Hum Genet (1992) 89:99-104

9 Springer-Verlag1992

13s Haplotypes in various world populations

Cihan Oner:, Aleksandar J. Dimovski 1, Nancy F. Olivieri 2, Gino Schiliro 3, John F. Codrington:' 4,
Sladdehine Fattoum L 5, Adekunle D. Adekile:' 6, Reyhan Oner 1, Gunes T. Yiiregir 7, (~. AItay 8, A. Gurgey s,
Rashik B. Gupta:" 9, Vinod B. Jogessar 1~ Michael N. Kitundu t' ::, Dimitris Loukopoulos 12, Gabriel P. Tamagnini 13,
M. Leticia S. Ribeiro :3, Ferdane Kutlar 1, Li-Hao Gu 1, Kenneth D. Lanclos:, and Titus H.J. Huisman 1
:Department of Biochemistryand Molecular Biology,MedicalCollegeof Georgia, Augusta, GA 30912-2100, USA
2Department of Hematology,The Hospital for Sick Children, Toronto M5G 1X8, Canada
3Department of Pediatric Hematology,Universityof Catania, 1-95125 Catania, Italy
4Academisch Ziekenhuis, Paramaribo, Suriname
5Laboratoire de Biochimie, H6pital d'Enfants, Place Bab-Saadoun,Tunis, Tunisie
6Department of Pediatrics, ObafemiAwolowoUniversity, Ile-Ife, Nigeria
7Department of Biochemistry,Universityof ffukurova,Adana, Turkey
8Children's Medical Center, Hacettepe University,Ankara, Turkey
9Regional Medical Center for Tribals, Jabalpur 482003, India
1~ of Haematology,KingEdward VIII Hospital, P.O. Congella, Durban, Republic of South Africa
l:Yuma FoundationLaboratories, Iramba District, Kinampanda,Tanzania
:2First Department of Medicine, Universityof Athens, Laikon Hospital, GR-11527 Athens, Greece
13Department of Hematology,Centro Hospitalar, P-3000 Coimbra, Portugal

Received July 15, 1991 / Revised October 29, 1991

Summary. We have determined the 13s haplotypes in 709
patients with sickle cell anemia, 30 with SC disease, 91
with S-[~-thalassemia, and in 322 HbS heterozygotes
from different countries. The methodology concerned
the detection of mutations in the promoter sequences of
the Gy_ and Ay-globin genes through dot blot analysis of
amplified DNA with 32p-labeled probes, and an analysis
of isolated H b F by reversed phase high performance
liquid chromatography to detect the presence of the ATX
chain [Ay75(E19) I l e ~ T h r ] that is characteristic for hap-
lotype 17 (Cameroon). The results support previously
published data obtained with conventional methodology
that indicates that the 13s gene arose separately in differ-
ent locations. The present methodology has the advan-
tage of being relatively inexpensive and fast, allowing
the collection of a vast body of data in a short period of
time. It also offers the opportunity of identifying unusual
13s haplotypes that may be associated with a milder ex-
pression of the disease. The numerous blood samples
obtained from many SS patients living in different coun-
tries made it possible to compare their hematological
data. Such information is included (as average values) for
395 SS patients with haplotype 19/19, for 2 with haplo-
type 17/17, for 50 with haplotype 20/20, for 2 with haplo-
type 3/3, and for 37 with haplotype 31/31. Some informa-
tion on haplotype characteristics of normal ~A chromo-
somes is also presented.
Introduction
Sickle cell anemia (SS) is one of the most common
hereditary diseases. Its hematological characteristics and
Offprint requests to: T. H. J. Huisman
clinical severity are variable and are influenced by a
number of factors, including the simultaneous presence
of an a-thalassemia (a-thai), variations in H b F level,
and the haplotype background that is linked to the 13-
globin gene (for review see Nagel and Ranney 1990).
There is also convincing evidence that the ~s mutation
arose in Africa and Saudi Arabia-India on at least five
different types of chromosomes. These chromosomes
have distinct haplotypes that are linked to the [3s gene
and are numbered 17, 19, 20, 3, and 31, respectively,
and are also known as the Cameroon, Benin, Bantu or
CAR (Central African Republic), Senegal, and Saudi
Arabia-India types, respectively (for review see Nagel
and Ranney 1990; Schroeder et al. 1990).
Determination of these haplotypes is based upon the
presence or absence of different restriction sites (re-
viewed in Hattori et al. 1986). We recently detected cer-
tain mutations within the promoter regions of the Gy_
and Ay-globin genes and in the second intervening se-
quence (IVS-II) of the Ay-globin gene that are character-
istic for the listed haplotypes (Lanclos et al. 1991; Di-
movski et al. 1991). A [3s chromosome with haplotype 19
has two specific mutations, one in each of the promoter
sequences, namely -369 (C---~G) Gy and -657 (G-*T)
Ay, that with haplotype 20 has a double-base mutation, a
highly characteristic 6-bp deletion in the Gy promoter,
and a single base pair mutation in the Ay promoter. A 13s
chromosome with haplotype 17 has none of these but
carries a T ~ C mutation at codon 75 (Ay) leading to the
synthesis of the A~tT chain (75 Ile---~Thr; Ricco et al.
1976). The 13s chromosome with either haplotypes 3 or
31 cannot be distinguished from each other by this pro-
cedure. Both have only the C---,T mutation at -158 in
the Gy promoter that results in a high level of Gy chains
100

Table 1. Mutations characteristic for ~3s chromosomes with specific tion of the t y p e s of 7 chain b y r e v e r s e d p h a s e high p e r -
haplotypes. +, The mutation is present; - , the mutation is absent f o r m a n c e liquid c h r o m a t o g r a p h y ( H P L C ; the l a t t e r ap-
Mutations Haplotypes p r o a c h was u s e d in this study). A n a d d e d b e n e f i t o f the
m e t h o d o l o g y is t h a t it allows the selection o f u n u s u a l [3s
17 19 20 3 31
h a p l o t y p e s t h a t differ f r o m the five m a j o r types and a r e
-1106/05 (GC--~TT) (07) - - + - - o f t e n a s s o c i a t e d with a m i l d e r f o r m of the disease.
6 bp deletion ( - C T T T A A ) (07) - - + - - Since the d e v e l o p m e n t o f this m e t h o d o l o g y , we have
-369 (C---~G) (07) - + - - - r e c o n f i r m e d s o m e of the [3s h a p l o t y p e s p r e v i o u s l y d e t e r -
-158 (C--+T) (07) - - - + + m i n e d in o u r l a b o r a t o r y with the restriction e n d o n u c l e a s e
-657 (G---~T) (A~/) _ q_ _ _ _ m e t h o d , a n d all c u r r e n t d a t a w e r e o b t a i n e d with the new
-271 (C--+T) (A7) -- -- + -- -- a p p r o a c h . In the p r e s e n t c o m m u n i c a t i o n , we d e s c r i b e
Hb F high G7 (> 60%) -- _ _ + + o u r e x p e r i e n c e with h a p l o t y p i n g a large n u m b e r of [3s
Hb F with ATT +2 _ _ _b _b c h r o m o s o m e s f r o m p a t i e n t s living in 14 d i f f e r e n t coun-
tries using the n e w a p p r o a c h . D e t a i l s of h e m a t o l o g y and
a Due to a T---~Cmutation at codon 75 of the A7-globin gene
clinical f e a t u r e s for m o s t of the p a t i e n t s have e i t h e r b e e n
b Differentiation of haplotypes 3 and 31 is based on racial/ethnic
p u b l i s h e d o r will b e p u b l i s h e d e l s e w h e r e . T h e d a t a for
background of the subject or on the presence or absence of a
HinclI site 5' to the ~ gene (haplotype 31: +: 3: - ) p a t i e n t s f r o m the U n i t e d States ( H a t t o r i et al. 1986;
K u t l a r et al. 1985), K e n y a ( O j w a n g et al. 1987), a n d
T u n i s i a ( A b b e s et al. 1991; F a t t o u m et al. 1991) in the
( G i l m a n a n d H u i s m a n 1984; T a b l e 1). D i f f e r e n t i a t i o n p r e s e n t study are a r e c o n f i r m a t i o n of a l r e a d y p u b l i s h e d
b e t w e e n the two is b a s e d on the e t h n i c / r a c i a l b a c k - i n f o r m a t i o n , while the o t h e r s r e p r e s e n t n e w a n d o n g o i n g
g r o u n d of the i n d i v i d u a l a n d , in c e r t a i n cases, on t h e analyses.
p r e s e n c e o r a b s e n c e of the HinclI site 5' to the ~ gene
a n d the B a m H I site 3' to the [3-globin gene. M o r e o v e r ,
B e r g et al. (1991) h a v e r e p o r t e d t h a t t h e + A T A / - T Materials and methods
c o n f i g u r a t i o n at p o s i t i o n - 5 3 0 to the [3-globin g e n e is
c h a r a c t e r i s t i c for h a p l o t y p e 31. T o distinguish h a p l o - Blood samples from 1152 individuals were collected in vacutainers
t y p e s 3 a n d 31, a D N A s e g m e n t b e t w e e n p o s i t i o n s - 7 2 4 with EDTA as anticoagulant. The subjects came from 14 different
a n d + 2 7 r e l a t i v e to the C a p site o f the [3-globin gene is countries and had SS, SC disease, sickle cell trait (AS), or Hb 8-]3-
a m p l i f i e d and h y b r i d i z e d with p r o b e s specific for this thal; the 13-thalalleles were not identified.
The United States patients were mainly African Americans
c h a n g e in s e q u e n c e a n d for the n o r m a l s e q u e n c e (for from the Georgia area of the southeastern USA, but included one
m e t h o d o l o g y , see W o n g et al. 1989). T h e m e t h o d o l o g y Arab family. The Canadian patients were Caribbean immigrants:
is r e l a t i v e l y fast; n u m e r o u s a m p l i f i e d D N A s a m p l e s are those from Tunisia and Syria were Arabs, while those from Turkey
p l a c e d on a n y l o n m e m b r a n e a n d are h y b r i d i z e d s e q u e n - were Eti-Turks from ~ukurova province. The Italian and Greei~
tially with the p r o b e s for the f o u r m u t a t i o n s in the G7 patients were Caucasians from Sicily and Athens, respectively.
p r o m o t e r o r the two in t h e a 7 p r o m o t e r . I d e n t i f i c a t i o n The Surinamese were blacks with varying ancestries, and those
from India belonged to the Gond tribal groups from the central
o f h a p l o t y p e 17 r e q u i r e s e i t h e r an a d d i t i o n a l amplifica- part of the country. The Kenyans, Tanzanians, and Angolans were
tion involving the AT-globin g e n e a n d h y b r i d i z a t i o n with Bantus, while the Nigerians were representative of various ethnic
a p r o b e specific for the T--+C m u t a t i o n at c o d o n 75, o r groups (mainly Ibo, Hausa, and Yoruba) and were drawn from
the i s o l a t i o n of H b F f r o m the r e d cells a n d c h a r a c t e r i z a - eight different centers. All patients were attending sickle cell

Table 2. Data about primers and probes.

M, Mutant probe; N, normal probe Sequence Positions Function
5' 3'
ACGTCATAATCTACCAAG GTCATG c7: - 1227 to - 1204 Direct primer
AGCTTAGGGGATAAACTAATTTG A7: -- 1279 to -- 1257 Direct primer
C7
GGCGTCTGGACTAGGAGCTTATTG a,r +53 to +30 Reverse primer

T A C T T C C T [ ~ CATGTTAAG (M) 07: -- 1114 to --1096 - 1106/05 (GC~TT)

TACTTCCT G[GCJCATGTTAAG (N)
CATGCTTTAAACTACAGGC (M) 0,/: --407 to --383 (M) 6-bp deletion
TACATGCTITAAI CTTTAAIA (N) 409 to -391 (N) (-CTTTAA)
CTGGAGCTA~G~AGACAAGAA (M) 07:-378 to -360 -369 (C-+G)
CTGGAGCTAI C I A G A C A A G A A (N)
GAAACGGT~T~ CCTGGCTAAA (M) 0 7 : - 1 4 8 to -166 - 158 (C--,T)
GAAACGGT[CJ CCTGGCTAAA (N)
T G A G G T A A G C A T T A G [ ~ T C T (M) AT: -672 to -654 -657 (G--~T)
TGAGGTAAGCATTAGIGITCT (N)
A G A G A A A A A [ ~ T G G A A T G A C (M) AT: -280 to -262 -271 (C---~T)
A G A G A A A A A C~JTGGAATGAC (N)
 101

clinics in their various countries but the Angolans were residents of
Portugal and attending the Central Hospital in Coimbra. All were
in steady state, i.e., not in crisis or any other acute illness at the
time of blood collection. Less then 10% of the patients were re-
lated, but the AS individuals were mostly relatives of the SS
patients.
All blood samples were kept, as much as possible, at 4~ for
varying periods of time, and were shipped or carried in wet ice by
fast air service and by different authors to Augusta, Ga. Most sam-
ples reached the laboratory more than 3 weeks after collection.
However, complete blood counts were obtained within 1 day of
collection for samples from the United States, Canada, Portugal,
Italy, Greece, and South Africa. These were done either locally at
the centers of collection or in the laboratory in Augusta, Ga.
Hematological data were obtained using an automated cell
counter. All samples were analyzed by isoelectrofocusing (IEF;
Righetti 1986) and by cation exchange HPLC (Biss6 and Wieland
1988; Kutlar et al. 1990), for the quantitation of Hb F and Hb A2.
Hb F was isolated by DEAE-cellulose chromatography (Schroeder
and Huisman 1980) and its 7 chain composition was determined by
reversed phase H P L C (Shelton et al. 1984; Kutlar et al. 1986).
D N A was isolated from the blood samples with the method of
Poncz et al. (1982). For the majority of the samples the 13s muta-
tion was confirmed by dot-blot analysis, hybridizing amplified
D N A with a 32p-labeled oligonucleotide probe that is specific for
the A---~T mutation at codon 6 (Glu---~Val) of the [3-globin gene.
Segments of about 1350 bp of both the c,{_ and Aq,-globin genes
were amplified from genomic D N A with 5' direct oligonucleotide
primers specific for c~, and A7 and a common 3' reverse primer
(Table 2). Aliquots of these amplified D N A samples were blotted
onto nylon membranes and hybridized to the specific 5' end-labeled
oligonucleotide probes listed in Table 2; the listing includes se-
quences of the probes, their locations within the sequences of the
5' flanking regions of the "~-globin genes, and the mutations or the
deletion for which these probes are specific. Methodology has
been detailed in earlier studies (Lanclos et al. 1991; Dimovski et
al. 1991).
Results
Subjects
A total of 1861 13s chromosomes were analyzed; 509 [3s
chromosomes came from patients of North and South
America, 791 from Africa, 426 from Mediterranean
countries, and 135 from Indian donors. The largest group
of patients was from Nigeria, followed by the United
States and Turkey. There was no significant sex differ-
ence in the whole population.
[3s Haplotypes (Table 3)
Four different haplotypes were present in the North and
South American donors; the frequency of haplotype 19
was the highest in all three groups, followed by haplo-
types 20, 3, and 17. The high frequency of haplotype 20
among patients from Surinam was striking. The seven
chromosomes with haplotype 31 were from four mem-
bers of an Arab family, described before (Kutlar et al.
1985). As many as 36 [3s chromosomes had atypical hap-
lotypes; some of these are presently under study.
The data from African patients fell into two groups.
The Kenyan, Angolan, and Tanzanian [3s chromosomes
had haplotype 20, while those of Nigerian subjects had
haplotype 19 with 3.7% haplotype 17, 1.0% haplotype 3,
and 0.8% haplotype 20. As many as 411 of the 426 [3s
chromosomes (96.5%) from the patients of Mediterra-
nean descent had haplotype 19; 13 13s chromosomes are
in need of further characterization. All but two of the
135 Indian 13s chromosomes had haplotype 31; the origin
of two [3s chromosomes with haplotype 17 remains un-
clear.
flA and [3-thal chromosomes
Dimovski et al. (1991) reported the specific changes in
the 5' flanking regions of the G7 and A7 genes of 105 13A
chromosomes from normal African American black in-
dividuals from the southeastern United States. They
found that 26 chromosomes were positive for the -657
G ~ T (A] t) mutation, while 18 of these 26 chromosomes
also had the -369 C---~G (GT) mutation. These two
changes were specific for haplotype 19. None were posi-

Table 3. Number of patients with hemoglobinopathies participating in this study and their 13s haplotypes
Country SS SC AS SI3TM [3s Haplotypes
chromosomes
19 17 20 3 31 Others
U S A (SE) 147 13 41 23 371 205 13 71 56 7 19
Canada 21 11 5 3 61 30 8 7 8 0 8
Surinam 14 1 45 3 77 41 2 23 2 0 9
Kenya 55 0 1 0 111 2 0 109 0 0 0
Tanzania 14 0 13 0 41 0 0 41 0 0 0
Nigeria 294 2 30 3 623 576 23 5 6 0 13
Angola a 6 0 4 0 16 2 0 14 0 0 0
Tunisia 35 2 37 6 115 109 0 0 0 0 6
Saily (Italy) 18 0 19 15 70 70 0 0 0 0 0
Greece 0 0 14 0 14 13 0 0 1 0 0
Turkey 67 1 60 19 214 206 0 0 0 1 7
Syria 2 0 5 4 13 13 0 0 0 0 0
India 36 0 45 12 129 0 2 0 0 127 0
South Africa (Indians) 0 0 3 3 6 0 0 0 0 6 0

Total 709 30 322 91 1861 1267 48 270 73 141 62

a From subjects living in Portugal
102

Table 4. Hematological and Hb composition data for SS patients from different countries with homozygosities for specific 13s haplotypes
(average values with standard deviations in parentheses)? nd, No data: Hb, hemoglobin; PCV, Packed cell volume; RBC, red blood count:
MCV, mean corpuscular volume; MCH, mean corpuscular hemoglobin; MCHC, mean corpuscular hemoglobin concentration
Haplo- Country n Age Hb PCV RBC MCV MCH MCHC A2b Fb Gyc
type (years) (g/dl) Off) 10t2/l (fl) (pg) (g/dl) (%) (%) (%)
19/19 USA 24 7.9 8.80 0.250 3.02 84.0 29.4 35.0 2.9 11.7 40.8
(6.4) (1.0) (0.030) (0.57) (9.0) (4.0) (2.7) (0.5) (5.2) (4.6)
Surinam 5 10.5 8.30 0.294 2.85 102.5 28.8 28.2 3.2 9.3 42.4
(4.8) (1.4) (0.048) (0.35) (8.7) (2.7) (1.8) (1.0) (4.4) (4.0)
Nigeria 249 9.7 7.53 0.282 2.76 103.7 26.8 26.8 2.9 9.2 41.6
(6.0) (1.4) (0.045) (0.65) (13.3) (2.2) (2.2) (1.0) (5.6) (5.9t
Tunisia 35 14.3 8.20 0.250 2.53 98.8 32.4 32.8 2.9 7.6 36.5
(6,7) (1.2) (0.041) (0.31) (8.1) (3.11 (2.6) (1.1) (2.9) (4.3)
Italy 18 11.2 7.55 0.240 2.47 97.2 30.6 31.5 2.9 9.0 39.6
(7.1) (1.6) (0.039) (0.37) (7.5) (3.2) (2.1) (0.7) (4.1) (3.6)
Turkey 62 10.0 8.40 0.250 2.72 91.9 30.7 34.2 2.7 9.8 44.0
(4.2) (1.81 (0.060) (0.65) (7.0) (2,1) (2.0) (0.6) (4.0) (4.1)
Syria 2 4 7.20 0.225 2.73 82.0 26.2 32.0 3.7 7.8 41.1
20 9.20 0.255 2.61 98.0 35.2 36.1 3.1 9.2 40.0
17/17 USA 1 12 7.90 0.225 2.89 77.7 27.3 35.1 3.2 5.4 42.7
Nigeria 1 . . . . . . 3.1 14.1 49.2
20/20 USA 6 9.8 8.20 0.210 2.55 84.5 31.8 37.5 2.5 12.1 41.3
(4.1) (0.9) (0.020) (0.29) (7.11 (3.2) (1.4) (0.35) (6.4) (3.8)
Surinam 3 12.6 7.60 0.290 2.96 98.0 25.7 26.2 3.6 5.7 38.6
(4.8) (1.5) (0.050) (0.60) (7.1) (2.11 (1.5) (0.4) (2.3) (2.9)
Tanzania 12 10.7 6.42 0.247 2.27 108.8 28.8 26.0 nd 8.6 44.0
(6.5) (1.3) (0.050) (0.49) (14.4) (4.9) (1.7) (3.4) (3,6)
Kenya 25 10.9 7.85 0.260 2.54 102.4 30.9 30.2 3.1 7.5 40.6
(7.2) (1.3) (0.040) (0.31) (8.0) (2.8) (1.3) (0.7) (4.5) (4.9)
Angola 4 9.3 7.30 0.207 2.70 88.3 30.5 35.3 nd 2.7 nd
(5.0) (0.5) (-) (0.23) (6.4) (2.4) (1.0) (2.3)
3/3 USA 2 43 9.6 0.280 3.60 79.0 26.7 33.7 3.0 19.2 71.1
15 8.2 0.300 3.11 78.0 26.4 33.5 3.3 14.0 71.2
31/31 USA 3 13.3 10.1 0.295 3.78 78.0 26.7 34.2 1.2 27.8 64.9
(5.8) (1.4) (0.020) (0.12) (4.0) (2.7) (1.3) (0.3) (5.3) (1.3)
India 34 12.1 9.7 0.281 3.17 88.6 30.6 34.5 1.9 23.2 68.6
(8.2) (1.8) (0.038) (0.78) (7.0) (5.2) (1.4) (0.3) (5.9) (3.7)
a The data for the US patients are from Hattori et al. (1986); Kutlar et al. (1985)
b By microchromatography (Schleider et al. 1977) or cation exchange HPLC (Biss6 and Wieland 1988; Kutlar et al. 1990)
c By reversed phase HPLC (Shelton et al. 1984; Kutlar et al. 1986)

tive for haplotype 20. In the same study it was o b s e r v e d
that 23 of 32 c h r o m o s o m e s with a [3-thal m u t a t i o n had
haplotype A (which is similar to the 13s haplotype 3). Five
c h r o m o s o m e s with haplotype B, which is similar to 13s
haplotype 19, were positive for the - 6 5 7 G--+T (17) mu-
tation, but only one c h r o m o s o m e carried the C - - , G mu-
tation at - 3 6 9 (Gy). O n e c h r o m o s o m e with an atypical
haplotype in the study was positive for 13s haplotype 20-
related mutations.
O f the 30 13A c h r o m o s o m e s f r o m Nigerian AS indi-
viduals in the present study, seven (23.3%) were positive
for haplotype 19-specific mutations, while one (3.3%)
was positive for haplotype 20 mutations. T h e [3-thal
c h r o m o s o m e , present in three m e m b e r s of one family,
had haplotype 20-specific mutations. O f the thirteen ~3A
c h r o m o s o m e s f r o m Tanzania, four had haplotype 19-
specific mutations. I n f o r m a t i o n on 13A c h r o m o s o m e s
f r o m the o t h e r countries is not available.
Hematological and hemoglobin (Hb) composition data
C o m p l e t e and satisfactory data could be obtained for
486 SS patients (Table 4). Because m a n y samples were
collected m o r e than 3 weeks before analysis (Surinam,
Nigeria, Tanzania, Syria, India), the PCV, MCV, and
M C H C values should be viewed with reservation. T h e
most severe anemia is f o u n d a m o n g SS patients with
haplotype 20/20, followed by the patients with haplotype
19/19. The hematological data from 37 SS patients with
haplotype 31/31 indicated mild to m o d e r a t e anemia with
an average H b level of a b o u t 10.0 g/dl. H b F values var-
ied considerably but were generally below 10.0% for SS
patients with the 19/19, 17/17, and 20/20 haplotypes.
H i g h e r values with high ~7 values were observed in all
SS patients with haplotype 3/3 and 31/31; detailed infor-
mation a b o u t the Indian SS patients will be presented
elsewhere ( G u p t a et al. 19911.

Discussion
Two recent reviews (Schroeder et al. 1990; Nagel and
Ranney 1990) have summarized the [3s haplotype data
and have estimated the approximate boundaries of the
four major haplotypes. The Senegal type 3 is present in
Atlantic West Africa, the Benin type (19) in central
West Africa, the Bantu (CAR) type (20) in South-central
and Eastern Africa, while the Saudi Arabia-India type
31 is restricted to the Indian subcontinent and the east-
ern section of the Arabian peninsula. The fifth type (17)
is much more restricted, being observed mainly in the
Eton ethnic group of Cameroon (Lapoumeroulie et al.
1989); it was originally observed among African Ameri-
cans living in the southeastern United States (Hattori
et al. 1986). The nearly exclusive occurrence of haplotype
19 among SS patients in various Mediterranean countries
suggests that this [3s chromosome was introduced from
central West Africa via Algeria, Tunisia, and Egypt.
The large body of data presented here supports these
conclusions. The almost exclusive occurrence of one spe-
cific [~s haplotype in patients from different countries (20
in Kenya, Angola, and Tanzania; 19 in Nigeria; 19 in all
Mediterranean countries; 31 in India) is most striking.
The presence of haplotypes 3 and 17 among Nigerian SS
patients is as expected; [3s haplotype 3 is introduced from
the west and 17 from the east (Cameroon). The presence
of haplotype 20 is also not surprising since it is generally
agreed that Bantu migration originated around the
Nigeria/Cameroon area (Nagel 1984). Less evident is the
origin of the [3s haplotype 17 in two Indian tribal patients.
The variation in the relative percentages of the African
~s haplotypes in American, Canadian (mainly immi-
grants from the Caribbean area), and Surinam patients
likely reflects the origins of their predecessors. Appar-
ently, many slaves in South America were Bantus who
carry the [3s chromosome with haplotype 20.
Recently, Bouhassira et al. (1989) suggested the oc-
currence of a gene conversion in the [3s chromosome
with haplotype 20 that involves the replacement of the
A7 sequence by a G7 sequence in the promoter of the Av-
globin gene. The 5' limit of the conversion is thought to
be located between positions - 3 0 6 and - 2 7 1 (at position
- 2 7 1 the C is replaced by a T as in Gy) and the 3' limit
between positions +25 (the A is replaced by G) and
+1108 (the T found in Ay is retained; the 6y-globin gene
has an A at this position). The authors observed that this
conversion is highly, but not exclusively, associated with
haplotype 20 because some normal chromosomes also
appear to carry this change. Moreover, the frequency of
the conversion, determined for 11 SS patients with a
homozygosity for haplotype 20, was 0.82. The charac-
terization of the 13s chromosomes with haplotype 20,
listed in Table 3, is based upon the presence of changes
in the Gy and a,~ promoters, including the C---~Tmutation
at position - 2 7 1 (Ay) (Table 2). All 270 [3s chromosomes
with haplotype 20 of the patients from the southeastern
United States, the Caribbean area (the Canadian pa-
tients), Surinam, and the African countries carried that
mutation, while the other [3s chromosomes, the [3A, 13c,
and [3-thal chromosomes, did not.
103
The polymerase chain reaction (PCR) amplification
method for mass screening of 13s haplotypes has the
advantage over the restriction enzyme methodology of
being fast, simple, and accurate, as was indicated by the
excellent agreement between the data obtained with the
two approaches (Dimovski et al. 1991). Another advan-
tage is the rapid selection of unusual haplotypes that are
associated with a milder expression of the disease; an
example is a new genetic rearrangement for the hybrid
haplotype (3/19) found in a Turkish SS patient with mild
disease and a high level of Hb F ((3ner et al. 1991). On
the other hand, the method failed to detect the rare 13s
haplotype observed among Indian SS patients that is
closely related to the common haplotype 31 (Kulozik et
al. 1986).
Acknowledgement. This study was supported by United States
Public Health Service research grant HLB-41544.
References
Abbes S, Fattoum S, Vidaud M, Goossens M, Rosa J (1991) Sickle
cell anemia in the Tunisian population: haplotyping and Hb F
expression. Hemoglobin 15 : 1-9
Berg PE, Mittleman M, Elion J, Labie D, Schechter AN (1991)
Increased protein binding to a -530 mutation of the human
[3-globin gene associated with decreased [3-globin synthesis.
Am J Hematol 36: 42-47
Biss6 E, Wieland H (1988) High-performance liquid chromato-
graphic separation of human haemoglobins: simultaneous
quantitation of foetal and glycated haemoglobins. J Chro-
matogr 434 : 95-110
Bouhassira EE, Lachman H, Krishnamoorthy R, Labie D, Nagel
RL (1989) A gene conversion located 5' to the Ay gene in
linkage disequilibrium with the Bantu haplotype in sickle cell
anemia. J Clin Invest 83 : 2070-2073
Dimovski AJ, Oner C, Agarwal S, Gu Y-C, Kutlar F, Lanclos
KD, Huisman THJ (1991) Certain mutations observed in the
5' sequences of the G?_and AT-globingenes of ~s chromosomes
are specific for chromosomes with major haplotypes. Acta
Haematol (Basel) 85 : 79-87
Fattoum S, Guemira F, Oner C, Oner R, Li H-W, Kutlar F, Huis-
man THJ (1991) ~-Thalassemia, Hb S-[3-thalassemia and sickle
cell anemia among Tunisians. Hemoglobin 15:11-21
Gilman JG, Huisman THJ (1984) Two independent genetic factors
in the [3-globin gene cluster are associated with high Gv levels
in the Hb F of SS patients. Blood 64 : 452-457
Gupta RB, Tiwary RS, Pande PL, Kutlar F, Oner C, Oner R,
Huisman THJ (1991) Hemoglobinopathies among the Gond
tribal groups of Central India; interaction of u- and [3-thalas-
semia with 13chain variants. Hemoglobin 15 : 441-458
Hattori Y, Kutlar F, Kutlar A, McKie VC, Huisman THJ (1986)
Haplotypes of ~s chromosomes among patients with sickle cell
anemia from Georgia. Hemoglobin 10 : 623-642
Kulozik AE, Wainscoat JS, Serjeant GR, Kar BC, AI-Awamy B,
Essan GJF, Falusi AG, Haque SK, Hilali AM, Kate AS,
Ranasinghe WAEP, Weatherall DJ (1986) Geographical sur-
vey of Bs globin gene haplotypes: evidence for an independent
Asian origin of the sickle cell mutation. Am J Hum Genet
39: 239-244
Kutlar A, Hattori Y, Bakioglu I, Kutlar F, Kamel K, Huisman THJ
(1985) Hematological observations on Arabian SS patients
with a homozygosity or heterozygosity for a ~s chromosome
with haplotype 31. Hemoglobin 9 : 545-557
Kutlar F, Kutlar A, Huisman THJ (1986) Separation of normal
and abnormal hemoglobin chains by reversed phase high per-
formance liquid chromatography. J Chromatogr 357:147-153
104
Kutlar A, Kutlar F, Gu L-G, Mayson SM, Huisman THJ (1990)
Fetal hemoglobin in normal adults and 13-thalassemia hetero-
zygotes. Hum Genet 86:106-110
Lanclos KD, Oner C, Dimovski AJ, Gu Y-C, Huisman THJ (1991)
Sequence variations in the 5' flanking and IVS-II regions for
the ~ - and a,/-globin genes of 13s chromosomes with five differ-
ent haplotypes. Blood 77 : 2488-2496
Lapoumeroulie C, Dunda O, Trabuchet G, Mony-Lobe M, Labie
D, Elion J, Krishnamoorthy R (1989) A novel sickle gene of
yet another origin in Africa: the Cameroon type. Blood [Suppl
1] 74:63a
Nagel RL (1984) The origin of the hemoglobin S gene: clinical,
genetic and anthropological consequences. Einstein Quart J
Biol Med 2 : 53-62
Nagel RL, Ranney HM (1990) Genetic epidemiology of structural
mutations of the 13-globingene. Semin Hematol 27 : 342-359
Ojwang PJ, Ogada T, Beris P, Hattori Y, Lanclos KD, Kutlar A,
Kutlar F, Huisman THJ (1987) Haplotypes and ~. globin gene
analyses in sickle cell anaemia patients from Kenia. Br J
Haematol 65 : 211-215
Oner C, Dimovski AJ, Altay (7, Gurgey A, Gu YC, Huisman
THJ, Lanclos KD (1992) Sequence variations in the 5' hyper-
sensitive site-2 of the locus control region of 13s chromosomes
are associated with different levels of fetal globin in Hb S ho-
mozygotes. Blood 78 : 813-819
Poncz M, Solowiejczyk D, Harpel B, Mory Y, Schwartz E, Surrey
S (1982) Construction of human gene libraries from small
amounts of peripheral blood: analysis of 13-like globin genes.
Hemoglobin 6 : 27-36
Ricco G, Mazza U, Turi RM, Pich PG, Camaschella C, Saglio G,
Bernini LF (1976) Significance of a new type of human fetal
hemoglobin carrying a replacement isoleucine-+threonine at
position 75(E19) of the 7 chain. Hum Genet 32:305-313
Righetti PG (1986) Practical application of isoelectricfocusing in
hemoglobin separation and identification. In: Huisman THJ
(ed) The hemoglobinopathies. (Methods in hematology, vol
15) Churchill-Livingstone, Edinburgh, pp 47-70
Schleider CTH, Mayson SM, Huisman THJ (1977) Further modifi-
cation of the microchromatographic determination of hemo-
globin A2. Hemoglobin 1 : 503-504
Schroeder WA, Huisman THJ (1980) The chromatography of
hemoglobin. (Clinical and biochemical analysis, vol 9) Dekker,
New York
Schroeder WA, Munger ES, Powars DR (1990) Sickle cell
anaemia, genetic variations, and the slave trade to the United
States. J African Hist 31 : 163-180
Shelton JB, Shelton JR, Schroeder WA (1984) High performance
liquid chromatographic separation of globin chains on a large-
pore C4 column. J Liquid Chromatogr 7:1969-1977
Wong SC, Stoming TA, Efremov GD, Huisman THJ (1989) High
frequencies of a rearrangement (+ATA; - T ) at -530 to the 13-
globin gene in different populations indicate the absence of a
correlation with a silent [3-thalassemia determinant. Hemo-
globin 13 : 1-5