of these enzymes, and the interplay of two of
these glycosyltransferases with two auxiliary proteins encoded
in the cluster.
MATERIALS AND METHODS
Strains, plasmids, and culture conditions. The strains and plasmids used in
this study are listed in Table 1. Standard media and culture conditions were used
for Escherichia coli and Streptomyces strains (20, 37). The following antibiotics
were incorporated in the medium when required for selection: ampicillin (Amp),
thiostrepton (Tsr), apramycin (Apr), hygromycin B (Hyg), and puromycin (Pur).
For spiramycin production, Streptomyces strains were grown in MP5 medium
(29). The detection and quantification of spiramycin in culture supernatants by
bioassays or by high-performance liquid chromatography (HPLC) were per-
formed as previously described (9). Spiramycin I, II, and III were used as
standards for quantification by HPLC.
Gene nomenclature. Some genes of the spiramycin biosynthetic gene cluster
were named previously, for instance, srmGI to srmGIV for the polyketide syn-
thase (PKS) genes (21) or srmB, srmR, and srmX for a resistance gene, a
regulatory gene, and a biosynthetic gene, respectively (8). When the complete
sequence of the gene cluster was determined by Karray et al. (18), the putative
spiramycin genes identified were named orf followed by a number as follows: the
designations orf1 to orf34c were used for the ones upstream of the PKS genes,
with orf1 close to srmGI, and the designations orf1*c to orf11* were used for the
ones downstream of the PKS, with orf1*c being close to srmGIV. But this
nomenclature raised several problems. Therefore, a new nomenclature is now
used in which the genes are named srm followed by a number, in ascending order
from left to right across the cluster (from srm1 to srm44).
Preparation and manipulation of DNA. DNA extraction from E. coli and
Streptomyces, in vitro DNA manipulation, bacterial transformation with DNA,
and introduction of DNA in Streptomyces by E. coli-Streptomyces intergenic
transfer were performed according to well-established protocols (20, 37). DNA
amplification by PCR was carried out using either Taq polymerase from Qiagen
or a GC-rich PCR system from Roche. The oligonucleotides used as primers in
this study are listed in Table 2.
Construction of the excisable cassettes att1aac, att2aac, and att3aac. These
cassettes are similar to the excisable cassettes att1⍀aac, att2⍀aac, and att3⍀aac
previously described (33) except that the terminators originating from the ⍀
2832 NGUYEN ET AL. ANTIMICROB. AGENTS CHEMOTHER.

TABLE 1. Strains and plasmids used in this study

Strain or Source or
Description
plasmid reference

Strains
ATCC 23877 Wild-type S. ambofaciens strain ATCC
OSC2 Derivative of S. ambofaciens ATCC 23877 devoid of pSAM2 33
SPM102 ⌬srm29::att3aac in OSC2 This work
SPM103 ⌬srm30::att3aac in OSC2 This work
SPM104 ⌬srm38::att3aac in OSC2 This work
SPM120 ⌬srm5::att3aac in OSC2 This work
SPM108 ⌬srm29::att3 in OSC2 This work
SPM109 ⌬srm30::att3 in OSC2 This work
SPM110 ⌬srm38::att3 in OSC2 This work
SPM121 ⌬srm5::att3 in OSC2 This work
SPM209 ⌬srm28::att2⍀aac in OSC2 This work
SPM211 ⌬srm6::att2⍀aac in OSC2 This work
SPM212 ⌬srm28::att2 in OSC2 This work

Downloaded from http://aac.asm.org/ on July 7, 2019 by guest

SPM213 ⌬srm6::att2 in OSC2 This work
SPM214 ⌬srm28::att2 ⌬srm6::att2⍀aac in OSC2 This work
SPM215 ⌬srm28::att2 ⌬srm6::att2 in OSC2 This work
SPM216 ⌬srm29::att3 ⌬srm6::att2⍀aac in OSC2 This work
SPM217 ⌬srm29::att3 ⌬srm6::att2 in OSC2 This work
DH5␣ General cloning host strain Promega
S17-1 Host strain for conjugation from E. coli to S. ambofaciens 39
DY330 Used for PCR-targeted mutagenesis 43

Plasmids
pGEMTeasy Ampr; E. coli vector for cloning PCR product Promega
pUWL201 Ampr Tsrr; E. coli-Streptomyces shuttle vector for gene expression in S. ambofaciens 6
under the control of the ermE*p promoter
pOSV554 Aprr; E. coli-Streptomyces shuttle vector for gene expression in S. ambofaciens under Darbon et al.,
the control of the ermE*p promoter unpublished
pOSV234 Ampr Aprr; att3aac cassette (33) cloned into the vector pGP704Not (5, 27) This work
pOSV221 Ampr Aprr; att2⍀aac cassette (33) cloned into the vector pGP704Not (5, 27) This work
pOSV508 Ampr Tsrr; E. coli-Streptomyces shuttle plasmid expressing the Xis and Int proteins 33
for site-specific excision of excisable cassettes
pOSV236 Ampr Tsrr Purr oriT; E. coli-Streptomyces shuttle plasmid expressing the Xis and Int This work
proteins for site-specific excision of excisable cassettes. Derived from pOSV508
(33)
pSPM36 Ampr Purr oriT; cosmid from the S. ambofaciens OSC2 gene library containing part 18
of the spiramycin cluster
pSPM45 Ampr Purr oriT; cosmid from the S. ambofaciens OSC2 gene library containing part 17
of the spiramycin cluster
pSPM47 Ampr Purr oriT; cosmid from the S. ambofaciens OSC2 gene library containing part 17
of the spiramycin cluster
pSPM209 Ampr Aprr Purr; srm28 inactivation (srm28::att2⍀aac) by PCR targeting into pSPM45 This work
pSPM102 Ampr Aprr Purr; srm29 inactivation (srm29::att3aac) by PCR targeting into pSPM45 This work
pSPM103 Ampr Aprr Purr; srm30 inactivation (srm30::att3aac) by PCR targeting into pSPM45 This work
pSPM104 Ampr Aprr,Purr; srm38 inactivation (srm38::att3aac) by PCR targeting into pSPM36 This work
pSPM120 Ampr Aprr Purr; srm5 inactivation (srm5::att3aac) by PCR targeting into pSPM47 This work
pSPM220 Ampr Aprr Purr; srm6 inactivation (srm6::att2⍀aac) by PCR targeting into pSPM45 This work
pSPM224 Aprr; coding sequence of srm28 cloned into pOSV554 This work
pSPM154 Ampr Tsrr; coding sequence of srm29 cloned into pUWL201 This work
pSPM129 Ampr Tsrr; coding sequence of srm38 cloned into pUWL201 This work
pSPM133 Ampr Tsrr; coding sequence of srm5 cloned into pUWL201 This work
pSPM222 Aprr; coding sequence of srm6 cloned into pOSV554 This work

interposon (31) and flanking the apramycin resistance gene in ⍀aac (1) are
absent in these excisable cassettes.
Inactivation of srm5, srm6, srm28, srm29, srm30, and srm38 by in-frame dele-
tion in S. ambofaciens. PCR targeting (5, 10, 43) was used to inactivate the srm5,
srm6, srm28, srm29, srm30, and srm38 genes. The cosmids pSPM36, pSPM45, and
pSPM47 were used in these experiments. They all contain large regions of the
spiramycin biosynthetic gene cluster cloned into the cosmid pWED2 (18). This
vector is unable to replicate in Streptomyces, but it contains the pac gene con-
ferring puromycin resistance in Streptomyces and the oriT sequence for efficient
interspecific transfer from E. coli to Streptomyces. The general procedure was as
follows. The gene targeted for replacement and located in the cosmid insert was
replaced by a resistance cassette via ␭RED-mediated recombination. For this
purpose, the E. coli DY330 strain harboring the cosmid was transformed with
PCR products corresponding to the cassette flanked by short sequences identical
to both extremities of the coding sequence from the targeted gene. The cassettes
used (att2⍀aac and att3aac) confer apramycin resistance in E. coli and Strepto-
myces. The modified cosmids were checked by restriction analysis and PCR. A
cosmid in which the targeted gene had been replaced by the cassette was then
introduced into S. ambofaciens by protoplast transformation or intergenic con-
jugation, with E. coli S17-1 as the donor strain. After selection for apramycin
resistance, the colonies obtained were screened to find apramycin-resistant and
puromycin-sensitive S. ambofaciens clones in which gene replacement had oc-
curred after recombination on each side of the targeted gene. The gene replace-
ment in S. ambofaciens was confirmed by PCR or Southern blot analysis. For
VOL. 54, 2010 GLYCOSYLATION STEPS IN SPIRAMYCIN BIOSYNTHESIS 2833

TABLE 2. Primers used in this study

Primer Sequence (5⬘–3⬘) Description

KF230 AGCTGGCCGACCGCGAACTGGGGCGCAGACTGCACCGGAT Forward primer for deletion of srm28

ATCT ACCTCTTCGTCCCGAAGCAACT
KF231 GCACGCCCAGCGCGGTCTCGGCGGCACGGCCGACGAACTCATC Reverse primer for deletion of srm28
GGCGCGCTTCGTTCGGGACGAAG
KF44 TACCACCTGGTACCGCTGATCTGGGCTCTGCGTGCCTCGGATCG Forward primer for deletion of srm29
CGCGCGCTTCGTTCGGGACGAA
KF45 GGGCGGCGGAGTTCTGCGCGAACATGTGCTGCCGTACGGCATC Reverse primer for deletion of srm29
TGCCTCTTCGTCCCGAAGCAACT
KF46 CCGCTCGCGGGCCACCTGCTTCCGCTGGTGCCCATCGCGTATCG Forward primer for deletion of srm30
CGCGCGCTTCGTTCGGGACGAA
KF47 GCGCCATCTCCTCGGCGAGCCCGGCTGCCGCCTTGGCATAATCT Reverse primer for deletion of srm30
GCCTCTTCGTCCCGAAGCAACT
KF48 CCGGGCATGTGAATCCGACCCTGGGAGTCGCCGAGGAACTATC Forward primer for deletion of srm38
GCGCGCGCTTCGTTCGGGACGAA
KF49 CCGCCGGCCGCCCTGATCTGCTCCCGGAACCCGCGCATGTATCT Reverse primer for deletion of srm38

Downloaded from http://aac.asm.org/ on July 7, 2019 by guest

GCCTCTTCGTCCCGAAGCAACT
KF77 CATCTCCTCGCTCAGCCGCCGCGCGCCCGCCCTGATCGCGATCG Forward primer for deletion of srm5
CGCGCGCTTCGTTCGGGACGAA
KF78 GAGCCCGCCCTCCCTCACCGACGTCATCACCTCCACCGGCATCT Reverse primer for deletion of srm5
GCCTCTTCGTCCCGAAGCAACT
Del.srm6F GCGGCCGGGTCAGGGGCGGTCCCTCGGCCCGCAGGCCGGGAT Forward primer for deletion of srm6
CTACCTCTTCGTCCCGAAGCAACT
Del.srm6R CGGACACGAGCACGGGCGTCCGTGCGCTCGGCCGTCGGCTATC Reverse primer for deletion of srm6
GGCGCGCTTCGTTCGGGACGAAG
Orf16F CGACGCAGGTCAGCACGGTG Confirmation of srm28 disruption
Orf16R CAGGTCATCCACTCCGCGAC Confirmation of srm28 disruption
KF54 GTGACCTCCATCCCGCACCACACGC Confirmation of srm29 disruption
KF55 GGCTCCTCGAGCAGGCGCACCAGCG Confirmation of srm29 disruption
KF56 GGGCCCTCTTCACGACCGCGCCGCT Confirmation of srm30 disruption
KF57 GGTAACTCCGCGGCATGTCCGGCCC Confirmation of srm30 disruption
KF58 CTTCCGGTTGCCGGGCATGTGAATC Confirmation of srm38 disruption
KF59 GCAGCAGTCCCTCGATCGCGTCGGC Confirmation of srm38 disruption
KF79 GTGCAGGGCGGTGAGGCGCTCCAGG Confirmation of srm5 disruption
KF80 CTGCGCGCCGCCGGGCACGAGGTAC Confirmation of srm5 disruption
Srm6F CGCGGCCCGGAGGCGGGTTG Confirmation of srm6 disruption
Srm6R AGCGCCCAGGCGAGGGGCAC Confirmation of srm6 disruption
OE.srm28F ATAAAGCTTAATCTGTGGACGGGGCGGTG Forward primer for amplification of srm28
OE.srm28R ATACTGCAGCAGGACGCGCACGGCACTCC Reverse primer for amplification of srm28
KF98 AAGCTTGGGCCCGCGGCCGGCGTCCCCT Forward primer for amplification of srm29
KF97 GGATCCTGCAGGGCCCGCGCGCCGGTTCA Reverse primer for amplification of srm29
KF83 AAGCTTCGACGCATGAAGGGTTTCACATGGCTCAT Forward primer for amplification of srm38
KF84 GGATCCACGTCTCAGCCCACCCGGGGCAGCAGTCC Reverse primer for amplification of srm38
KF90 AAGCTTGAGAAGGGAGCGGACATGTGCGCGTCCTGCTGACATC Forward primer for amplification of srm5
KF91 GGATCCTGCAGAACATGTCGGTGTCCTCTTTGCGGACGGTCAC Reverse primer for amplification of srm5
OE.srm6F ATAAAGCTTCGCGGCCCGGAGGCGGGTTG Forward primer for amplification of srm6
OE.srm6R ATACTGCAGAGCGCCCAGGCGAGGGGCAC Reverse primer for amplification of srm6

each gene replacement experiment, at least one clone was chosen for further
studies. In order to excise the apramycin resistance cassette, the plasmid
pOSV508 or its derivative pOSV236 was introduced into the mutant strain. The
plasmid pOSV236 was constructed by cloning a fragment containing the pac-oriT
sequence of pWED2 (18) into the EcoRV site of pOSV508. These plasmids
express the excisionase and integrase from pSAM2. As a result, the apramycin
resistance cassette was excised through site-specific recombination, leading to
in-frame deletion of the targeted gene. After loss of the unstable pOSV508 or
pOSV236 plasmid, the in-frame deletion of the targeted gene was verified by
PCR amplification and sequencing of the PCR product.
Using this procedure, sequences of 1,013 bp from srm5, 1,093 bp from srm6,
1,033 bp from srm28, 965 bp from srm29, 980 bp from srm30, and 1,052 bp from
srm38 were replaced by apramycin resistance cassettes. The excisable cassette
att3aac, leaving a scar sequence of 35 bp after excision, was used for the deletion
of srm5, srm29, srm30, and srm38 for which 3n ⫹ 2 bp were deleted, where n is
any integer. The excisable cassette att2⍀aac, leaving a scar sequence of 34 bp
after excision, was used for the deletion of srm6 and srm28 for which 3n ⫹ 1 bp
were deleted. The primer pairs used in the PCR amplifications are presented in
Table 2. The resulting recombinant cosmids obtained after PCR targeting are
presented in Table 1. After gene replacement in S. ambofaciens and excision of
the cassette, the strains SPM121 (⌬srm5::att3), SPM213 (⌬srm6::att2), SPM212
(⌬srm28::att2), SPM108 (⌬srm29::att3), SPM109 (⌬srm30::att3), and SPM110
(⌬srm38::att3) were obtained.
Strains in which two genes were inactivated were constructed by successive
deletion of the genes. Strain SPM212 (⌬srm28::att2) was transformed with the
cosmid pSPM220 to inactivate srm6. After gene replacement and excision of
the cassette, the resulting mutant strain was named SPM215 (⌬srm6::att2
⌬srm28::att2). Strain SPM108 (⌬srm29::att3) was transformed with the cosmid
pSPM220 to inactivate srm6. After gene replacement and excision of the cassette,
the resulting mutant strain was named SPM217 (⌬srm6::att2 ⌬srm29::att3).
Complementation of the mutants. For complementation, the glycosyltrans-
ferase and auxiliary protein genes were expressed under the control of the
constitutive promoter ermE*p, using either the multicopy vector pUWL201 (6)
or the integrative vector pOSV554 (E. Darbon et al., unpublished data). The
srm5, srm6, srm28, srm29, and srm38 genes were PCR amplified using a GC-rich
PCR system (Roche) and the primer pairs KF90/KF91 (srm5), OE.srm6F/
OE.srm6R (srm6), OE.srm28F/OE.srm28R (srm28), KF98/KF97 (srm29), and
KF83/KF84 (srm38), respectively. The PCR products were then cloned into
pGEMT-Easy, and their sequences were verified. The genes were then cloned as
HindIII-PstI fragments into either pOSV554 (srm6 and srm28) or pUWL201
2834 NGUYEN ET AL.
(srm29) or as HindIII-BamHI fragments into pUWL201 (srm5 and srm38),
yielding the plasmids pSPM133 for srm5, pSPM222 for srm6, pSPM224 for
srm28, pSPM154 for srm29, and pSPM129 for srm38. These constructs were
introduced into S. ambofaciens mutants either by protoplast transformation
(pSPM154, pSPM129, and pSPM133) or by conjugation (pSPM224 and
pSPM222).
LC-MS analyses. After 4 days of culture at 26°C, supernatants were filtered
through an Ultrafree-MC filter unit (0.1-␮m pore size; Millipore) and analyzed
on an Atlantis dC18 column (250 mm by 4.6 mm; particle size, 5 ␮m; column
temperature, 25°C) using an Agilent 1200 HPLC instrument equipped with a
quaternary pump. Samples were eluted with isocratic 0.1% HCOOH in H2O
(solvent A)–0.1% HCOOH in CH3CN (solvent B) (95:5) at 1 ml min⫺1 for 5 min,
followed by a gradient to 50:50 solvent A/solvent B over 35 min. Spiramycins
were detected by monitoring absorbance at 232 nm. A Bruker Daltonik Esquire
HCT ion trap mass spectrometer equipped with an orthogonal atmospheric
pressure interface-electrospray ionization (AP-ESI) source was used for liquid
chromatography-mass spectrometry (LC-MS) analyses. Elution from the Atlantis
dC18 was split into two flows: 1/10 was directed to the ESI-mass spectrometer for
MS and tandem MS (MS/MS) measurements, and the remaining 9/10 was di-
rected to a diode array UV detector. In the ESI process, nitrogen served as the
drying and nebulizing gas, and helium gas was introduced into the ion trap both
for efficient trapping and cooling of the ions generated by the ESI and for
fragmentation processes. Ionization was carried out in positive/negative mode
with the nebulizing gas set at 241 kPa, the drying gas set at 8 ␮l/min, and the
drying temperature set at 345°C for optimal spray and desolvation. Ionization
and mass analysis conditions (capillary high voltage, skimmer and capillary exit
voltages, and ion transfer parameters) were tuned for optimal detection of
compounds in the range of masses between 50 and 1,000 m/z.
RESULTS
Putative glycosyltransferases and auxiliary proteins en-
coded in the spiramycin biosynthetic gene cluster. There are
three deoxysugar moieties in the spiramycin molecule: two
amino sugars, mycaminose and forosamine, and one neutral
sugar, mycarose (Fig. 1A). Enzymes involved in the biosynthe-
sis of these sugars are encoded by genes in the spiramycin
biosynthetic gene cluster (18). The analysis of the cluster re-
vealed the presence of four genes (srm5, srm29, srm30, and
srm38) encoding putative glycosyltransferases (18) (Fig. 1B).
This was unexpected as there is usually one specific glycosyl-
transferase for each sugar to be transferred. To explain the
discrepancy between the number of putative glycosyltrans-
ferases and the number of sugar moieties, several hypotheses
can be formulated. For instance, one of these genes might not
be expressed. However, transcriptional analysis of the cluster
showed that all four genes are transcribed during spiramycin
biosynthesis, and their transcription is coregulated with that of
the other biosynthetic genes (F. Karray et al., unpublished
data). Alternatively, the product of one of the genes might be
inactive, but comparisons and alignments with the protein se-
quences of functional glycosyltransferases did not provide any
obvious indication that this might be the case. In that light, if
all of the glycosyltransferases are expressed and active, two of
them could independently catalyze the attachment of the same
sugar. Finally, one of the four glycosyltransferases may be
involved in a process other than spiramycin biosynthesis, for
instance, in macrolide resistance by drug inactivation, which
has been observed in Streptomyces antibioticus, a producer of
the macrolide oleandomycin (32).
In the spiramycin cluster, two genes (srm6 and srm28) en-
code putative glycosyltransferase auxiliary proteins. These two
genes are located immediately upstream of putative glycosyl-
transferase genes (srm5 and srm29), as is generally the case.
Gene clusters studied thus far contained only one gene coding
ANTIMICROB. AGENTS CHEMOTHER.
TABLE 3. Spiramycin production by the wild-type strain and
mutant strains in which the putative glycosyltransferase
genes have been inactivated
Spiramycin
Straina Characteristics
production
OSC2 Wild type ⫹
SPM108 ⌬srm29::att3 in OSC2 ⫺
SPM109 ⌬srm30::att3 in OSC2 ⫹
SPM110 ⌬srm38::att3 in OSC2 ⫺
SPM121 ⌬srm5::att3 in OSC2 ⫺
SPM108(pSPM154) ⌬srm29::att3 in OSC2 complemented ⫹
by srm29
SPM110(pSPM129) ⌬srm38::att3 in OSC2 complemented ⫹
by srm38
SPM121(pSPM133) ⌬srm5::att3 in OSC2 complemented ⫹
by srm5
a
The name of the plasmid harbored by the strain is given in parentheses.
Downloaded from http://aac.asm.org/ on July 7, 2019 by guest
for an auxiliary protein, and it has been shown that when
several glycosyltransferases are encoded within the gene clus-
ter, the auxiliary protein activates only the glycosyltransferase
encoded next to the auxiliary protein gene in the cluster. How-
ever, it has been shown for DesVII, which requires the auxil-
iary protein DesVIII for its activity, that heterospecific auxil-
iary proteins can also activate DesVII in the absence of
DesVIII, although with a reduced efficiency (14).
With four glycosyltransferases and two auxiliary proteins
encoded within the spiramycin gene cluster, the situation ap-
pears complex and deserves further study. Moreover, this pro-
vides the opportunity to study the interplay of two auxiliary
proteins with different glycosyltransferases in a natural situa-
tion. To address the questions on the roles of the different
proteins in spiramycin glycosylation, the six genes encoding the
putative glycosyltransferases or auxiliary proteins were inacti-
vated, and the resulting mutant strains were studied.
Identification of the glycosyltransferases involved in spira-
mycin biosynthesis. The wild-type strain OSC2 and the four
mutant strains inactivated in one of the putative glycosyltrans-
ferase genes [SPM108 (⌬srm29::att3), SPM109 (⌬srm30::att3),
SPM110 (⌬srm38::att3), and SPM121 (⌬srm5::att3)] were grown
in the spiramycin production medium. The production of spi-
ramycin by these strains was then analyzed by bioassays and
HPLC; the results are presented in Table 3. Three of the four
mutant strains no longer produced spiramycin, but one of
them, SPM109 (⌬srm30::att3), still synthesized it. To verify that
the lack of spiramycin production in the three nonproducing
mutants was really due to the inactivation of the glycosyltrans-
ferase gene, complementation experiments were performed.
When a glycosyltransferase gene cloned into a multicopy vec-
tor and transcribed from the constitutive ermE*p promoter was
introduced into the corresponding mutant strain, spiramycin
production was restored (Table 3).
These results indicated that three of the glycosyltransferase
genes (srm5, srm29, and srm38) are involved in spiramycin
biosynthesis. As the inactivation of srm30 had no effect on
spiramycin biosynthesis, the role of this gene remains elusive.
Identification of the sugars added by the glycosyltrans-
ferases. During spiramycin biosynthesis, the sugars are added
in a preferred order (28). Mycaminose is the first sugar at-
tached to platenolide, at C-5, yielding forocidin. Then, foro-
samine is attached to C-9, yielding neospiramycin. Mycarose is
VOL. 54, 2010 GLYCOSYLATION STEPS IN SPIRAMYCIN BIOSYNTHESIS 2835

the last to be attached, and it is linked to mycaminose, to give

spiramycin. As three glycosyltransferases seemed to be required
for spiramycin biosynthesis, each of them should catalyze the
incorporation of one specific sugar. Sequence comparisons with
characterized enzymes that transfer mycaminose, mycarose, or
forosamine and analyses performed with SEARCHGTr (a pro-
gram for the analysis of glycosyltransferases involved in glyco-
sylation of secondary metabolites [16]) did not allow us to
make unambiguous predictions concerning the sugars trans-
ferred by the three glycosyltransferases. Thus, to determine the
role of each glycosyltransferase, we used LC-MS to analyze the
culture supernatant of the wild-type strain and of the mutant
strains with deletions of a glycosyltransferase gene. The results
are presented in Fig. 2.
In the supernatant of the wild-type strain, the three forms of

Downloaded from http://aac.asm.org/ on July 7, 2019 by guest

spiramycin were detected, together with small amounts of the
two forms of the aglycone and platenolide I and II, which differ
by the group at C-9 (a keto group for platenolide I and a
hydroxyl group for platenolide II). No other biosynthetic in-
termediates were detected. In the supernatant of the SPM121
(⌬srm5::att3) mutant strain, the two forms of platenolide were
found, but no glycosylated intermediates were detected. This is
consistent with the involvement of Srm5 in the attachment of
the first sugar added, mycaminose. Forocidin was the only
glycosylated intermediate detected in the supernatant of the
SPM108 (⌬srm29::att3) mutant strain, in addition to the two
forms of platenolide. This indicated that, in this mutant strain,
mycaminose could be attached to platenolide, but further gly-
cosylation was not possible, consistent with the involvement of
Srm29 in forosamine attachment. The two forms of platenolide
and forocidin and neospiramycin could be detected in the
supernatant of the SPM110 (⌬srm38::att3) mutant strain. This
indicated that Srm38 is involved in the attachment of my-
carose.
Involvement of the auxiliary proteins in glycosylation. The
srm6 gene, encoding a putative auxiliary protein, is located
immediately upstream of the gene encoding the Srm5 mycam-
inosyltransferase. The other gene encoding a putative auxiliary
protein, srm28, is located upstream of the gene encoding the
Srm29 forosaminyltransferase. According to previous studies
of auxiliary proteins, Srm6 might be required for the full ac-
tivity of Srm5, and Srm28 might be required for the full activity
of Srm29. To study the role of the putative glycosyltransferase
auxiliary proteins in spiramycin biosynthesis, the ability of the
corresponding mutant strains to synthesize spiramycin was ex-
amined. To take into account a possible interplay of the aux-
iliary proteins, a mutant with a deletion of both srm6 and srm28
was constructed and also studied. Culture supernatants were
studied by bioassays, HPLC, and LC-MS, and relevant results
are presented in Fig. 3 and summarized in Table 4.
The inactivation of srm6 did not suppress spiramycin pro- FIG. 2. LC-MS analysis of the metabolites produced by S. ambo-
duction; the three forms of spiramycin (together with small faciens mutant strains. Extracted ion currents are shown for com-
amounts of the two forms of platenolide) were present in the pounds with m/z values corresponding to those of the three forms of
culture supernatant of the mutant strain SPM213 (⌬srm6::att2) spiramycin, the two forms of platenolide, and the glycosylated inter-
mediates of spiramycin biosynthesis. Strains are as follows: OSC2 (A),
(Fig. 3A). Moreover, the deletion of srm6 was accompanied by
SPM121 (⌬srm5::att3) (B), SPM108 (⌬srm29::att3) (C), strain SPM110
an increase in spiramycin production (Table 4). The reason for (⌬srm38::att3) (D). Peak 1, spiramycin I; peak 2, spiramycin II; peak 3,
this increase is unknown, but the same phenomenon was ob- spiramycin III; peak 4, platenolide II; peak 5, platenolide I; peak 6,
served for three independent srm6 inactivation mutant strains. forocidin; and peak 7, neospiramycin. Intensity is expressed in arbi-
In contrast, the inactivation of srm28 abolished spiramycin trary units.
production in the SPM212 (⌬srm28::att2) strain. This effect
2836 NGUYEN ET AL. ANTIMICROB. AGENTS CHEMOTHER.

was due to the inactivation of srm28 because the introduction

of the srm28 gene, expressed under the control of the consti-
tutive ermE*p promoter and carried by an integrative vector,
into the SPM212 strain restored spiramycin biosynthesis (Ta-
ble 4). When the SPM212 culture supernatant was analyzed by
LC-MS, small amounts of forocidin could be detected, to-
gether with the two forms of platenolide (Fig. 3B). No other
glycosylated intermediates were detected, indicating that gly-
cosylation was blocked after the addition of mycaminose, and
forosamine could not be attached. This is in agreement with
the requirement of the auxiliary protein Srm28 for the activity
of the forosaminyltransferase Srm29. The amount of forocidin
present in culture supernatants of strain SPM212 was sufficient
for detection by LC-MS but not for reliable quantification.
This low level of intermediate accumulation is reminiscent of

Downloaded from http://aac.asm.org/ on July 7, 2019 by guest

FIG. 3. LC-MS analysis of the metabolites produced by S. ambofa-
ciens mutant strains. Extracted ion currents are shown for compounds
with m/z values corresponding to those of the three forms of spiramycin,
the two forms of platenolide, and the glycosylated intermediates of spi-
ramycin biosynthesis. Strains are as follows: SPM213 (⌬srm6::att2) (A),
SPM212 (⌬srm28::att2) (B), and SPM215 (⌬srm6::att2 ⌬srm28::att2) (C).
Peak 1, spiramycin I; peak 2, spiramycin II; peak 3, spiramycin III; peak
4, platenolide II; peak 5, platenolide I; and peak 6, forocidin. Intensity is
expressed in arbitrary units.
the observation that in Streptomyces fradiae inactivation of
some glycosyltransferase or deoxyhexose biosynthetic genes
involved in tylosin biosynthesis did not lead to the accumula-
tion of the macrolactone (tylactone) under conditions that
normally favor tylosin production (4, 7). The complementation
experiment, in which high levels of spiramycin production are
obtained, demonstrates that the mutant strain SPM212 is not
impaired in other spiramycin biosynthetic genes.
As expected from the phenotype of the srm28 deletion mu-
tant, the SPM215 (⌬srm6::att2 ⌬srm28::att2) mutant strain did
not produce any spiramycin. However, when the SPM215 cul-
ture supernatant was analyzed by LC-MS, the two forms of
platenolide were the only intermediates detected (Fig. 3C). No
glycosylated intermediates were detected, indicating that this
strain was impaired not only in forosamine attachment, as
expected, but also in mycaminose attachment. This indicated
that Srm6, although dispensable, nevertheless plays a role in
glycosylation and that Srm5 also requires an auxiliary protein
for its activity.
Interplay of the auxiliary proteins. No glycosylated spiramy-
cin biosynthetic intermediates were observed in the culture
supernatants of the SPM215 strain, which is devoid of both
auxiliary proteins. To further investigate the possible role of
Srm6 in glycosylation and the possible interplay of the auxiliary
proteins, each of the genes srm6 or srm28, expressed under the
control of the constitutive ermE*p promoter and carried by an
integrative vector, was introduced into SPM215.
When srm6 was introduced into this mutant, yielding the
strain SPM215(pSPM222), forocidin was detected (Table 4).
This demonstrated that Srm6 can interact with the Srm5 gly-

TABLE 4. Glycosylated compounds synthesized by S. ambofaciens strains

Glycosylated compound detected Amt of spiramycin
Straina Description
Forocidin Neospiramycin Spiramycin (␮M/g of DCW ⫾ SD)b

OSC2 Wild type ⫺ ⫺ ⫹ 71.5 ⫾ 3.5

SPM213 ⌬srm6::att2 in OSC2 ⫺ ⫺ ⫹ 181.5 ⫾ 5.8
SPM212 ⌬srm28::att2 in OSC2 ⫹ ⫺ ⫺ 0
SPM215 ⌬srm28::att2 ⌬srm6::att2 in OSC2 ⫺ ⫺ ⫺ 0
SPM212(pSPM224) SPM212 complemented by srm28 ⫺ ⫺ ⫹ 178.5 ⫾ 3.1
SPM215(pSPM222) SPM215 complemented by srm6 ⫹ ⫺ ⫺ 0
SPM215(pSPM224) SPM215 complemented by srm28 ⫺ ⫺ ⫹ 194.9 ⫾ 3.1
SPM217 ⌬srm29::att3 ⌬srm6::att2 in OSC2 ⴙ ⫺ ⫺ 0
a
The name of the plasmid harbored by a strain is given in parentheses.
b
For strains synthesizing spiramycin, the total amount of the three forms of spiramycin is given. DCW, dry cell weight.
VOL. 54, 2010
FIG. 4. Schematic representation of the glycosylation steps during spiramycin biosynthesis. The intermediates (platenolide I, forocidin, and
neospiramycin) are presented together with the glycosyltransferase associated with each glycosylation step. The interactions of the glycosyltrans-
ferases with the two auxiliary proteins are also represented by dotted lines. The two forms of platenolides (platenolide I and II) are also presented.
cosyltransferase and promote the transfer of mycaminose. The
fact that spiramycin biosynthesis is blocked after forocidin for-
mation demonstrated that there was no productive interaction
between Srm6 and Srm29. When srm28 was introduced into
SPM215, yielding SPM215(pSPM224), it restored spiramycin
production. As both Srm5 and Srm29 require an auxiliary
protein, this showed that Srm28 was able to interact effi-
ciently with both glycosyltransferases. The interaction of
Srm28 with the Srm5 mycaminosyltransferase was confirmed
by the study of the SPM217 (⌬srm6::att2 ⌬srm29::att3) mu-
tant strain. In this strain, the Srm28 auxiliary protein could
not activate the Srm29 forosaminyltransferase, whose gene
was deleted. The Srm6 auxiliary protein, whose gene was
deleted, could not activate the Srm5 mycaminosyltrans-
ferase. However, this strain could produce forocidin (Table
4), confirming that Srm28 activates Srm5. Figure 4 summarizes
the results obtained concerning the enzymes involved in the
glycosylation of spiramycin.
DISCUSSION
The work reported here shows that, among the four pu-
tative glycosyltransferases encoded within the spiramycin
biosynthetic gene cluster, only three are involved in spira-
mycin biosynthesis. Each of these three glycosyltransferases
is required for the attachment of a specific sugar: Srm5 is the
GLYCOSYLATION STEPS IN SPIRAMYCIN BIOSYNTHESIS 2837
Downloaded from http://aac.asm.org/ on July 7, 2019 by guest
mycaminosyltransferase, Srm29 is the forosaminyltrans-
ferase, and Srm38 is the mycarosyltransferase. The role of
Srm30, the fourth putative glycosyltransferase, remains un-
known. However, it is known that the srm30 gene is transcribed
at the same time as the other biosynthetic genes. A role for
Srm30 in the inactivation of macrolides was hypothesized. In-
activation of macrolides by glycosylation has been observed in
S. ambofaciens extracts, and two glycosyltransferase activities
could be distinguished by their macrolide substrate profiles (9).
The GimA glycosyltransferase is responsible for one of these
activities. Interestingly, the gene encoding this glycosyltrans-
ferase has been identified, and it is not located within the
spiramycin biosynthetic cluster. However, the gene responsible
for the second activity, called GimB, has not yet been identi-
fied. One possibility could be that the Srm30 glycosyltrans-
ferase is responsible for this activity, a situation that would be
similar to that in S. antibioticus, the producer of the macrolide
oleandomycin (32). In S. antibioticus two glycosyltransferases,
OleI and OleD, can inactivate macrolides by glycosylation and
differ in their pattern of substrate specificity. The oleI gene is
located in the oleandomycin biosynthetic gene cluster, while
oleD is located elsewhere in the genome. However, all of our
attempts to demonstrate that Srm30 has a macrolide-inactivat-
ing activity were unsuccessful (data not shown). Moreover, we
constructed an S. ambofaciens mutant strain in which gimA and
2838 NGUYEN ET AL.
srm30 were both deleted. Extracts from this strain retained a
macrolide-inactivating activity (data not shown). While this
does not absolutely rule out the possible involvement of Srm30
in macrolide inactivation, it minimally shows that Srm30 is not
the only gene responsible for the so-called GimB activity.
The involvement of the two glycosyltransferase auxiliary
proteins in spiramycin biosynthesis was also elucidated. Our
results showed that both of them are involved in glycosylation.
The two glycosyltransferases Srm5 and Srm29 require the as-
sistance of an auxiliary protein to perform the attachment of
mycaminose and forosamine, respectively. The genes encoding
these glycosyltransferases are both immediately downstream of
the genes encoding the auxiliary proteins. Each glycosyltrans-
ferase can be activated by the auxiliary protein encoded by the
upstream gene: Srm5 by Srm6 and Srm29 by Srm28. In addi-
tion, we have demonstrated the existence of an interplay be-
tween the auxiliary proteins (i.e., Srm28 can also efficiently
activate Srm5). This explains why srm6 is dispensable for spi-
ramycin biosynthesis. In contrast, we did not observe any ac-
tivation of Srm29 by Srm6. Because of the observed flexibility
of auxiliary proteins, we cannot exclude that Srm38, the my-
carosyltransferase, might require the assistance of an auxiliary
protein, but this cannot be studied in vivo in S. ambofaciens.
As Srm28 possesses certain flexibility, it would be interesting
to determine if it can efficiently activate other glycosyltrans-
ferases requiring the assistance of auxiliary proteins. It was
shown that different auxiliary proteins could activate the
DesVII glycosyltransferase, but the efficiency of the activation
ranged between 26 and 66% compared to that of the natural
partner DesVIII (14). To our knowledge, this is the first report
of the interplay of auxiliary proteins involved in different gly-
cosylation steps during the synthesis of a single compound, but
the auxiliary proteins studied thus far have been involved in
pathways where only one glycosyltransferase required the
assistance of an auxiliary protein. Other macrolide biosyn-
thetic pathways may also involve two auxiliary proteins with
two glycosyltransferases that require them. One such exam-
ple might be the megalomicin biosynthetic pathway. Megalo-
micin, which is produced by Micromonospora megalomicea, is
structurally very similar to erythromycin but differs by the ad-
dition of the deoxyamino sugar megosamine, attached at the
C-6 of the macrolactone. In the megalomicin biosynthetic cluster,
there are two genes located immediately upstream of the
mycaminosyltransferase and megosaminyltransferase genes,
which are predicted to code for auxiliary proteins though they
were originally annotated as nucleoside diphosphate (NDP)-
sugar epimerases (14, 41). It would be interesting to investigate
the role and eventual interplay of the putative auxiliary pro-
teins in this pathway.
Most of the known or putative auxiliary proteins activate
glycosyltransferases that attach amino sugars, and this is also
the case in the spiramycin pathway. However, a role as an
amino sugar carrier for the auxiliary proteins does not seem
probable, as DesVIII equally activates DesVII activity for the
attachment of both amino sugars and nonamino sugars (2). In
this respect, it should be noted that while the Srm29 forosami-
nyltransferase requires the Srm28 auxiliary protein, there is no
evidence for such a requirement for the activity of the SpnP
forosaminyltransferase involved in spinosyn biosynthesis, and
ANTIMICROB. AGENTS CHEMOTHER.
no putative auxiliary protein is encoded in the spinosyn bio-
synthetic gene cluster (15, 42).
The mechanism by which auxiliary proteins activate glyco-
syltransferases remains unclear (2, 3, 24, 44). Auxiliary pro-
teins are most probably not involved in the transfer reaction
itself but might act by inducing a conformational change in the
glycosyltransferase. Further studies of Srm28, which can effi-
ciently activate two different glycosyltransferases for the at-
tachment of two different sugars, may help to better elucidate
the role of these intriguing proteins.
ACKNOWLEDGMENTS
H.C.N. received fellowships from the Vietnamese Ministry of Edu-
cation and from the Université Paris-Sud 11. F.K. was supported by a
CNRS-BDI fellowship. This work was supported in part by the Euro-
Downloaded from http://aac.asm.org/ on July 7, 2019 by guest
pean Union through the Integrated Project ActinoGEN (CT-2004-
0005224) and by Pôle de Recherche et d’Enseignement Supérieur
UniverSud Paris.
REFERENCES
1. Blondelet-Rouault, M. H., J. Weiser, A. Lebrihi, P. Branny, and J. L. Per-
nodet. 1997. Antibiotic resistance gene cassettes derived from the omega
interposon for use in E. coli and Streptomyces. Gene 190:315–317.
2. Borisova, S. A., C. Zhang, H. Takahashi, H. Zhang, A. W. Wong, J. S.
Thorson, and H. W. Liu. 2006. Substrate specificity of the macrolide-glyco-
sylating enzyme pair DesVII/DesVIII: opportunities, limitations, and mech-
anistic hypotheses. Angew. Chem. Int. Ed. Engl. 45:2748–2753.
3. Borisova, S. A., L. Zhao, I. C. Melancon, C. L. Kao, and H. W. Liu. 2004.
Characterization of the glycosyltransferase activity of desVII: analysis of and
implications for the biosynthesis of macrolide antibiotics. J. Am. Chem. Soc.
126:6534–6535.
4. Butler, A. R., S. A. Flint, and E. Cundliffe. 2001. Feedback control of
polyketide metabolism during tylosin production. Microbiology 147:795–801.
5. Chaveroche, M. K., J. M. Ghigo, and C. d’Enfert. 2000. A rapid method for
efficient gene replacement in the filamentous fungus Aspergillus nidulans.
Nucleic Acids Res. 28:E97.
6. Doumith, M., P. Weingarten, U. F. Wehmeier, K. Salah-Bey, B. Benhamou,
C. Capdevila, J. M. Michel, W. Piepersberg, and M. C. Raynal. 2000. Anal-
ysis of genes involved in 6-deoxyhexose biosynthesis and transfer in Saccha-
ropolyspora erythraea. Mol. Gen. Genet. 264:477–485.
7. Fish, S. A., and E. Cundliffe. 1997. Stimulation of polyketide metabolism in
Streptomyces fradiae by tylosin and its glycosylated precursors. Microbiology
143:3871–3876.
8. Geistlich, M., R. Losick, J. R. Turner, and R. N. Rao. 1992. Characterization
of a novel regulatory gene governing the expression of a polyketide synthase
gene in Streptomyces ambofaciens. Mol. Microbiol. 6:2019–2029.
9. Gourmelen, A., M. H. Blondelet-Rouault, and J. L. Pernodet. 1998. Charac-
terization of a glycosyl transferase inactivating macrolides, encoded by gimA
from Streptomyces ambofaciens. Antimicrob. Agents Chemother. 42:2612–
2619.
10. Gust, B., G. L. Challis, K. Fowler, T. Kieser, and K. F. Chater. 2003.
PCR-targeted Streptomyces gene replacement identifies a protein domain
needed for biosynthesis of the sesquiterpene soil odor geosmin. Proc. Natl.
Acad. Sci. U. S. A. 100:1541–1546.
11. Hansen, J. L., J. A. Ippolito, N. Ban, P. Nissen, P. B. Moore, and T. A. Steitz.
2002. The structures of four macrolide antibiotics bound to the large ribo-
somal subunit. Mol. Cell 10:117–128.
12. Hong, J. S. 2005. The role of a second protein (DesVIII) in glycosylation for
the biosynthesis of hybrid macrolide antibiotics in Streptomyces venezuelae. J.
Microbiol. Biotechnol. 15:640–645.
13. Hong, J. S., S. H. Park, C. Y. Choi, J. K. Sohng, and Y. J. Yoon. 2004. New
olivosyl derivatives of methymycin/pikromycin from an engineered strain of
Streptomyces venezuelae. FEMS Microbiol. Lett. 238:391–399.
14. Hong, J. S., S. J. Park, N. Parajuli, S. R. Park, H. S. Koh, W. S. Jung, C. Y.
Choi, and Y. J. Yoon. 2007. Functional analysis of desVIII homologues
involved in glycosylation of macrolide antibiotics by interspecies complemen-
tation. Gene 386:123–130.
15. Hong, L., Z. Zhao, C. E. Melancon III, H. Zhang, and H. W. Liu. 2008. In
vitro characterization of the enzymes involved in TDP-D-forosamine biosyn-
thesis in the spinosyn pathway of Saccharopolyspora spinosa. J. Am. Chem.
Soc. 130:4954–4967.
16. Kamra, P., R. S. Gokhale, and D. Mohanty. 2005. SEARCHGTr: a program
for analysis of glycosyltransferases involved in glycosylation of secondary
metabolites. Nucleic Acids Res. 33:W220–W225.
17. Karray, F. 2005. Etude de la biosynthèse de l’antibiotique spiramycine par
Streptomyces ambofaciens. Ph.D. thesis. Université de Paris-Sud 11, Orsay,
France.
VOL. 54, 2010
18. Karray, F., E. Darbon, N. Oestreicher, H. Dominguez, K. Tuphile, J. Gagnat,
M. H. Blondelet-Rouault, C. Gerbaud, and J. L. Pernodet. 2007. Organiza-
tion of the biosynthetic gene cluster for the macrolide antibiotic spiramycin
in Streptomyces ambofaciens. Microbiology 153:4111–4122.
19. Katz, L., and G. W. Ashley. 2005. Translation and protein synthesis: macro-
lides. Chem. Rev. 105:499–528.
20. Kieser, T., M. J. Bibb, M. J. Buttner, K. F. Chater, and D. A. Hopwood. 2000.
Practical Streptomyces genetics. The John Innes Foundation, Norwich,
United Kingdom.
21. Kuhstoss, S., M. Huber, J. R. Turner, J. W. Paschal, and R. N. Rao. 1996.
Production of a novel polyketide through the construction of a hybrid
polyketide synthase. Gene 183:231–236.
22. Liu, M., and S. Douthwaite. 2002. Resistance to the macrolide antibiotic
tylosin is conferred by single methylations at 23S rRNA nucleotides G748
and A2058 acting in synergy. Proc. Natl. Acad. Sci. U. S. A. 99:14658–14663.
23. Lombo, F., C. Olano, J. A. Salas, and C. Mendez. 2009. Chapter 11. Sugar
biosynthesis and modification. Methods Enzymol. 458:277–307.
24. Lu, W., C. Leimkuhler, G. J. Gatto, Jr., R. G. Kruger, M. Oberthur, D.
Kahne, and C. T. Walsh. 2005. AknT is an activating protein for the
glycosyltransferase AknS in L-aminodeoxysugar transfer to the aglycone
of aclacinomycin A. Chem. Biol. 12:527–534.
25. Melancon, C. E., III, H. Takahashi, and H. W. Liu. 2004. Characterization of
tylM3/tylM2 and mydC/mycB pairs required for efficient glycosyltransfer in
macrolide antibiotic biosynthesis. J. Am. Chem. Soc. 126:16726–16727.
26. Mendez, C., and J. A. Salas. 2001. Altering the glycosylation pattern of
bioactive compounds. Trends Biotechnol. 19:449–456.
27. Miller, V. L., and J. J. Mekalanos. 1988. A novel suicide vector and its use
in construction of insertion mutations: osmoregulation of outer membrane
proteins and virulence determinants in Vibrio cholerae requires toxR. J.
Bacteriol. 170:2575–2583.
28. Omura, S., H. Sano, and T. Sunazuka. 1985. Structure activity relationships
of spiramycins. J. Antimicrob. Chemother. 16(Suppl. A):1–11.
29. Pernodet, J. L., M. T. Alegre, M. H. Blondelet-Rouault, and M. Guerineau.
1993. Resistance to spiramycin in Streptomyces ambofaciens, the producer
organism, involves at least two different mechanisms. J. Gen. Microbiol.
139:1003–1011.
30. Pernodet, J. L., S. Fish, M. H. Blondelet-Rouault, and E. Cundliffe. 1996.
The macrolide-lincosamide-streptogramin B resistance phenotypes charac-
terized by using a specifically deleted, antibiotic-sensitive strain of Strepto-
myces lividans. Antimicrob. Agents Chemother. 40:581–585.
31. Prentki, P., and H. M. Krisch. 1984. In vitro insertional mutagenesis with a
selectable DNA fragment. Gene 29:303–313.
GLYCOSYLATION STEPS IN SPIRAMYCIN BIOSYNTHESIS 2839
32. Quiros, L. M., I. Aguirrezabalaga, C. Olano, C. Mendez, and J. A. Salas.
1998. Two glycosyltransferases and a glycosidase are involved in oleando-
mycin modification during its biosynthesis by Streptomyces antibioticus. Mol.
Microbiol. 28:1177–1185.
33. Raynal, A., F. Karray, K. Tuphile, E. Darbon-Rongere, and J. L. Pernodet.
2006. Excisable cassettes: new tools for functional analysis of Streptomyces
genomes. Appl. Environ. Microbiol. 72:4839–4844.
34. Rix, U., C. Fischer, L. L. Remsing, and J. Rohr. 2002. Modification of
post-PKS tailoring steps through combinatorial biosynthesis. Nat. Prod. Rep.
19:542–580.
35. Roberts, M. C., J. Sutcliffe, P. Courvalin, L. B. Jensen, J. Rood, and H.
Seppala. 1999. Nomenclature for macrolide and macrolide-lincosamide-
streptogramin B resistance determinants. Antimicrob. Agents Chemother.
43:2823–2830.
36. Salas, J. A., and C. Mendez. 2007. Engineering the glycosylation of natural
products in actinomycetes. Trends Microbiol. 15:219–232.
37. Sambrook, J., and D. W. Russel. 2001. Molecular cloning: a laboratory
manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Har-
bor, NY.
38. Schlunzen, F., R. Zarivach, J. Harms, A. Bashan, A. Tocilj, R. Albrecht, A.
Downloaded from http://aac.asm.org/ on July 7, 2019 by guest
Yonath, and F. Franceschi. 2001. Structural basis for the interaction of
antibiotics with the peptidyl transferase centre in eubacteria. Nature 413:
814–821.
39. Simon, R., U. Priefer, and A. Puhler. 1983. A broad host range mobilization
system for in vivo genetic engineering: transposon mutagenesis in Gram
negative bacteria. Nat. Biotechnol. 1:784–791.
40. Vester, B., and S. Douthwaite. 2001. Macrolide resistance conferred by base
substitutions in 23S rRNA. Antimicrob. Agents Chemother. 45:1–12.
41. Volchegursky, Y., Z. Hu, L. Katz, and R. McDaniel. 2000. Biosynthesis of the
anti-parasitic agent megalomicin: transformation of erythromycin to mega-
lomicin in Saccharopolyspora erythraea. Mol. Microbiol. 37:752–762.
42. Waldron, C., P. Matsushima, P. R. Rosteck, Jr., M. C. Broughton, J. Turner,
K. Madduri, K. P. Crawford, D. J. Merlo, and R. H. Baltz. 2001. Cloning and
analysis of the spinosad biosynthetic gene cluster of Saccharopolyspora spi-
nosa. Chem. Biol. 8:487–499.
43. Yu, D., H. M. Ellis, E. C. Lee, N. A. Jenkins, N. G. Copeland, and D. L.
Court. 2000. An efficient recombination system for chromosome engineering
in Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 97:5978–5983.
44. Yuan, Y., H. S. Chung, C. Leimkuhler, C. T. Walsh, D. Kahne, and S.
Walker. 2005. In vitro reconstitution of EryCIII activity for the preparation
of unnatural macrolides. J. Am. Chem. Soc. 127:14128–14129.