A Comparison of Growth and Gene Expression in Two Species of Oysters

Katie Fulkerson

Capstone Project, Autumn Quarter (2007)-Spring Quarter (2008), University of

Washington, Seattle, WA

Received June 13, 2008

Abstract
The Pacific oyster, Crassostrea gigas, is the most valuable commercial species
in Puget Sound, in the state of Washington. While of less commercial value, the
Olympia oyster, Ostrea conchaphila, still holds significant importance in being
native to Washington State. To better understand the differences in these two
species as it is relates to growth, this study 1) compared growth rates in both species
grown at the same site, 2) identified genes likely involved in growth in C. gigas and
O. conchaphila, and 3) characterized gene expression patterns from tissues extracted
during two periods of juvenile oyster development. Oysters were purchased as seed
and grown in Agate Pass in Kitsap County. Growth measurements were taken once
a month beginning in August 2007 and ending in December 2007. Tissue samples of
the mantle, muscle, and gills were taken during the months of September and
November for gene expression analysis. Bioinformatic techniques were used to
identify growth-related genes in C. gigas and O. conchaphila by mining expressed
sequence tags (ESTs). Growth rates were significantly higher in C. gigas compared
to O. conchaphila over the course of the experiment. Several genes putatively
involved in growth were identified and quantified, including the Molluscan growth
differential factor (mGDF), Kazal-type serine peptidase inhibitor domain 1 (KSPI),
Protein kinase C inhibitor protein 1 (PKCIP), and Cytochrome P450 17-
hydroxylase/lyase (P450). Additionally, a fifth gene was studied, Insulin-induced
gene 2 protein (INSIG2), which was not detected in either species. The differential
expression patterns observed, based on quantitative PCR analysis, suggest some of
these genes are involved in controlling growth in oysters. Obtaining a better
understanding of the mechanisms involved in growth will provide further
knowledge of the biology of oysters and has the potential to assist the aquaculture
industry in selecting broodstock.

Key Words: Molluscan growth differential factor, Kazal-type serine peptidase

inhibitor domain 1, Protein kinase C inhibitor 1, Insulin-induced gene 2 protein,
Cytochrome p450, gene expression
Introduction
Oysters have been harvested and consumed throughout the world for scores of
generations. Having gradually been integrated into traditional aquaculture, oysters have
been cultivated for over 1,000 years in Japan (Patrick et al. 2006). Oyster trade was
instigated in 1608 following the exploration by Samuel de Champlain in North America.
This led to the depletion of natural stocks through overexploitation and then by habitat
degradation and pollution as North America became colonized. Oyster culture was turned
to in the mid 19th century as the solution to saving natural stocks while at the same time
meeting the increasing consumer demand for oysters. On the Atlantic coast, the native
oyster Crassostrea virginica enjoyed success in the aquaculture business. Unfortunately,
Ostrea conchaphila, the oyster native to the Pacific coast, did not respond well to
aquaculture. Presently, there are five species of oysters cultivated along the Pacific Coast
of the United States: the native oyster Ostrea conchaphila, the Atlantic oyster
Crassostrea virginica, the Kumamoto oyster Crassostrea sikamea, the European flat
oyster Ostrea edulis, and the Pacific oyster Crassostrea gigas. In 2003, oyster production
equaled approximately 4.5 million kg of meat, about 95% of the total oysters yielded on
the Pacific Coast with 61% of the landed value coming from Washington State (Lavoie).
Crassostrea gigas, which comprised the bulk of the harvest, has since established itself as
the most dominant species in the Pacific Northwest (Lavoie).
The ability of oysters to reach market size in a timely manner is of great concern
to aquaculturists. Growth is a complex process as it is dependent on genetics as well as
multiple environmental factors such as water temperature, food availability, placement in
the water column, and density of the bed. The role of genetics in growth has been
confirmed through successive successful selective breeding for increased growth (Kittel,
1999). Kittel (1999) documented a heritability estimate of 0.54 for whole weight in
C. gigas. While genetic factors determine the rate and ultimate size of an individual, food
and temperature are viewed as the primary influences of growth. Temperature regulates
growth through physiological rates concerning metabolism and consumption as well as
playing a role in the abundance and size of the available prey (Johnson et al. 2001).
Laboratory studies have shown a positive correlation between metabolic rate and
temperature and, as a result, seasonal variations in metabolic activity are often considered
a function of temperature. Newer experimental designs show that food availability may,
in fact, be more important than temperature. In one study by (Brockington and Clarke,
2001) on the urchin, Sterechinus neumayeri, only 15-20% of the summer increase in
metabolism was found to be caused directly by the rise in temperature, while 80-85% was
caused by the increase in physical activity associated with feeding, growth, and spawning
(Brockington and Clarke, 2001). In this case, the extra oxygen consumption induced by
feeding includes the handling costs of food and metabolic costs of growth. Together these
two elements comprise the heat increment of feeding, or specific dynamic action (SDA)
(Brockington and Clarke, 2001).
Sediment type and seston concentration are also known to affect growth of
bivalve species by impeding filtration and the digestive process (Cardoso et al, 2007).
Cardoso et al (2007) also notes field studies have observed competition for food
occurring in dense intertidal beds of C. gigas. Intense competition does not allow the
oyster to achieve optimum foraging rates, resulting in slower growth due to low food
availability (Villarroel et al. 2004). Villarroel et al. (2004) cites slow growth rates of the
Crassostrea rhizophorae as being due to low food availability, mainly of phytoplankton
biomass (Villarroel et al. 2004). Furthermore, additional growth has been known to occur
in other bivalve species, such as Macoma blathica and Cerastoderma, at the lowest tidal
zone where submersion time and daily feeding periods are longer (Cardoso et al, 2007).
The scarcity or even total absence of food during shorter or longer periods of time
is a characteristic of marine ecosystems that affects the physiology of the animals that
inhabit them (Malanga et al. 2007). Food resources for most animals are abundant during
spring and summer and lacking during winter months (Malanga et al. 2007). This
nutritional deprivation is a natural part of the life cycle of many aquatic organisms. It
results in behavioral modifications known as winter torpor which reduces metabolic rates
so as not to deplete the reserves of protein, glycogen, and lipids too rapidly (Vinagre et
al. 2007). By slowing metabolic rates, the animal is able to maintain body mass per shell
length during winter (Malanga et al. 2007). The decrease in metabolic rate is known as
standard metabolism (Alberntosa et al. 2007). Disease and parasitism can also reduce
growth rate potential by increasing energetic costs (Johnson et al. 2001). Understanding
the metabolic processes and the response of the organism to the total absence of food
reveals a greater wealth of information as to the ecology of a species (Alberntosa et al.
2007).
A concept known as scope of growth (SFG) is used as a summation of energy
acquisition and expenditure in bivalves (Kesarcodi-Watson et al, 2001). An energy
budget equation is defined as the sum of energy from the food ingested divided into
metabolizable, egested, and excreted energy. The amount of energy will vary according
to the effects of extrinsic (fluctuations in the biotic and abiotic conditions within the
water column) and intrinsic (body size, reproductive stage) factors. Animal production or
growth is represented by the difference between the absorbed energy and the energy lost
in respiration and excretion, taking age, sex and body type into account. Nutritional
deficiencies will also affect production, and a satisfactory diet is needed to obtain optimal
production. Feed composition and ingestion are the most important factors to consider in
a balanced growth equation. Additionally, metabolic rate is a major component of the
equation. It is considered a loss term that provides a measure of the energetic cost to the
system of supporting the animal (Farias et al. 2003). SFG represents the total available
energy for reproduction, somatic tissue growth, and shell production. An organism can
only allocate net positive energy to SFG. Positive energy is obtained when the total
energy absorbed is greater than total metabolic losses (Kesarcodi-Watson et al, 2001).

1. SFG = AE – (RE+EE)
SFG = scope for growth
AE = absorbed food energy
RE = energy lost in respiration
EE = energy lost as excretion

Temperature and food availability also influence the annual cycle of accumulation
and use of energy reserves associated with gametogenesis in bivalves. The simplest
model consists of the buildup of energy during periods of prey abundance and releasing
the energy in the form of genetic material during the spawning process (Alberntosa et al.
2007).
 The mantle surface is responsible for shell deposition (Pauly et al, 1988). The
growth of soft body parts and the shell of oysters is a continuous process. Soft body
growth occurs mainly in spring (Gricourt et al. 2003) with shell growth occurring
primarily in the summer due to the higher water temperatures which result in an increased
food supply (Gricourt et al. 2003; Pauly et al. 1988). The increase of calcium in the diet is
used for increasing the shell size (Pauly et al. 1988). The shell consists of three layers: the
outermost layer (periostracum), the outer calcareous (prismatic) layer, and the inner
calcareous (cross-lamellar) layer. Mantle edge cells are specifically involved in the
formation of the periostracum. They allow for the synthesis and secretion of
proteinaceous components as well as cellular calcium transport to the extrapallial space
(Gricourt et al. 2003).
In Washington State, the size of C. gigas following two years of growth is
correlated with the month the oyster was planted as well as the size of the oyster at
planting (Pauly et al, 1988). C. gigas reared from seed average a length of 4 to 5cm
during their first year of growth. Growth in C. gigas tends to be more rapid when they are
young and typically decreases when they reach 4 to 5 years of age (Pauly et al, 1988). In
contrast, O. conchaphila experiences a much slower growth rate, taking 4 to 5 years to
reach market size of approximately 50mm. In Washington State, it takes O. conchaphila
an average of 3 to 4 years to reach shell heights of 35 to 45mm, with little growth
occurring afterward (Gillespie, 1999).
While there is general information on growth in both species, limited information
is available on the internal mechanisms which regulate the growth process. It is generally
thought that growth and related metabolisms in mollusks are controlled by the nervous
ganglia. It is known that mollusks, in general, possess insulin-related peptides and, more
specifically, insulin-like growth factor (IGF) (Gricourt et al, 2003). In mammals, insulin
is an important regulator of numerous physiological processes such as glucose uptake and
cellular growth and division (Hamano et al. 2005). A study by Gricourt et al (2003)
observed the occurrence/amount of IGF-1 in the mantle of C. gigas during periods of
elevated shell growth. In particular, this study ascertained that insulin-like peptides may
participate in the control of growth in mollusks by stimulating protein synthesis in the
edge of the mantle cells and, through the mantle, influence shell growth. Gricourt et al
(2003) also observed IGF in other tissues such as the labial palps and gonad. In
gastropods, the cauterization of the light green cells (LGCs) in juvenile snails resulted in
the retardation of body and shell growth as well as a reduction in food consumption and
changes in carbohydrate metabolism in various tissues (Hamano et al. 2005). Insulin-
related peptides also appear to be involved in the reproductive process of mollusks
(Gricourt et al. 2006).
From a broader perspective, it is likely that the genes involved in general
metabolism are also involved in realized growth. Expression of those genes is likely to
change in relation to the developmental stage, water temperature, feeding, and placement.
It is known that the bivalve digestive gland has a substantial amount of alpha-amylase, an
enzyme used to break down starch into glucose molecules (Pennec and Pennec, 2002).
While the enzyme is scarce during the winter, its mRNA transcripts are abundant from
the beginning of the phytoplankton bloom in March until September. It has been
suggested that there may be a relationship between the presence of the enzyme and the
phytoplankton bloom. Studies have shown a positive correlation with food inputs and
amylase activity in bivalves (Pennec and Pennec, 2002). Additionally, the presence of
aldolase, which breaks down into glycerol-3-phosphate and dihydroxyacetone during
digestion, may indicate a need for the direction of energy for metabolic purposes within
the shell (Pennec and Pennec, 2002).
The intent of this study is to gain a better understanding of growth rates and
internal growth mechanisms in O. conchaphila and C. gigas. The specific objectives
include 1) comparing the growth rates of C. gigas and O. conchaphila in the same
environment, 2) identifying 1-5 genes involved in the growth of these two species, and
3) to compare the gene expression patterns from C. gigas and O. conchaphila tissues
extracted during two periods of development. It was expected that the growth rates of the
two species would differ but that the internal mechanisms regulating growth would be
similar. Further insight of the mechanisms surrounding growth in oysters will
be beneficial to aquaculturists in determining the length of time it will take oysters to
reach market size as well as improving the hatchery production of these economically
important animals. Additionally, it can aid shellfish managers in setting sustainable
harvest rates so as not to overexploit the larger oysters which provide a greater
contribution to recruitment.

Methods

Objective 1: Growth Rates

Single C. gigas was grown in six purse bags with 130 oysters per purse. Single
O. conchaphila were grown in six purse bags with 125 oysters per purse. The number of
oysters per purse bag was determined via purchase packages and grower
recommendation. Purses were attached to stakes at the 0.05 high tide mark at Agate Pass
in Kitsap County. Measurements were taken at the beginning of August before placement
on beach. A random sample of 30 oysters of each species was measured in millimeters,
once a month, lengthwise from the umbo to the edge, from August to December 2007.
The sample size was established via a statistical analysis based on determining the
minimum significant sample size and an additional five individuals to strengthen results.
Weather and precipitation data were5 collected from the Weather Underground station
KWAKINGS1 located in Chris Lane, Kingston, WA. Ocean temperatures were collected
from NOAA station ID: 9447130.

Objective 2: Identifying genes regulating growth

At the end of the first month’s growth period on the beach (August) and at the end
of November 2007, ten oysters of each species were collected for tissue samples.
Extracted tissues included the mantle, gills, and muscle as well as a conglomeration of
tissues from O. conchaphila. Tissues were placed in small, capped tubes, kept on ice and
placed in a freezer at -80°C.

Bioinformatic techniques were used to identify genes related to growth

in Crassostrea through the expressed sequence tags (ESTs). Specifically, genes known to
be associated with growth in other taxa were compared to unannotated oyster
sequences. Due to the limited sequences for Ostrea, at this time, degenerative primer-
based PCR was performed in order to find the homologs (or similar genes) in Ostrea
samples. In addition, one previously described gene (mGDF) was examined as it was
known to be involved in molluscan growth.

RNA was extracted from all samples using 1000ul Tri-Reagent (Molecular
Research Center). Samples were homogenized in Tri-Reagent, and 200ul of Chloroform
was added. After a thorough mixing samples were centrifuged at 4°C for 15 min at
11,500rpm. The aqueous phase was removed and 500ul of Iso-2-propanol was added, to
precipitate the RNA, and centrifuged again. The supernatant was removed and 1000ul of
75% EtOH in DEPC water was added and centrifuged for a third time. The EtOH was
removed and the RNA pellet isolated. 50ul of DNASE free water was added before
incubating the samples at 55°C for 10 min. Total RNA was quantified using
NANODROP 1000. Samples were kept at -80°C.

CDNA was made from reverse transcribing the Total RNA which was extracted
from the tissue samples. cDNA reactions were carried out in 20ul reactions containing
4ul AMV RT buffer (Promega), 8ul dNTPs(2.5uM), 1ul oligo dt primer (Promega), 1ul
AMV transcriptase (Promega), 1ul RNase free water, 5ul total RNA previously extracted.
CDNA was PCRed and observed on 3% gels. PCR reactions were carried out in
25ul reactions containing 10.5ul water, 12.5ul 2x goTaq (Promega), 1ul cDNA, 0.5ul
forward primer, and 0.5ul reverse primer (Table 1). The PCR was used to amplify the
following five genes: mGDF, KSPI, KPCIP, INSIG-2, and P450. Amplification of
C. gigas genes began at 95°C for the initial five minute denaturing, followed by 40 cycles
of 95°C for 60 sec, 55°C for 60 sec, 72°C for 60 sec, and a final extension step at 70°C
for 10 min. Amplification of O. conchaphila genes began at 95°C for the initial 5 min
denaturing, followed by 40 cycles of 95°C for 60 sec, 50°C for 60 sec, 72°C for 60 sec,
and a final extension step at 70°C for 10 min. The temperature was lowered for
O. conchaphila to lessen the specificity of the primers and increase the likelihood of
getting a match.
Table 1: Primer sequences used for identifying genes likely involved in the growth of
C. gigas and O. conchaphila grown in Agate Pass, Kitsap County, WA in 2007.
Gene Primer sequences Expected Actual
Product Product
length Length
mGDF Forward: 388 ≈ 388
AAAGCCGTGGGTTGGAACGATT
Reverse:
TTCCGAACACACACCTGGAACA
KSPI Forward: 250 ≈ 250
ACGCGCGACAGGTGTAAATGTT
Reverse:
TCACTTTGAGGTCACGCCCTTT
KPCIP Forward: 599 ≈ 599
ATCATGGGCGACAGGGAAGAAT
Reverse:
TTGGCTAACTCGCAAGCAGTGT
INSIG- Forward: 536 ≈ 536
2 TCGGCAACTTCTTTGCCGTGTT
Reverse:
TGCGAGCTGTCTTCCGATGTTT
P450 Forward: 585 ≈ 585
AATTTCAAGTGGCCCGTGTGGT
Reverse:
ATGCCATGCGCAGAGTCTCTTT

Objective 3: Gene Expression

Quantitative RT-PCR was used to measure gene expression levels in the oysters
collected from the field in August and November 2007. Real Time reactions were carried
out in 25ul reactions containing 1ul cDNA, 0.1ul forward primer (10uM), .1ul reverse
primer (uM), and either 12.5u 2x Brilliant II SYBER GREEN QPCR Master Mix
(STRATAGENE) or 12.5ul 2x Immomix (Bioline) and 1ul Syto 13 (Invitrogen) from a
50ul stock (Table 2).

Table 2: Quantitative RT-PCR reactions carried out to measure gene expression levels in
C. gigas and O. conchaphila.
Tissues Sampled
Species mGDF KSPI PKCIP INSIG-2 P450
Pacific mantle mantle mantle x Gill
Olympia muscle muscle muscle x x
Results

Objective 1: Growth Rates

C. gigas displayed a growth rate superior to that of O. conchaphila (Figure 1).
The growth of this species increased steadily by approximately 10mm a month until
leveling off between November and December. On average, these oysters grew about
30mm over this four-month time span. O. conchaphila did not show such high increases
in growth. This species, on average, only grew approximately 10mm over the four-month
period with the majority of growth occurring between August and September. The
maximum length reached by C. gigas during the time period of this study was 84mm,
while that of O. conchaphila was 56mm.

Figure 1: C. gigas and

O. conchaphila growth
rates in millimeters for
August, September,
November and December
2007, in Agate Pass,
Kitsap County, WA.

Average air temperatures during August and September remained in the range of
60°F (Figure 2). The temperature dropped into the 40s during October and leveled off
through December. High temperatures remained in the high 70s between August and
October while low temperatures dropped to 0°C with the exception of September when
the low temperature jumped to 40°F. Precipitation averaged 50mm a month from August
to November (Figure 3). Average precipitation increased to 290.1mm in December. The
ocean surface temperature in August averaged 55.26°C and decreased steadily to an
average of 49°C in December (Figure 4).
 100

80 Figure 2: Average, high,

ave temp
60
high temp and low temperatures for
40

20
low temp
August, September,
0 November and December
Aug Sept Oct
Months
Nov Dec
2007, in Agate Pass,
Kitsap County, WA.

350
300
250
Figure 3: Precipitation for
200 August, September,
precip mm
150
100
November and December
50 2007, in Agate Pass,
0
Aug Sept Oct Nov Dec
Kitsap County, WA.
Month

56
55
54
53 Figure 4: Ocean
52
51
50
temperatures for August,
49
48
47
September, November
46
45 and December 2007, in
Aug Sept Oct
Months
Nov Dec
Agate Pass, Kitsap
County, WA.

Objective 2: Gene Identification

mGDF, with a product size of 388 base pairs, was detected in all tissue samples
(mantle, gill, and muscle) from C. gigas (Figure 5). KSPI and KPCIP were also detected
in the same tissue samples with bands showing a product size of approximately 250 base
pairs for KSPI and approximately 599 for KPCIP. mGDF was detected in the muscle
tissue of O. conchaphila with a product size of approximately 388 base pairs (Figure 6).
KSPI was detected in all the tissue samples of O. conchaphila with a product size of
approximately 250 base pairs, while KPCIP was detected in the gill and muscles with
 product sizes of approximately 599 base pairs. INSIG-2, with a product size of 536 base
pairs, was not detected in either species. P450 was not detected in O. conchaphila, but it
was detected in the gill and muscle tissue of C. gigas with a product size of 585 base
pairs.

L ma g m ma g m ma g m

mGDF KSPI PKCIP

L w ma g m ma g m b w ma g m ma g m

Sept Nov Sept Nov

INSIG P450

Figure 5: PCR of genes possibly involved in growth in C. gigas. Tissue samples include
the mantle (ma), gill (g), and muscle (m). Red labels indicate the detection of the gene.
 L w ma g m ma g m w ma g m ma g m w ma g m ma g m w ma g m ma g m w ma g

Sept Nov Sept Nov Sept Nov Sept Nov Sept

MGDF KSPI KPCIP INSIG-2

Figure 6: PCR of genes possibly involved in growth in O. conchaphila.. Tissue samples include the mantle (ma), gill (g), and muscle
(m). Red labels indicate the detection of the gene.
Objective 3: Gene Expression
The expression level of mGDF in the mantle of C. gigas is higher in November
than in September; however, the change is not significant (P = 0.107) (Table 1; Figure 7).
The expression of mGDF in the muscle of O. conchaphila is similar to C. gigas with
expression levels being higher in November, but the overall change does not show a
significant difference (P = 0.166) (Figure 8). The expression level of KSPI in the mantle
of C. gigas is higher in September, although the difference between September and
November is very small (P = 0.409 (Figure 9). Expression of KSPI in the muscle of
O. conchaphila shows a similar trend, the only difference being that KSPI is slightly
more prevalent in November instead of September (P = 0.488) (Figure 10). The
expression level of KPCIP in the mantle of C. gigas is higher in September in comparison
to November (Figure 11). This difference, while not significant (P = 0.075), still shows a
substantial change in expression. The expression level of KPCIP in the muscle of
O. conchaphila displays the same trend as C. gigas, with higher expression in September
(Figure 12). In O. conchaphila, however, KPCIP is either not expressed in November or
the expression is so low it is undetectable (P = 0.000). The expression of P450 in the gill
of C. gigas displayed a very low level of expression in September in comparison to the
higher level of expression in November (P = 0.024) (Figure 13).

Figure 7: Expression of mGDF from C. gigas

mantle samples between September and
November 2007, in Agate Pass, Kitsap County,
WA.

Figure 8: Expression of mGDF from

O. conchaphila muscle samples, between
September and November 2007, in Agate
Pass, Kitsap County, WA.
Figure 9: Expression of KSPI from
C. gigas mantle samples between
September and November 2007, in Agate
Pass, Kitsap County, WA.

Figure 10: Expression of KSPI from

O. conchaphila muscle samples, between
September and November 2007, in Agate
Pass, Kitsap County, WA.
 Figure 11: Expression of PKCIP from
C. gigas mantle samples between
September and November 2007, in Agate
Pass, Kitsap County, WA.

Figure 12: Expression of PKCIP from

O. conchaphila muscle samples, between
September and November 2007, in Agate
Pass, Kitsap County, WA.
 Figure 13: Expression of P450from
C. gigas gill samples between
September and November 2007, in
Agate Pass, Kitsap County, WA.

Discussion

Objective 1: Growth Rates

The results of this study, as supported by previous studies, reveal the superior
growing ability of C. gigas in relation to O. conchaphila. This may be due to the superior
filtering system of C. gigas. A study by (31) states that data collected from the annual
growth measurements of C. gigas showed two periods of higher growth. The first,
occurring in spring, is the soft tissue due to intense gonadal development. The second,
occurring in summer and early autumn, concerns shell growth, which is what this study is
measuring (Gricourt et al. 2003). The period of no growth in C. gigas between November
and December is most likely due to the onset of winter. This corresponds to a decrease in
phytoplankton in the system caused by cold temperatures and the shortening of days. The
latter can also aid in the explanation of the lack of growth in O. conchaphila as well.
Growth in this species may cease sooner than in C. gigas as it is a poorer filter feeder
and, as the autumn progresses and food becomes scarce, the oysters obtain less and less
of it.

Objective 2: Gene Identification

Four genes associated with growth were successfully identified in these oysters.
They are also follows:

mGDF
The first gene identified as being associated with growth in mollusks was the
transforming growth factor (TGF)-beta family of proteins. This family has been
extensively studied and characterized at the molecular level in vertebrates. All the
proteins in this superfamily share characteristic features and, on the basis of their
extended homology, were classified into the following subgroups: TGF-beta, bone
morphogenetic proteins (BMP), activins, inhibins, and the growth differentiation factors
(GDF). A study by Lelong et al 2000 shows that the mGDF protein in C. gigas is more
closely related to the human proteins BMP2 and BMP4 than to the corresponding
proteins DPP and 60A in Drosophila. An unrooted phylogenetic tree supports the
relationship of mGDF with that of the BMP2-4 and DPP group with a high bootstrap
value (98.3%). Expression of mGDF mRNA was not observed in the oocytes and
embryos up to the gastrula stage in C. gigas followed by a very small amount in the
trochophore stage, in the study by Lelong et al (2000). mGDF is not truly expressed in
C. gigas until the adult stage when it is present in most tissues with higher levels
appearing in the digestive gland, mantle, and gills (Lelong et al. 2000). It was expected
that the molluscan growth factor (mGDF) would be detected in the tissues of C. gigas as
the gene had been previously identified in this species. An alignment using Genious
Basic 3.6.2 shows 100% similarity (Table 3) (Genious, Biomatters Ltd.). This gene is
also known to be involved in growth in several other species such as the zebra fish
(Danio rerio), and abalone (Haliotis asinine).

KSPI
Kazal-type serine peptidase inhibitor domain 1 (KSPI) belongs to a family of
serine proteinase inhibitors also known as MEROPS inhibitor family I1, clan IA (Letunic,
2006). Serine proteinase inhibitors are classified into several protein families based on
the primary sequence, structural motifs, and mechanism of binding. Kazal inhibitors are
multi-domain proteins that share several common structural features, such as cysteine
distribution patterns, VCG-x(4)-TY sequence motifs, and highly homologous three-
dimensional structures. Over 100 Kazal-type proteinase inhibitors have been discovered
in vertebrates, arthropods, nematodes, and bacteria. In vertebrates, Kazal is usually found
in blood plasma, saliva, secretions of pancreas, seminal vesicles, and submandibular
glands. Kazal may also act as an insulin-like growth factor binding protein. The
molecular characterization, gene cloning, and expression of the serine proteinase inhibitor
in mollusks is not very well defined. However, a group of humoral factors was identified
in hemolymph of C. virginica, C. gigas, the surface clam, Spinuls, and the softshell clam,
Mya arenaria. KSPI is known to function in growth in other species with similarities of
approximately 30% such as the trout (Oncorhynchus mykiss), mouse (Mus musculus), and
Atlantic salmon (Salmo salar).
Table 3: Gene characterization and species with similar sequences.
Sequence name Accession Top Blasted
number Similar species Accession %
number similar
Molluscan Growth AJ130967 Pinctada fucata BAE96291 62.6%
Differential Factor (pearl oyster)
Haliotis vulgate AAM33143 36.7%
(limpet)
Haliotis asinine ABC00191 37.0%
(abalone)
Crassostrea gigas CAA10268 100.0%
(Pacific oyster)
Kazal-type serine Mus musculus NP_849260 32.8%
peptidase inhibitor (mouse)
domain 1 Salmo salar ABO36539 36.8%
(salmon)
Oncorhynchus ABA33953 36.8%
mykiss (trout)
Biomphalaria ABL74453 38.4%
glabrata (snail)
Protein kinase C Mus musculus NP_849260 11.8%
inhibitor protein 1 (mouse)
Salmo salar ABO36539 14.8%
(salmon)
Rattus norvegicus NP_001028236 15.0%
(rat)
Oncorhynchus ABA33953 14.1%
mykiss (trout)
Xenopus laevis ABF71729 11.8%
(frog)
Homo sapiens EAW49782 11.3%
(human)
Cytochrome P450 17- Danio rerio (zebra NP_997971 16.8%
hydroxylase/lyase fish)
Pleuronectes CAA52010 28.7%
(flatfish)
Liza aurata (grey AAB70307 16.8%
mullet)

KPCIP
Protein kinase C inhibitor protein 1(PKCIP) is part of a family of conserved
regulator proteins (Strochilic et al. 2004) composed of serine/threonne kinases which are
present in the tissues of all animals. Mammalian PKC isoforms share similar domain
structures and have been classified into three groups: classical PKCs which are calcium,
phosphatidylserine (PS) and diacylgyceral (DAG) dependent; novel PKCs which are
calcium independent but are still regulated by DAB and PA; and atypical PKCs that are
regulated by PS alone. PKCs play key regulatory roles in multiple cellular processes that
include differentiation, cell growth, secretion and muscle contraction (Walker and Plows,
2003). 14-3-3 Gamma was identified as the adaptor protein for muscle specific kinase
signaling at the neuromuscular junction (NMJ) through the forced expression of 14-3-3 y
in myotubes in vitro and in muscle fibers in vivo induced both the specific perturbations
of the NMJ (Strochilic et al. 2004). KPCIP shows an average 11% alignment similarity
with the following species where it is also involved in growth: humans (Homo sapiens),
frog (Xenopus laevis), and trout (O. mykiss).

INSIG2
Insulin-induced gene 2 protein (INSIG2) is involved in metabolic activity, gene
transcription, and cell growth. INSIG-2 is a close homolog to INSIG-1. They share a
similarity of 59% (Yabe et al. 2002). INSIG-2 differs from INSIG-1 in two respects: 1)
INSIG-1 depends on nuclear sterol regulatory element-binding proteins (SREBPs) for its
expression and 2) the action of INSIG-2 shows an absolute requirement for sterols (Yabe
et al. 2002). INSIG-2 is a second protein of the endoplasmic reticulum that blocks the
processing of SREBPs (Yabe et al. 2002). INSIGs, in general, encode proteins that block
proteolytic activation of sterol regulatory element-binding proteins and transcription
factors that regulate lipogenic enzymes and adipocyte metabolism (Krapivner et al.
2008). The genes restrict the cholesterol biosynthetic pathway by preventing proteolytic
activation of SREBPs and by enhancing degradation of HMG-CoA reductase (Engelking
et al. 2006).

P450
Cytochrome P450 17-hydroxylase/lyase (P450) monooxygenase enzymes (CYP)
comprise an ancient and widely distributed protein superfamily. A recent published
accounting lists more then 750 sequences belonging to more then 107 different families.
P450 proteins are found in a diverse array of organisms, including bacteria, plants, fungi,
and animals (Snyder, 2000). Cytochrome P450 is a dependent monooxygenase system
composed of approximately 100 isozymes from 27 gene families of endogenous
substances such as steroid biosynthesis, fatty acid metabolism, and also xenobiotics
(Fisher et al. 2003). It is a coupled electron transport system in the endoplasmic reticulum
of the cell where Cytochrome P450 binds and activates oxygen (Lee and Anderson,
2005). Functions of P450s in the metabolism of endogenous compounds and xenobiotics
(i.e. dietary plant chemicals, various aromatic hydrocarbons (PAH, AH), polychlorinated
biphenyls (PCB), insecticides, drugs) have been extensively studied in the last 30 years.
Types of P450 mediated reactions include hydroxylation, epoxidation, oxidative
deamination, S-, N-, and O-dealkylations, and dehalogenation. The results of these
reactions tend to be hydrophilic, and presumably more excretible products (Snyder,
2000). Four of the Cytochrome P450 genes code for enzymes that degrade lipophilic
xenobiotics to more water-soluble substances to facilitate their mobility and excretion
(Fisher et al. 2003). In the marine environment, the best studied member of the
Cytochrome P450 superfamily is CYP1A1, the major form induced by dioxins, PAHs
and PCBs. P450-type enzymatic activities have been reported in arthropods (crustaceans),
annelids (polecats), cnidarians, mollusks, porifera, platyhelminths, and echinoderms. In
mollusks, P450 is highest in the digestive gland, though it is also detectable in blood
cells, gills, foot and gonads. In echinoderms, P450 is mainly detectable in the pyloric
ceca, gonads and haemal plexus. Crustaceans have the highest total P450 protein in the
hepatopancreas, but significant activity also occurs in the green gland, gonads, and
stomach. Typically, total P450 protein and associated enzymatic activities are found to be
ten-fold lower in mollusks than in mammals. The second mollusk CYP gene, CYP4Y1,
was identified from the digestive gland of the mussel M. galloprovincialis, where its
expression was inhibited by increasing concentrations of beta-NF added in static
exposures (Snyder, 2000). P450 shows a 17% similarity in the zebra fish (D. rerio) and a
28% similarity with the flat fish (pleuronectes).

Objective 3: Gene Expression

The characterization of tissue expression patterns and quantifying expression
level in relation to different periods of development met the third objective of this study.
The expression of mGDF follows the same trend in both C. gigas and O. conchaphila.
While there is definitely a difference in expression over time and an indication that the
gene must be doing something, the preliminary data of this study will only allow for
speculation. The elevated level of expression in November may indicate a higher level of
activity in the gene. Another explanation could be that the lower expression levels in
September could indicate a higher level of protein translation. This leads to a relationship
between the growth and weather data as oysters are more likely to be creating proteins
needed for growth during the summer and early autumn months when food is available.
Varying levels of gene expression may not be observed with KSPI as it could be
involved in a different aspect of growth in oysters not affected by seasonal changes.
Since this gene is found in blood plasma, saliva, secretions of pancreas, seminal vesicles
and submandibular glands, it may be that this gene is more involved in metabolism or
growth of reproductive organs than in actual body growth. Additionally, it may only be
the protein levels that are changing which this study would not reveal.
PKCIP shows dramatic variances in gene expression in both C. gigas and
O. conchaphila. This gene which is directly involved in cell growth is probably not
expressed in O. conchaphila during November as O. conchaphila has ceased growing due
to the change in temperature and corresponding lack of food. PKCIP is most likely still
present in C. gigas during this period as C. gigas is a stronger filter feed and may still be
able to strain the remaining food particles from the water. Tissue samples taken in
December for this species may have yielded a significant difference in expression.
However, this is all speculation as these genes have not been extensively studied in
oysters.
The change in the expression of P450 in C. gigas could possibly indicate one of
two things. First, it could indicate a change in growth between September and November
when the gene is actively translating the protein in September and not in November with
the drop in the food supply. Second, it could indicate a change in the water quality as
P450 is also involved in the metabolism of endogenous compounds. The change in water
quality could have occurred with change in seasons and water temperature.
Concluding Statements

It was expected that the growth rates of the two species would differ but that the
internal mechanisms regulating growth would be similar. It was discovered that, in
support of previous studies, the growth rates of the two species are different due to
differences in their life history. The genes identified as being likely to be involved in
regulating growth were not only the same (mGDF, KSPI, KPCIP), but similarly
expressed as well. In addition, the expression of those genes showed consistent trends. It
was speculated that the expression of genes involved in growth may be influenced by
changes in relation to the environment, such as water temperature, feeding, and
placement. While this study can merely add to this hypothesis, the trends of the
expression patterns could potentially be reflections of a change in the environment. It
would be a worthwhile objective for a future study, as it appears that available prey items
which vary seasonally play a role in gene expression.
The United States is the largest producer and consumer of oysters in the world. It
produces 50 million pounds of oyster meats and imports over 20 million pounds annually.
This is approximately 56% of the production in the world. As the largest oyster producer
on the Pacific Coast, Washington State produces approximately 5 million pounds of
oyster meat which is roughly five times the amount produced by British Columbia,
Oregon, and California combined (Pauly et al. 1988).
A greater understanding of basic growth mechanisms in oysters can lead to the
ability to modify it through manipulations of water quality, temperature, food supply, or
genetics. The ability to influence the growth of oysters would aid aquaculturists in
establishing the length of time it will take oysters to reach market. Larger oysters could
also be introduced into areas such as Chesapeake Bay which is in need of the water
quality control services provided by the filter feeder. It can aid managers in setting
sustainable harvest rates and in avoiding the overexploitation of larger oysters which
provide a greater contribution to recruitment. Additionally, it can also aid in the
broodstock selection of hatcheries.
Future work suggested by this study could include a more in-depth study on the
genes involved in growth. Measurements and tissue samples should also be taken at
multiple points throughout the year. Data could also be collected during different life
stages and age groups as well. This data provides insight into the processes involved in
the growth of two important species of oysters in our region.

Acknowledgements

I would like to thank all the people who have contributed to the completion of the
this project: Lin Murdock and Greg Jensen for helping me get started; my advisor Steven
Roberts for all the guidance and assistance along the way; Sam White for all the technical
support in lab, Vivianne Barry and Debbie Kay from the Suquamish Tribe for the use of
their oysters and facilities, my dad for helping me to collect measurement data once a
month, and my mom for the grammatical corrections on my paper.
References

Alberntosa, M, Fernandez-Reiriz MJ, Labarta U, Perez-Camacho A. (2007).Response of

two species of clams, Ruditapes decussatus and Venerupis pullastra, to starvation:
Physiological and biochemical parameters. Comparative Biochemistry and
Physiology. 146, 241-249.

Brockington, S, Clarke A. (2001).The relative influence of temperature and food on the

metabolism of a marine invertebrate. Journal of Experimental Marine Biology
and Ecology. 258, 87-99.

Cardoso, Joana, Langlet, Denis, Loff, Jose, Martins, Ana, Witte Johannes, Santos, Paulo,
van der Veer, Henk. (2007) Spatial variability in growth and reproduction of the
Pacific oyster Crassostrea gigas (Thunger, 1793) along the west European coast.
Journal of Sea Research 57: 303-315.

Engelking, LJ, Evers BM, Richardson JA, Goldstein JL, Brown MS, Liang G.
(2006).Severe facial clefting in INSIG-deficient mouse embryose caused by sterol
accumulation and reversed by lovastatin. Journal of Clinical Investigation. 116

Farias, A, Garcia-Esquievel Z, Viana MT. (2003).Physiological energetics of the green

abalone, Haliotis fulgens, fed on a balanced diet. Journal of Experimental Marine
Biology and Ecology. 289, 263-276.

Fisher, T, Crane M, Callaghan A. (2003).Induction of Cytochrome P450 activity in

individual Chironomus riparius (Meigen) larvae exposed to xenobiotics.
Ecotoxicolgy and Environmental Safety. 54, 1-6.

Genious, Biomatters Ltd.

Gricourt, L., Bonnec, G., Boujard, D., Mathieu, M., and Kellner K. (2003) Insulin-like
system and growth regulation in the Pacific oyster Crassostrea gigas: hrIGF-1
effect on protein synthesis of mantle edge cells and expression of a homologous
insulin receptor-related receptor. General and Comparative Endocrinology 134:
44-56.

Gricourt, L, Mathieu M, Kellner K. (2006). An insulin-like system involved in the control

of Pacific oyster Crassostrea gigas reproduction: hrIGF-1 effect on germinal cell
proliferation and maturation associated with expression of a homologous insulin
receptor-related receptor. Aquaculture. 251, 85-98.

Gillespie, Graham E. (1999). Status of the Olympia Oyster, Ostrea conchaphila, in

Canada. Canadian Stock Assessment Secretariat Research Document 99/150: 1-
36.
Hamano, K, Awaji M, Usuki H. (2005). cDNA structure of an insulin-related peptide in
the Pacific oyster and seasonal changes in the gene expression. Journal of
Endocrinology. 187, 55-67.

(weather data) History for KWAKINGS1. Retrieved April 4, 2008, from Weather
Underground Web site:
http://www.wunderground.com/weatherstation/WXDailyHistory.asp?ID=KWAKI
NGS1&graphspan=month&month=8&day=30&year=2007

Johnson, TB, Hartt L, Mason DM. (2001).Constraints to growth of Lake Superior lake
trout, Salvelinus namaycush. Great Lakes Fishery Commission.

Lavoie, Rene Oyster culture in North America history, present, and future. Oyster
Research Institute News. 17.

Lee, R, Anderson J. (2005).Significance of Cytochrome P450 system responses and

levels of bile fluorescent aromatic compounds in marine wildlife following oil
spills. Marine Pollution Bulletin. 50, 705-723.

Lelong, C, Mathieu, Favrel P. (2000).Structure and expression of mGDF, a new member

of the transforming growth factor-beta superfamily in the bivalve mollusk
Crassostrea gigas. European Journal of Biochemistry. 267, 3986-3993.

Letunic, Ivica (2006). Kazal type serine proteinase inhibitors. Retrieved April 26, 2008,
from SMART Web site: http://smart.embl-
heidelberg.de/smart/do_annotation.pl?BLAST=DUMMY&DOMAIN=KAZAL

Kesarcodi-Watson, A., Lucas, J.S., Klumpp, D.W. (2001) Comparative feeding and
physiological energies of diploid and triploid Sydney rock oysters, Saccostrea
commercialis I. Effects of oyster size. Aquaculture 203: 177-193.

Kittel, Manfred. (1999) Tasmanian Pacific Oysters, Crassostrea gigas, in Washington

State: A Morphological, Physiological, and Molecular Genetic Analysis of and
Introduced Population. Ann Arbor: University Microfilms.

Krapivner, S, Popov S, Chernogubova E, Hellenius M, Fisher RM, Hamsten A, van't-

Hooft FM. (2008).Insulin-induced gene 2 (INSIG2) involvement in human
adipocyte metabolism and body weight regulation. Journal of Clinical
Endocrinology and Metabolism.

Malanga, G, Estevez MS, Calvo J, Abele D, Puntarulo S. (2007).The effect of seasonality

on oxidative metabolism in Nacella (Patinigera) magellanica. Comparative
Biochemistry and Physiology. 146, 551-558.

(ocean temps) Meteorological Observations: Station ID: 9447130. Retrieved April 4,

2008, from NOAA: Tides and Currents Web site:
 http://tidesandcurrents.noaa.gov/data_menu.shtml?bdate=20070801&edate=2007
1231&metinterval=h&unit=1&shift=g&stn=9447130+Seattle%2C+WA&type=M
eteorological+Observations&format=View+Data

Patrick, S, Faury N, Goulletquer P. (2006).Seasonal changes in carbohydrate metabolism

and its relationship with summer mortality of Pacific oyster Crassostrea gigas
(Thunberg) in Marennes-Oleron bay (France). Aquaculture. 252, 328-338.

Pauly, Gilbert B., Ray, Birgitta Van Der, and Troutt, David. (1988) Pacific Oyster.
Species Profiles: Life Histories and Environmental Requirements of Coastal
Fishes and Invertebrates (Pacific Northwest) 82: 1-29.

Pennec, Gail Le, Pennec, Marcel. (2002) Molecular analysis of the seasonal expression of
genes coding for different functional markers on the digestive gland of the bivalve
mollusk Pecten maximus. Comparative Biochemistry and Physiology Part B:
Biochemistry and Molecular Biology 133: 417-426

Villarroel, E., Buitrago, E., Lodeiros, C. (2004) Identification of environmental factors

affecting growth and survival of the tropical oyster Crassostrea rhizophorae in
suspended culture in the Golfo de Cariaco, Venezuela. Revista Cientifica-
Facultad de Ciencias Veterinarias 14(2004): 28-35.

Snyder, Mark (2000).Cytochrome P450 enzymes in aquatic invertebrates: recent

advances and future directions. Aquatic Toxicology. 48, 529-547.

Strochilic, L, Cartaud A, Mejat A, Grailhe, Schaeffer L, Changeux JP, Cartaud J.

(2004).14-3-3 y associates with muscle specific kinase and regulates synaptic
gene transcription at vertebrate neuromuscular synapse. Neuroscience. 101,
18189-18194.

Vinagre, AS, Nunes do Amaral AP, Ribarcki FP, da Silveira EF, Perico E. (2007).
Seasonal variation of energy metabolism in ghost crab Ocypode quadrata at Siriu
Beach (Brazil). Comparative Biochemistry and Physiology Part B: Biochemistry
and Molecular Biology. 146, 514-519.

Walker, A, Plows L. (2003).Bacterial lipopolysaccharide modulates Protein Kinase C

signaling in Lymnaea stagnalis haemocytes. Biology of the Cell. 95, 527-533.

Yabe, D, Brown MS, Goldstein JL. (2002).INSIG-2 a second endoplasmic reticulum

protein that binds SCAP and blocks export of sterol regulatory element-binding
proteins. Biochemistry. 99, 12753-12758.