This article was downloaded by: [Consortium for e-Resources in Agriculture]

On: 16 September 2009

Access details: Access Details: [subscription number 912062045]
Publisher Taylor & Francis
Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,
37-41 Mortimer Street, London W1T 3JH, UK

Journal of Environmental Science and Health, Part B

Publication details, including instructions for authors and subscription information:
http://www.informaworld.com/smpp/title~content=t713597269

Enrichment and isolation of endosulfan-degrading microorganism from tropical

acid soil
Surya Kalyani S a; Jitender Sharma b; Surender Singh c; Prem Dureja d; Lata c
a
Food and Agriculture Department, Bureau of Indian Standards, New Delhi, India b Department of
Biotechnology, Kurukshetra University, Kurukshetra, Haryana, India c Division of Microbiology, Indian
Agricultural Research Institute, New Delhi, India d Division of Agricultural Chemicals, Indian Agricultural
Research Institute, New Delhi, India

Online Publication Date: 01 September 2009

To cite this Article Kalyani S, Surya, Sharma, Jitender, Singh, Surender, Dureja, Prem and Lata(2009)'Enrichment and isolation of
endosulfan-degrading microorganism from tropical acid soil',Journal of Environmental Science and Health, Part B,44:7,663 — 672
To link to this Article: DOI: 10.1080/03601230903163665
URL: http://dx.doi.org/10.1080/03601230903163665

PLEASE SCROLL DOWN FOR ARTICLE

Full terms and conditions of use: http://www.informaworld.com/terms-and-conditions-of-access.pdf

This article may be used for research, teaching and private study purposes. Any substantial or
systematic reproduction, re-distribution, re-selling, loan or sub-licensing, systematic supply or
distribution in any form to anyone is expressly forbidden.

The publisher does not give any warranty express or implied or make any representation that the contents
will be complete or accurate or up to date. The accuracy of any instructions, formulae and drug doses
should be independently verified with primary sources. The publisher shall not be liable for any loss,
actions, claims, proceedings, demand or costs or damages whatsoever or howsoever caused arising directly
or indirectly in connection with or arising out of the use of this material.
 Journal of Environmental Science and Health Part B (2009) 44, 663–672
Copyright
C Taylor & Francis Group, LLC

ISSN: 0360-1234 (Print); 1532-4109 (Online)

DOI: 10.1080/03601230903163665

Enrichment and isolation of endosulfan-degrading

microorganism from tropical acid soil

SURYA KALYANI S1 , JITENDER SHARMA2 , SURENDER SINGH3 , PREM DUREJA4 and LATA3
1
Food and Agriculture Department, Bureau of Indian Standards, New Delhi, India
2
Department of Biotechnology, Kurukshetra University, Kurukshetra, Haryana, India
3
Division of Microbiology, Indian Agricultural Research Institute, New Delhi, India
4
Division of Agricultural Chemicals, Indian Agricultural Research Institute, New Delhi, India
Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009

Endosulfan (6,7,8,9,10,10-hexachloro-1,5,5a,6,9,9a-hexahydro-6,9-methano-2,3,4-benzo-dioxathiepin-3-oxide) is a cyclodiene

organochlorine currently used as an insecticide all over the world and its residues are posing a serious environmental threat.
This study reports the enrichment and isolation of a microbial culture capable of degrading endosulfan with minimal production of
endosulfan sulfate, the toxic metabolite of endosulfan, from tropical acid soil. Enrichment was achieved by using the insecticide as
sole sulfur source. The enriched microbial culture, SKL-1, later identified as Pseudomonas aeruginosa, degraded up to 50.25 and 69.77
% of α and β endosulfan, respectively in 20 days. Percentage of bioformation of endosulfan sulfate to total formation was 2.12% by
the 20th day of incubation. Degradation of the insecticide was concomitant with bacterial growth reaching up to an optical density of
600 nm (OD600) 2.34 and aryl sulfatase activity of the broth reaching up to 23.93 µg pNP/mL/hr. The results of this study suggest
that this novel strain is a valuable source of potent endosulfan–degrading enzymes for use in enzymatic bioremediation. Further, the
increase in aryl sulfatase activity of the broth with the increase in degradation of endosulfan suggests the probable involvement of
the enzyme in the transformation of endosulfan to its metabolites.
Keywords: Biodegradation; endosulfan; endosulfan sulfate; Pseudomonas aeruginosa; tropical acid soil.

Introduction step in the investigation of enzymatic technologies for en-

Endosulfan (6, 7, 8, 9, 10, 10-hexachloro-1, 5, 5a, 6, 9a-
hexahydro-6, 9-methano-2, 3, 4-benzodioxyanthiepin- 3-
oxide) is widely employed as an insecticide in world agri-
culture. Technical grade endosulfan contains two stereoiso-
mers, α and β endosulfan in the ratio of 7: 3. In the close
vicinities of agricultural fields, the contamination of at-
mosphere, soils, sediments, surface and rain waters and
foodstuffs by endosulfan has been documented in numer-
ous previous studies.[1] The persistence of endosulfan in
soil and water environments has been observed by different
researchers under different conditions.[2,3] Its harmful im-
pacts on aquatic fauna and numerous mammalian species
including human beings have been reported several times
in literature.[4−7]
Detoxification of pesticides through biological means
is receiving serious attention as an alternative to existing
methods, such as incineration and landfill. A preliminary
Address correspondence to Jitender Sharma, Department of
Biotechnology, Kurukshetra University, Kurukshetra, Haryana,
India; E-mail: jksharma.kuk@gmail.com
Received December 3, 2008.
dosulfan detoxification is the definitive identification of a
biological source of endosulfan–degrading activity.
In a bioremediation process, heterotrophic microorgan-
isms break down substrates (hazardous compounds) to ob-
tain chemical energy, hence organic pollutants can serve as
carbon, energy and nutrient sources for microbial growth.
Some studies have described endosulfan as a sulfur source
for microbial growth and a poor biological energy source
when used as a sole carbon source.[8,9] Sutherland et al.[8]
selected microorganisms for their ability to release the sul-
fite group from endosulfan and to use this insecticide as
a source of sulfur for bacterial growth. Awasthi et al.[10]
isolated a bacterial co-culture using endosulfan as a sole
carbon source. To date, some physicochemical and biolog-
ical remedial strategies have been described by researchers
which lead to degradation of endosulfan into both toxic
and non-toxic metabolites.[8−22]
In this study we are reporting a bacterial strain SKL-1,
isolated using enrichment with endosulfan as sole sulfur
source. The organism identified as Pseudomonas aerugi-
nosa, is the most active endosulfan-degrading single strain
of microorganism, with minimal production of endosul-
fan sulfate, the toxic metabolite of endosulfan degradation.
 664
This strain will be further investigated for its endosulfan-
degrading potential in soil and for the enzymatic reactions
in detoxification of endosulfan.
Materials and methods
Pesticide standards
Endosulfan isomers and metabolites, viz., endosulfan sul-
fate (C9 H8 Cl4 S), endosulfan diol (C9 H8 Cl6 O), endosulfan
ether (C9 H6 ClO2 ) and endosulfan lactone (C9 H4 Cl6 O2 )
to be used as standards were purchased from Merck,
Germany.
Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009
Sample collection for enrichment studies
Samples of laterite, coastal sandy and red loam soils were
collected from Kerala (India) having a history of endosul-
fan application. Top 0–15 cm of soil was collected using
core samplers and covered with plastic bags to minimize
changes in physical parameters. The samples were stored at
4◦ C.
Enrichment of microbial communities
Soil (approximately 50 g) was first enriched for endosulfan-
degrading organisms by the addition of 5 mg of technical
grade endosulfan in 200 µL of acetone to remoistened soil,
followed by incubation in the dark at room temperature
for 1 month. Further enrichment was achieved by initiating
shake flask enrichment cultures from these samples by using
endosulfan as the only added source of sulfur.
The enrichment medium (pH 6.8) consisted of 0.225 g of
K2 HPO4 , 0.225 g of KH2 PO4, 0.225 g of NH4 Cl, 0.845 g of
(MgCl)2 .6H2 O, 0.005 g of CaCO3, 0.005 g of FeCl2 .4H2 O,
1.0 g of D-glucose and 1 mL of a trace element solu-
tion per liter. The stock trace element solution contained
198.0 mg of MnCl2 .4H2 O, 136.0 mg of ZnCl2, 171.0 mg
of CuCl2 .2H2 O, 24.0 mg of CoCl2 .6H2 O and 24.0 mg of
NiCl2 .6H2 O per liter.
Erlenmeyer flasks (50 mL) and nutrient culture media
were autoclaved separately for 20 min at 121◦ C. Fifty mi-
croliters of acetone containing 1.0 mg of technical-grade
endosulfan (99% pure) was aseptically added to each ster-
ilized flask in a laminar flow hood allowing the acetone
to evaporate. Nine milliliters of enrichment medium was
added to each flask.
Microbial inoculums for the enrichment studies were pre-
pared by shaking 20 g of the enriched soil sample overnight
in 100 mL of enrichment medium at 25◦ C and 160 rpm. The
solid particles were allowed to settle for one hour and 1 mL
of supernatant solution from the source flasks was used
to inoculate the spiked flasks. Uninoculated spiked flasks
were also set up as a control to compensate for any chemi-
cal degradation. The flasks were incubated at 28◦ C with or-
bital shaking (160 rpm) for two weeks (Round 1 enrichment
Kalyani et al.
culture). Thereafter, 0.1 mL of the enriched medium was
transferred into 10 mL of fresh sterile enrichment medium
containing 100 ppm endosulfan and further incubated for
two weeks (Round 2 enrichment culture).
Endosulfan degrading monocultures
To obtain pure cultures of single strains, 1 mL aliquots
of round 2 enrichment culture was centrifuged (8000 rpm,
10 min), the supernatant was removed and cell residues
were resuspended in 50 µL of sterile enrichment media
by vortexing. Aliquots of this suspension were plated on
enrichment medium agar by spread plating and incubated
under aerobic conditions at 28◦ C 7d. Isolates were further
purified by streaking on fresh plates. Intrinsic antibiotic
resistance pattern of the selected cultures was carried out
to avoid redundancy among the isolates.
Screening of isolates for endosulfan degradation in liquid
culture media
Four isolates of bacteria exhibiting luxury growth on the en-
richment medium were selected, and grown in nutrient cul-
ture broth containing 100 ppm endosulfan. Cultures were
incubated (28◦ C, 160 rpm) for one week and cells were har-
vested by centrifugation (5000 rpm, 20 min) and washed
thrice in 30 mL of nutrient culture media. Cells were there-
after resuspended in the same media. Endosulfan dissolved
in acetone was used to spike Erlenmeyer flasks as described
earlier to obtain a final concentration of 100 ppm endosul-
fan in the media. Two milliliters of inoculum was added to
each spiked flask except the control flasks after adjusting
their optical densities and incubated (28◦ C, 160 rpm) for
20 d. This study was performed in triplicates.
For studying degradation of endosulfan sulfate by SKL-
1, endosulfan sulfate dissolved in acetone was used to spike
Erlenmeyer flasks as described earlier to obtain a final con-
centration of 10 ppm endosulfan sulfate in the media.
Molecular identification of bacterial isolate
The bacterial isolate, tentatively designated SKL-1, was
identified by analysis of 16S rDNA. Amplification of 16S r
DNA was carried out by polymerase chain reaction using a
thermal cycler (M. J. Research PTC-100). The polymerase
chain reactions (PCR) were carried out with 50–90 ng of
pure genomic DNA. The forward (PA) and reverse primers
(PH) were custom synthesized from Bangalore Genei Pvt.
Ltd. The sequence of the oligonucleotide primers used for
amplification of 16S rDNA genes were:
PA: 5 CACGGATCCAGAGTTTGAT(C/T)(A/C)-
TGGCTCAG3
PH: 5 GTGCTGCAGGGTTACCTTGTTACGACT3
The primers PA and PH, located at the extreme 5 and

3 ends, respectively, of the ribosomal rDNA sequence, en-
able the amplification of the entire gene. Purity of the PCR
 Endosulfan-degrading microorganism
product was checked by agarose gel electrophoresis. Se-
quencing of the purified PCR product was carried out
at an automated fluorescent sequencing facility of Ban-
glore Genei Pvt. Ltd. DNA sequence similarity search was
done by computing at Basic Local Alignment Search Tool
(BLAST), developed by National Center for Biotechnol-
ogy Information (NCBI), US[23] for searching the DNA
and protein database.
Analytical procedures
For determination of endosulfan and endosulfan sulfate
concentration, 5 mL of broth sample kept for incubation
was centrifuged (10000 rpm; 10 min) and the supernatant
Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009
was mixed with 0.5 g of activated charcoal. The sample
was poured in a funnel containing 4 cm layer of anhydrous
sodium sulfate over a plug of cotton. The sample was eluted
with 100 mL of n-hexane:acetone (7:3) and the solvent was
evaporated to dryness and final volume was made with n-
hexane at the time of analysis. Appropriate dilutions of the
sample extract were then analyzed with a Hewlett Packard
5890, Series II gas chromatograph equipped with a methyl
silicon column (10 m × 0.53 mm × 2.65 µm film thickness)
packed with HP - 1 and electron capture detector (ECD)
63
Ni. The oven temperature was 200◦ C, injector tempera-
ture was 250◦ C and the detector temperature was 250◦ C.
Nitrogen was the carrier gas at a flow rate of 60 mL min−1 .
Bacterial densities in liquid cultures were determined
spectrophotometrically by measuring the absorbance at
600 nm. Aryl sulfatase activity was also measured
spectrophotometrically.[24]
Calculation of degradation
Percentage of biodegradation of endosulfan is the differ-
ence between the percentage of degradation of endosulfan
in the inoculated flasks and the uninoculated control.
Percentage of bioformation of endosulfan sulfate to total
formation of endosulfan sulfate was calculated according
to Equation 1.
BES = [(Ein − Eun ) × 100] /Ein (1)
Where,
BES = Percentage of bioformation of endosulfan sulfate to
total formation of endosulfan sulfate (%)
Ein = Endosulfan sulfate formation in inoculated flask
(ppm) and
Eun = Endosulfan sulfate formation in uninoculated flask
(ppm)
Progressive rate of degradation of endosulfan was calcu-
lated according to Equation 2.
K = dx/dy (2)
Where,
K = Progressive rate of degradation of endosulfan for nth
day (ppm/day)
665
dx = endosulfan degraded on nth day (ppm) – endosulfan
degraded on n-1th day (ppm) and
dy = 1 (day)
Results and discussion
Enrichment of endosulfan degrading microorganisms
from soil
The different colonies of bacteria isolated from the enrich-
ment media were numbered SKL-1 to 11. Intrinsic antibi-
otic resistance has been used extensively as a technique for
strain identification in soil bacteria and it has been reported
that the pattern of antibiotic resistance of each strain is a
stable property by which the strains could be recognized.[25]
Keeping this in mind, the colony morphology and intrinsic
antibiotic resistance pattern of the eleven different isolates
was studied and it was revealed that only four of them were
essentially unique and hence were used for further studies.
The method of enrichment relies on bacteria being able
to grow in the minimal media and hence the number of
culturable bacteria is severely restricted.
Screening microbial isolates for their ability to utilize
endosulfan for growth
Regression analysis of bacterial population (106 CFU/mL)
on OD600 revealed that it followed a linear kinetics, the
regression equation being y=34.204x with an R2 value of
0.9045 indicating perfect fit. Hence measurement of OD600
was performed to quantify the growth of the isolate in
broth.
The isolates were screened for their ability to utilize en-
dosulfan as the sole sulfur source. Endosulfan is a poor
biological energy source, as it contains only six potential
reducing electrons. But it has a relatively reactive cyclic sul-
fite diester group and can serve as a good sulfur source.[26]
This selection procedure enriches for a culture capable of
either the direct hydrolysis of endosulfan or the oxidation of
the insecticide followed by its hydrolysis, thereby reducing
formation of toxic endosulfan sulfate.[8]
SKL-1 was the only isolate able to grow utilizing endo-
sulfan as a sulfur source and hence was used for further
studies.
Endosulfan degradation by enriched culture
The gas chromatography (GC) Rt (retention times) for α
endosulfan and β endosulfan were 2.70 and 3.70 minutes,
respectively (Fig. 1). The total degradation of α endosul-
fan and β endosulfan was 94.40 and 96.38% , respectively
after 20 days of incubation (Figs. 2 and 3). Thus the to-
tal degradation of β endosulfan was more than that of
α endosulfan. This may be because of the fact that the
rate of non-biological degradation involving hydrolysis and
 666
Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009
Fig. 1. Separation of endosulfan and its metabolites by gas liquid
chromatography. (A) Uninoculated control – Day 0; (B) inocu-
lated with SKL-1– Day 0; (C) uninoculated control– Day 20; and
(D) inoculated with SKL-1 – day 20. 1 – solvent peak; 2 – endo-
sulfan diol; 3 – endosulfan ether; 4 – α endosulfan; 5 – endosulfan
lactone; 6 – β endosulfan; 7 – endosulfan sulfate.
photodecomposition is more for the β isomer and the differ-
ence is all the more prominent in alkaline conditions.[13,27,28]
Further, the recent discovery that the isomers form a eutec-
tic mixture indicates that application of a mixture is most
likely to enhance the volatilization of the β isomer.[29]
The biodegradation of α endosulfan and β endosulfan
by SKL- 1 was 71.78 and 69.77% , respectively after 20 days
of incubation (Figs. 2 and 3) indicating that biodegradation
of the α isomer is more than that of the β isomer. Earlier
studies have shown that microbial species prefer α endo-
sulfan for degradation over β endosulfan.[10,22] However,
Kalyani et al.
recently, Siddique et al.[18] reported that bacteria degraded
relatively more β endosulfan than α endosulfan.
The percentage of biodegradation to total degradation
was 76.04 and 72.39% for α and β isomers, respectively after
20 days of incubation. Thus biotransformation contributed
to a major portion of total transformation of both the iso-
mers in the present study. The predominance of biological
degradation over non-biological degradation or vice versa
depends on the culture conditions in addition to the effi-
ciency of the microbial culture. Endosulfan is susceptible
to alkaline hydrolysis, with approximately ten fold increase
in hydrolysis occurring with each increase in pH unit.[12]
Many previous studies have been unable to differentiate
between chemical and biological hydrolysis of endosulfan
because microbial growth has led to increases in the alkalin-
ity of the culture medium.[12,13] To minimize non-biological
hydrolysis, the enrichment medium was buffered to pH
6.8 and cultures were monitored constantly for change in
pH.
The progressive rate of degradation of endosulfan exhib-
ited a prominent increase by the 3rd day of incubation and
reached its peak value of 13 ppm/day. Afterwards, there
was a steady decrease in the progressive rate of degradation
(Fig. 4). The low initial rate of degradation might represent
a lag phase while it got accelerated as the incubation pro-
ceeded, most likely due to induction/activation of enzymes
in the inoculated cultures. Similar observations were made
by Hussain et al.[19] The steady decrease in rate of degra-
dation afterwards may be due to exhaustion of nutrients in
the media.
The metabolites formed during the degradation of endo-
sulfan were identified as endosulfan diol (Rt = 0.89 min),
endosulfan ether (Rt = 2.21 min) endosulfan lactone (Rt =
3.21 min) and endosulfan sulfate (Rt = 4.90 min) (Fig. 1).
Miles and Moy[13] and Katayama and Matsumura[20] have
confirmed the formation of these metabolites by microbial
isolates during biodegradation of endosulfan.
Endosulfan diol, endosulfan ether and endosulfan lac-
tone are nontoxic, where as endosulfan sulfate is toxic in
nature. Unlike the isomers of endosulfan, the toxic metabo-
lite endosulfan sulfate can accumulate in animal fat and
hence the formation of endosulfan sulfate was studied in
detail.[30] It was observed that by the 20th day 15.91% of the
applied endosulfan was transformed to endosulfan sulfate.
Of the total endosulfan degraded 16.74% was converted
to endosulfan sulfate. There was a steady decrease in the
percentage of bioformation of endosulfan sulfate to total
formation as period of incubation progressed. By the 20th
day of incubation, the percentage of bioformation of en-
dosulfan sulfate to total transformation was only 2.12%
(Table 1).
In order to clarify whether endosulfan sulfate was further
degraded by SKL-1, biodegradation of endosulfan sulfate
by SKL-1 was studied by spiking the medium with 10 ppm
endosulfan sulphate. Table 2 indicates that there was no fur-
ther degradation of endosulfan sulfate by SKL-1. Similar
 Endosulfan-degrading microorganism
Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009
Fig. 2. Progressive degradation of α endosulfan by SKL-1 in pure culture.
observations were also made by Sutherland et al.[8] and
Shivaramaiah and Kennedy[21] in their studies on biodegra-
dation of endosulfan by soil bacteria.
The inability to transport the more polar compound
into the cell or the absence of an enzyme capable of hy-
drolyzing the oxidized compound may be reasons for the
lack of biodegradation of endosulfan sulfate. The differ-
ent oxidation states of the sulfur in endosulfan and en-
dosulfate make it unlikely that the same enzyme will be
capable of releasing the sulfur containing moiety from
both.
Thus the decrease in the percentage of bioformation of
endosulfan sulfate to total formation of endosulfan sul-
fate during the course of incubation may be attributed to
the reduction in the rate of formation of endosulfan sul-
Fig. 3. Progressive degradation of β endosulfan by SKL-1 in pure culture.
667
fate by SKL-1 with time. This suggests that the metabolism
of endosulfan is mediated by two divergent pathways, one
hydrolytic leading to the production of endosulfan diol,
endosulfan ether and endosulfan lactone and the other ox-
idative leading to the production of the toxic metabolite,
endosulfan sulfate, which is resistant to further biodegra-
dation. Kullman and Matsumura[15] while working with
Phanerochaete chrysosporium suggested similar mechanism
of degradation of endosulfan.
Bacterial density, culture pH and aryl sulfatase activity
The bacterial density, culture pH and aryl sulfatase activity
were measured to assess the relationship between growth
 668 Kalyani et al.
Table 1. Progressive formation of endosulfan sulfate from endo- Table 2. Incubation of endosulfan sulfate with SKL-1 in vitro.
sulfan by SKL-1 in pure culture.
Endosulfan sulfate remaining
Endosulfan Percentage of in broth (ppm)
Endosulfan sulfate bioformation of
sulfate formed formed to endosulfan Days of Control Incubation with
Days of endosulfan to endosulfan sulfate to incubation (Media) SKL-1
incubation applied (%) degraded (%) total formation
0 10.00 10.00
0 0.00 0.00 0.00 1 9.98 9.98
1 0.23 4.41 11.02 2 9.97 9.97
2 1.04 8.84 7.38 3 9.95 9.96
3 2.18 5.15 5.28 4 9.91 9.92
4 3.83 8.11 3.26 5 9.92 9.91
5 7.02 13.55 1.92 6 9.90 9.91
6 7.08 12.29 2.04 7 9.87 9.88
Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009

7 7.57 11.81 1.91 8 9.88 9.89

8 7.83 11.16 2.13 9 9.87 9.87
9 8.59 11.57 2.24 10 9.88 9.86
10 8.88 11.58 2.17 11 9.87 9.85
11 10.29 13.05 1.87 12 9.84 9.85
12 10.69 13.26 1.89 13 9.85 9.84
13 11.49 13.84 2.04 14 9.82 9.83
14 11.78 13.73 1.99 15 9.81 9.83
15 12.39 13.98 2.10 16 9.82 9.83
16 13.00 14.45 2.02 17 9.80 9.82
17 13.67 14.98 2.20 18 9.78 9.80
18 14.63 15.71 2.08 19 9.79 9.81
19 15.16 16.11 2.03 20 9.79 9.80
20 15.91 16.74 2.12 CV (%) 4.78
CV (%) 4.20 4.59 4.38 Days Treatment
SEm± 0.76 2.16 2.24 SEm± 0.03 0.01
CD (P = 0.05) 1.49 4.23 4.39 CD (P=0.05) 0.06 0.02

Fig. 4. Change in optical density (OD600 ) of medium inoculated with SKL-1 during endosulfan degradation.
 Endosulfan-degrading microorganism 669
Table 3. Correlation coefficients between transformation of en- dation of endosulfan by SKL-1 resulted in an increase
dosulfan and OD600 , pH and aryl sulfatase activity in vitro. in the pH of the culture medium. Though this observa-
tion is in conformity with the observations of Miles and
At Ab Bt Bb St Sb
Moy[13] and Martens,[12] it is contradictory to the observa-
OD 0.061 0.332∗∗ 0.068 0.468∗∗ −0.041 −0.164 tions of Hussain et al.[19] and Siddique et al.[18] In either
pH 0.205∗ 0.284∗∗ 0.201∗ 0.371∗∗ −0.355∗∗ 0.007 case the change in pH depends on the products of degra-
∗∗
As −0.140 0.310 −0.135 0.422∗∗ −0.131 −0.065 dation. The increase in pH in the present study due to
biological activity of SKL-1 could have further acceler-
At = Progressive rate of degradation of α endosulfan (total) (%).
Ab = Progressive rate of degradation of α endosulfan (biological) (%). ated the alkaline hydrolysis of endosulfan, especially the β
Bt = Progressive rate of degradation of β endosulfan (total) (%). isomer.[27]
Bb = Progressive rate of degradation of β endosulfan (biological) (%). Interestingly, pH change exhibited highly significant neg-
St = Progressive rate of formation of endosulfan sulfate (total) (%). ative correlation with total formation of endosulfan sulfate
Sb = Progressive rate of formation of endosulfan sulfate (biological) (Table 3). This may be due to the fact that under alka-
(%).
OD = Optical density of growth (600nm). line conditions hydrolysis of endosulfan is predominant
Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009

pH = pH of the broth.
As = Aryl sulfatase activity of the broth (µg/mL/hr).
∗
Significant at 5% level.
∗∗
Significant at 1% level.
and metabolic activities of the organism and its capability
to degrade endosulfan.
The growth of SKL-1 quantified by OD600 followed the
progressive rate of degradation of endosulfan (Fig. 4). The
OD600 reached 2.34 as progressive rate of α and β endo-
sulfan reached its peak. Growth of SKL-1 exhibited highly
significant positive correlation with biodegradation of α
endosulfan and β endosulfan (Table 3) indicating that the
microorganism utilizes endosulfan for its growth. OD600
had no significant correlation with formation of endosulfan
sulfate suggesting the limited role of the microbial isolate
in the formation of endosulfan sulfate.
Change in pH exhibited significant positive correlation
with total degradation and biodegradation of both α and β
endosulfan (Fig. 5 and Table 3). The growth and biodegra-
over its oxidation and hence formation of endosulfan sul-
fate, the product of oxidative degradation of endosulfan is
minimized.
The aryl sulfatase activity of the broth followed the pro-
gressive rate of degradation of endosulfan closely (Fig. 6).
Aryl sulfatase activity exhibited highly significant positive
correlation with biodegradation of α endosulfan and β en-
dosulfan (Table 3). Aryl sulfatase activity reached 23. 93
µg pNP/mL/hr as progressive rate of α and β endosulfan
reached its peak. Further, aryl sulfatase activity did not ex-
hibit any significant correlation with endosulfan sulfate for-
mation. Aryl sulfatase enzyme catalyzes the removal of sul-
fur moiety from organic sulfur compounds.[24] Katayama
and Matsumura[20] studying biodegrdation of endosulfan
by Trichoderma harzianum had suggested that endosulfan
sulfate was further converted to endosulfan diol by hy-
drolysis in presence of sulfatase enzyme. However, since in
our study endosulfan sulfate was not degraded further by
SKL-1, aryl sulfatase enzyme may be involved in the direct
hydrolysis of endosulfan to endosulfan diol.

Fig. 5. Change in pH of medium inoculated with SKL-1 during endosulfan degradation.

 670
Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009
Fig. 6. Change in aryl sulfatase activity of medium inoculated with SKL-1 during endosulfan degradation.
Phylogenetic identity of bacterial strain SKL-1
The 16S rDNA gene of the microbial isolate was amplified
and sequenced. Homology search in the BLAST server
developed by NCBI, USA revealed that the organism ex-
hibited 99% homology with many of the Pseudomonas
Fig. 7. Phylogenetic tree of Pseudomonas aeruginosa SKL-1.
Kalyani et al.
aeruginosa strains (Fig. 7). The sequence was submitted
in Genbank and the accession number was allotted as
EF443060.
Earlier reports of degradation of endosulfan involved
mixed bacterial cultures, bacterial co-cultures, As-
pergillus niger, Phanerochaete chrysosporium, Mucor
 Endosulfan-degrading microorganism
thermohyalospora, Anabaena spp. and Fusarium
ventricosum.[8,10,14−18] Recently, Hussain et al.[19] reported
that Pseudomonas spinosa, P. aeruginosa and Burkholderia
cepacia degraded endosulfan efficiently. The bacteria
belonging to Pseudomonas sp. are gram negative soil
bacteria and have been previously documented as excellent
degraders of a wide range of xenobiotics and recalcitrant
compounds both in soil and water environment.[31,32]
Conclusion
We have successfully enriched and isolated endosulfan de-
grading bacterial strain Pseudomonas aeruginosa SKL-1
that can utilize endosulfan as sole sulfur source in broth cul-
Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009
ture. After approximately 100 rounds of subculturing, the
culture metabolizes 100 ppm endosulfan to undetectable
levels in less than 30 days. This rate of degradation is signif-
icantly higher than those previously measured for bacteria,
considering the fact that non-biological degradation has
been minimized. Further, it was also observed that there is
a significant correlation between endosulfan degradation
and aryl sulfatase activity suggesting the possible involve-
ment of this enzyme in the degradation of endosulfan by
this organism.
The results have valuable applications for endosulfan
bioremediation in polluted sites. From this study, we can-
not predict the efficiency of the microbial isolate to utilize
endosulfan as a sulfur source in the soil environment. The
majority of the sulfur content of soils is found in an or-
ganic form, with over 95% present as sulfonates and sulfate
esters. Soil bacteria have numerous enzymes capable of re-
leasing sulfur from organic compounds. The ability of the
microbial isolate to degrade endosulfan in natural soil con-
ditions, where other sulfur sources are also present needs to
be investigated. The use of microorganisms for bioremedia-
tion requires an understanding of all the physiological and
biochemical aspects involved in chemical transformations.
Future research will focus on identification and isolation
of the enzymes involved, including a study of their regu-
lation and optimization of conditions. Modern molecular
approaches developed for remediation would be suitably
applied to achieve these objectives.
Acknowledgements
The first author gratefully acknowledges the University
Grants Commission for providing fellowship during the
tenure of the research work at the Indian Agricultural Re-
search Institute.
References
[1] United States Department of Health and Human Services. Toxi-
cological Profile for Endosulfan; Agency for Toxic Substances and
Disease Registry: Atlanta, GA, 1990.
671
[2] Rao, D. M.R.; Murty, A. S. Persistence of endosulfan in soils. J.
Agric. Food Chem. 1980, 28, 1099–1101.
[3] Guerin, T. F.; Kennedy, I. R. Distribution and dissipation of endo-
sulfan and related cyclodienes in sterile aqueous systems: implica-
tions for studies on biodegradation. J. Agric. Food Chem. 1992, 40,
2315–2323.
[4] Sunderam, R.I.M.; Cheng, D.M.H.; Thompson, G.B. Toxicity of
endosulfan to native and introduced fish in Australia. Environ. Tox-
icol. Chem. 1992, 11, 1469–1476.
[5] Paul, V.; Balasubramaniam, E. Effect of single and repeated ad-
ministration of endosulfan on behaviour and its interaction with
centrally acting drugs in experimental animals: A mini review. En-
viron. Toxicol. Pharmacol. 1997, 3, 151–157.
[6] Sinha, N.; Narayan, R.; Saxena, D.K. Effect of endosulfan on testis
of growing rats. Bull. Environ. Contam. Toxicol. 1997, 58, 79–86.
[7] Chaudhuri, K.; Selvaraj, S.; Pal, A.K. Studies on the genotoxicology
of endosulfan in bacterial system. Mutat. Res. 1999, 439, 63–67.
[8] Sutherland, T.D.; Horne, I.; Lacey, M.J.; Harcourt, R.L.; Russel,
R.J.; Oakeshott, J.G. Enrichment of an endosulfan-degrading mixed
bacterial culture. Appl. Environ. Microbiol. 2000, 66, 2822–2828.
[9] Guerin, T.F. The anaerobic degradation of endosulfan by indige-
nous microorganisms from low-oxygen soils and sediments. Envi-
ron. Pollut. 1999, 106, 13–21.
[10] Awasthi, N.; Manickam, N.; Kumar, A. Biodegradation of endosul-
fan by a bacterial coculture. Bull. Environ. Contam. Toxicol. 1997,
59, 928–934.
[11] Knoevenagel, K.; Himmelreich, R. Degradation of compounds con-
taining carbon atoms by photo-oxidation in the presence of water.
Arch. Environ. Contam. Toxicol. 1976, 4, 324–333.
[12] Martens, R. Degradation of endosulfan-8, 9-Carbon-14 in soil un-
der different conditions. Bull. Environ. Contam. Toxicol. 1977, 17,
438–446.
[13] Miles, J. R.W.; Moy, P. Degradation of endosulfan and its metabo-
lites by a mixed culture of soil microorganisms. Bull. Environ. Con-
tam. Toxicol. 1979, 23, 13–19.
[14] Mukherjee, I.; Gopal, M. Degradation of beta-endosulfan by As-
pergillus niger. Toxicol. Environ. Chem. 1994, 46, 217–221.
[15] Kullman, S.W.; Matsumura, F. Metabolic pathways utilized by
Phanerochaete chrysosporium for degradation of the cyclodiene
pesticide endosulfan. Appl. Environ. Microbiol. 1996, 62, 593–
600.
[16] Shetty, P.K.; Mitra, J.; Murthy, N.B.K.; Namitha, K.K.; Savitha,
K.N.; Raghu, K. Biodegradation of cyclodiene insecticide endosul-
fan by Mucor thermo-hyalospora MTCC 1384. Curr. Sci. 2000, 79,
1381–1383.
[17] Lee, S.E.; Kim, J.S.; Kennedy, I.R.; Park, J.W.; Kwon, G.S.; Koh,
S.C.; Kim, J.E. Biotransformation of an organochlorine insecticide,
endosulfan, by Anabaena species. J. Agric. Food Chem. 2003, 51(5),
1336–40.
[18] Siddique, T.; Okeke, B.C.; Arshad, M.; Frankenberger, W.T. Jr. En-
richment and isolation of endosulfan degrading microorganisms. J
Environ Qual. 2003, 32, 47–54.
[19] Hussain, S.; Arshad, M.; Saleem, M.; Khalid, A. Biodegradation of
α - and β -endosulfan by soil bacteria. Biodegradation 2007, 18(6),
731–740.
[20] Katayama, A.; Matsumura, F. Degradation of organochlorine pes-
ticides particularly endosulfan by Trichoderma harzianum. Environ.
Toxicol. Chem. 1993, 12, 1059–1065.
[21] Shivaramaiah, H. M.; Kennedy, I. R. Biodegradation of endosulfan
by a soil bacterium. J. Environ. Sci. Health Part B. 2006, 41, 895–
905.
[22] Kwon, G.S.; Kim, J.E.; Kim, T.K.; Sohn, H.Y.; Koh, S.C.; Shin, K.S.;
Kim, D.G. Klebsiella pneumoniae KE-1 degrades endosulfan with-
out formation of the toxic metabolite, endosulfan sulfate. FEMS
Microbiol. Lett. 2002, 215, 255–259.
[23] Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic
local alignment search tool. J. Mol. Biol. 1990, 215, 403–410.
 672
[24] Tabatabhai, M.A.; Bremner, J.M. Aryl sulfatase activity of soils.
Soil. Sci. Soc. Am. Proc. 1970, 34, 427–429.
[25] Josey, D.P.; Beynon, J. L.; Johnston, A.W.B.; Beringer, J.E. Strain
identification in Rhizobium using intrinsic antibiotic resistance. J.
Appl. Microbiol. 2008, 46(2), 343–350.
[26] Van Woerden, H.F. Organic sulfites. Chem. Rev. 1963, 63, 557–571.
[27] Walse, S.S.; Scott, G.I.; Ferry, J.L. Stereo selective degradation of
aqueous endosulfan in modular estuarine mesocosms. J. Environ.
Monit. 2003, 5, 373–379.
[28] Singh, N.C.; Dasgupta, T.P.; Roberts, E.V.; Mansingh, A. Dynamics
of pesticides in tropical conditions. 1. Kinetic studies of volatiliza-
tion, hydrolysis and photolysis of dieldrin and alpha and beta-
endosulfan. J. Agric. Food Chem. 1991, 39, 575–579.
[29] Schmidt, W.F.; Bilboulian, S.; Rice, C.P.; Fettinger, J.C.; McConnell,
L.L.; Hapeman, C. J. Thermodynamic, spectroscopic and computa-
Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009
Kalyani et al.
tional evidence for the irreversible conversion of β- to α-endosulfan.
J Agric Food Chem. 2001, 49, 5372–5376.
[30] Dorough, H.W.; Huhtanen, K.; Marshall, T.C.; Bryant, H.E.
Fate of endosulfan in rats and toxicological considerations
of apolar metabolites. Pest. Biochem. Physiol. 1978, 8, 241–
252.
[31] Radehaus, P.M.; Schmidt, S.K. Characterization of a novel
Pseudomonas sp. that mineralizes high concentrations of pen-
tachlorophenol. Appl. Environ. Microbiol. 1992, 58, 2879–
2885.
[32] Filonov, A.E.; Puntus, I.F.; Karpov, A.V.; Kosheleva, I.A.; Akhme-
tov, L.I.; Yonge, D.R.; Petersen, J.N.; Boronin, A.M. Assessment
of naphthalene biodegradation efficiency of Pseudomonas and
Burkholderia strains tested in soil model systems. J. Chem. Tech-
nol. Biotechnol. 2006, 81, 216–224.