JOURNAL OF CLINICAL MICROBIOLOGY, Jan. 1994, p. 253-255 Vol. 32, No.

1
0095-1137/94/$04.00+0
Copyright ©) 1994, American Society for Microbiology

Unique Oligonucleotide Primers in PCR for Identification of

Cryptococcus neoformans
THOMAS G. MITCHELL,1* ELIZABETH Z.FREEDMAN,1 THOMAS J. WHITE,2
ANDJOHN W. TAYLOR3
Department of Microbiology, Duke University Medical Center, Durham, North Carolina 27710'-
Roche Molecular Systems, Alameda, California 945012; and Department of Plant Biology,
University of California, Berkeley, California 947203
Received 7 July 1993/Returned for modification 4 August 1993/Accepted 20 October 1993

On the basis of a comparison of rRNA sequences coding the internal transcribed spacer (ITS) and 5.8S
regions of Filobasidiella neoformans, the teleomorph of Cryptococcus neoformans, and members of its most
closely related taxa, unique oligonucleotides were designed for the specific amplification of DNA only from C.
neoformans. Various combinations of these primers, designated CN4, CN5, and CN6, and the previously
described fungal primers fTS1 and ITS2 were tested in PCR for their ability to amplify DNA from 37 strains
of C. neoformans and 31 other isolates representing 18 species of yeasts. The combination of primers CN4 and
CN5 amplified DNA from both varieties of C. neoformans but from none of the other species tested. Other pairs
of primers (namely, CN5-CN6, CN4-ITS1, and CN6-ITS1) amplified DNA only from C. neoformans and from
the saprophyte FilobasidieUa depauperata, which is the only other member of the genus Filobasidiella. With
appropriate controls, these specific oligonucleotides may be used as primers in PCR to identify C. neoformans.

Unique primers were developed to amplify specific seg-
ments of the genes coding for rRNA (rDNA) of Cryptococ-
cus neoformans. These primers were designed on the basis
of a comparative analysis of sequences of the 5.8S and
internal transcribed spacer (ITS) regions of Filobasidiella
neoformans, which is the teleomorph of C. neoformans, and
its closest phylogenetic relatives (5). Upon use of either a
pair of the C. neofonnans-specific primers or one of these
primers in combination with a nonspecific fungal primer (6),
only DNA from C. neoformans (F. neoformans) or from
Filobasidiella depauperata, the other member of the genus
Filobasidiella, generated an intense product of the correct
size in PCR. The appropriate primer combinations can be
used to identify this pathogenic yeast (3) or possibly to probe
DNA preparations for C. neoformans-specific DNA. A
preliminary report detailed this method (4), and this note
presents more complete data on the procedure and the
specificity and sensitivity of the oligonucleotide primers.
After comparison of ITS rDNA sequences of F. neofor-
mans with those of members of its most closely related taxa
(unpublished data), three primers or probes were designed.
The sequences (5'- 3') of these oligonucleotides, designated
CN4, CN5, and CN6, and the other primers used (ITS1 and
ITS4) are as follows: ITS1, TCCGTAGGTGAACCTGCGG;
ITS4, TCCTCCGCTTATTGATATGC; CN4, ATCACCT
TCCCACTAACACATT; CN5, GAAGGGCATGCCTGTT
TGAGAG; and CN6, '1'T'AAGGCGAGCCGACGTCCTT.
ITS primers are general fungal primers (6); CN primers are
C. neoformans specific. Their relative locations among the
rDNA genes are indicated in Fig. 1. Oligonucleotide CN6
was designed from unique regions found only in the ITS
Cystofilobasidium (1, 5). Primer CN4 also consists of se-
quences present only in the ITS of F. neoformans and F.
depauperata; however, this sequence of F. depauperata
differs from that of F. neoformans by substitutions at three
bases. Primer CN5 contains more conserved sequences that
overlap with the 3' end of the 5.8S rDNA gene.
For this evaluation, most of the yeast strains investigated
were obtained from the American Type Culture Collection
(Rockville, Md.) or from clinical specimens at Duke Hospi-
tal. Several isolates of C. neoformans var. gattii were gifts
from Dexter Howard (University of California, Los Angeles)
or Tania Pfeiffer (Children's Hospital, Adelaide, Australia).
Except for the species of Candida, most of the species tested
are considered to be basidiomycetous yeasts. Cultures were
maintained on glucose-yeast extract agar, and the DNA was
extracted from each isolate by a method previously de-
scribed (2, 4, 5). Rapid minipreparations of DNA were
adequate for amplification and detection of the PCR prod-
ucts. For PCR, 50-,ul reaction mixtures were prepared as
described elsewhere (4, 6) and run for 30 cycles. Amplifica-
tion products were readily visualized on agarose gels, as
shown in Fig. 2.
In Fig. 2, amplification products from DNA extracted
from three species, C. neoformans, Cryptococcus albidus,
and Candida albicans, are compared. All three are ampli-
fied, as expected, by the primer pair ITS1-ITS4 (Fig. 2, the
first set of lanes labeled 1 to 3), and some length polymor-
NS1 ITS1 CN5
Nuclear Small rDNA } Nuclear Large rDNA

sequences of the two species of Filobasidiella and not in

species of the closely related genera Filobasidium or NS8 CN6 CN4 ITS4

500 bp

FIG. 1. The approximate locations (arrows) of the CN primers,

*
Corresponding author. Mailing address: Department of Micro- as well as useful ITS and NS primers (6), are indicated on this
biology, P.O. Box 3803, Duke University Medical Center, Durham, diagram of the rDNA genes. CN4 and CN6 are 3' primers; CN5 is a
NC 27710. Phone: (919) 684-5792. Fax: (919) 681-8911. 5' primer. Arrowheads approximate the 3' end of each primer.

253
254 NOTES J. CLIN. MICROBIOL.

ITS1 CN4 CN5 CN4
ITS4 CN5 CN6 ITS1
kb 1 2 3 1 2 3 1 2 3 1 2 3
1000-
500_
300
FIG. 2. A 3% agarose gel (4, 6) demonstrating specific amplifi-
cation of C. neofonnans but not other yeast genomic DNA by
specific primer pairs. The first and last lanes contain size markers
(kilobases). PCR primer pairs are indicated above each set of three
lanes. Lanes 1, DNA extracted from C. neofonnans var. neofor-
mans; lanes 2, DNA extracted from Cryptococcus albidus var.
albidus; lanes 3, DNA extracted from Candida albicans.
phism is evident. Most fungi yield ITS1-ITS4 products of
approximately 600 to 650 bp. All strains of C. neoformans
examined generated identical ITS1-ITS4 products (5). The
C. neoformans-specific amplicon generated by CN4-CN5 is
136 bp long, and the CN5-CN6 product is 116 bp long (Fig.
2).
The results of this evaluation of PCR-based identification
of C. neofonnans cultures are presented in Table 1, which
demonstrates both the specificity and sensitivity of the CN
primers, whether paired with each other or with a universal
fungal primer (in this study, ITS1 or ITS4). The sensitivity of
the primer combinations was 100%, as all strains of C.
neoformans were amplified by each pair of primers. The 37
strains of C. neoformans tested included clinical and natural
isolates representing both varieties and each of the four
serotypes.
Specificity varied with the primer pairs. Among the strains
CN6 CN5 tested, the combination CN4-CN5 amplified only C. neofor-
ITS1 ITS4
1 2 3 1 2 3 kb mans (Table 1). Except for F. depauperata, the primer pairs
CN5-CN6, CN4-ITS1, and CN6-ITS1 were completely spe-
cific for C. neoformans. F. depauperata is a saprophyte,
lacks a yeast form, and would not be confused with C.
neofonnans. As indicated in Table 1, the primer pair CN5-
ITS4 produced faint (weak) to intense bands in many non-C.
neofonnans yeasts because CN5 overlaps with the more
phylogenetically conserved sequences of 5.8S rDNA (Fig. 1
and 2). However, the size of this band usually differs from
that of C. neoformans (Fig. 2). Positive controls include
ITS1-ITS4 and known C. neofornans DNA to identify the
appropriate bands. The latter control is important because
occasionally, faint, higher-molecular-weight bands were
generated with DNA from unrelated yeasts; these probably
resulted from random amplification caused by arbitrary
binding of one of the primers to the template. Therefore,
DNA is identified as C. neofornans by the appearance of an
intense band of the appropriate size.
In the future, these primers may be useful for the ampli-
fication of C. neoformans DNA from clinical specimens.
They might also be incorporated in a protocol that used
nested primers. For example, fungal DNA could be ampli-
fied with ITS1-ITS4, and then specific C. neofonnans DNA
could be detected by amplifying with CN4-CN5 or CN5-
CN6. Although not evaluated here, oligonucleotides CN4
and CN6 should also function as specific hybridization
probes for the recognition of DNA from C. neoformans,
either in amplified fungal DNA or perhaps in clinical mate-
rial.
This report has described a simple PCR method, using
rapidly extracted DNA and the selective coupling of unique

TABLE 1. Sensitivity and specificity of unique C. neoformans primers

No. of No. of strains amplified for indicated primer pair"
Species and variety strains tested ITS1-ITS4 CN4-CN5 CN5-CN6 CN4-ITS1 CN6-ITS1 CN5-ITS4
Cryptococcus neofonnans 21 21 21 21 21 21 21
var. neoformansb
Cryptococcus neoformans 16 16 16 16 16 16 16
var. gattiic
Candida albicans 4 4 0 0 0 0 4
Candida krusei 1 1 0 0 0 0 id
Candida parapsilosis 4 4 0 0 0 0 4d
Candida tropicalis 4 4 0 0 0 0 2d
Cryptococcus albidus 2 2 0 0 0 0 2d
Cryptococcus laurentii 1 1 0 0 0 0 id
Cryptococcus luteolus 1 1 0 0 0 0 id
Cryptococcus terreus 1 1 0 0 0 0 id
Cryptococcus uniguttulatus 2 2 0 0 0 0 2
Cystofilobasidium bisporidiis 1 1 0 0 0 NT- 0
Cystofilobasidium capitatum 1 1 0 0 NT 0 0
Filobasidiella depauperata 1 1 0 1 1 1 1
Filobasidium capsuligenum 1 1 0 0 0 0 1
Filobasidium floriforme 1 1 0 0 0 0 0
Rhodotorula glutinis 1 1 0 0 0 0 id
Rhodotorula rubra 1 1 0 0 0 0 id
Torulopsis glabrata 2 2 0 0 0 0 2
Tnchosporon beigelii 2 2 0 0 0 0 id
a The ITS1-ITS4 pair provides a positive control. Because CN5 includes a portion of the conserved 5.8S rDNA sequence, when CN5 is paired with an ITS
primer, the DNA from many non-C. neofornans yeasts is amplified, as seen in the last column.
b Strains of C. neofornans var. neofonnans included 5 strains of serotype A, 2 strains of serotype D, and 14 nonserotyped strains.
c Strains of C. neofonnans var. gattii included 4 strains of serotype B, 4 strains of serotype C, and 8 nonserotyped strains.
d
Strain(s) only weakly amplified.
e NT, not tested.
VOL. 32, 1994
primers, to generate specific amplification only with DNA
from isolates of C. neoformans.
This investigation was supported by Public Health Service grants
AI 28545, AI 25783, and AI 28836.
Technical assistance of Robert Beach is greatly appreciated.
REFERENCES
1. Kwon-Chung, K. J. 1987. Filobasidiaceae-a taxonomic survey,
p. 75-85. In G. S. de Hoog, M. T. Smith, and A. C. M. Weijman
(ed.), The expanding realm of yeast-like fungi. Elsevier Science,
Amsterdam.
2. Lee, S. B., and J. W. Taylor. 1990. Isolation of DNA from fungal
mycelia and single spores, p. 282-287. In M. A. Innis, D. H.
Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols. A
guide to methods and applications. Academic Press, San Diego,
Calif.
3. Mitchell, T. G. 1992. Opportunistic mycoses, p. 1135-1157. In
NOTES 255
W. K. Joklik, H. P. Willett, D. B. Amos, and C. M. Wilfert (ed.),
Zinsser microbiology, 20th ed. Appleton & Lange, Norwalk,
Conn.
4. Mitchell, T. G., E. Z. Freedman, W. Meyer, T. J. White, and
J. W. Taylor. 1993. PCR identification of Cryptococcus neofor-
mans, p. 431-436. In D. H. Persing, T. F. Smith, F. C. Tenover,
and T. J. White (ed.), Diagnostic molecular microbiology: prin-
ciples and applications. American Society for Microbiology,
Washington, D.C.
5. Mitchell, T. G., T. J. White, and J. W. Taylor. 1992. Comparison
of 5.8S ribosomal DNA sequences among the basidiomycetous
yeast genera Cystofilobasidium, Filobasidium and Filobasidiella.
J. Med. Vet. Mycol. 30:207-218.
6. White, T. J., T. D. Bruns, S. B. Lee, and J. W. Taylor. 1990.
Amplification and direct sequencing of fungal ribosomal RNA
genes for phylogenetics, p. 315-322. In M. A. Innis, D. H.
Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols. A
guide to methods and applications. Academic Press, San Diego,
Calif.