You are on page 1of 14

MOLECULAR

PHYLOGENETICS
AND
EVOLUTION
Molecular Phylogenetics and Evolution 34 (2005) 67–80
www.elsevier.com/locate/ympev

Molecular phylogenetics and evolutionary history of the neotropical


Satyrine Subtribe Euptychiina (Nymphalidae: Satyrinae)
Debra Murraya,*, Dorothy Pashley Prowellb
a
150S Dirac Science Library, School of Computational Science and Information Technology, Florida State University
Tallahassee, FL 32306-4120, USA
b
Department of Entomology, Louisiana State University, USA

Received 29 December 2003; revised 17 June 2004

Abstract

The Euptychiina is one of the more diverse lineages of satyrine butterflies, represented by over 300 species. The first phylogenetic
analyses of the subtribe is presented based on 2506 aligned nucleotide sequences obtained from 69 individuals spanning 28 ingroup
genera and nine outgroup genera. Two genes were used, the mitochondrial gene cytochrome oxidase 1 (1268 bp) and the nuclear
gene elongation factor-1a (1238 bp). The subtribe is never recovered as monophyletic in analyses using parsimony, maximum like-
lihood, or Bayesian inference. Several euptychiine genera are placed basal to the ingroup, but support is found only for Euptychia
and Oressinoma. Three main lineages within the ingroup were clearly defined and many taxonomic groupings within the clades
strongly supported. The majority of genera tested were paraphyletic or polyphyletic. Based on results presented here and novel host
use, a close relationship of Euptychia to the Indo-Australian tribe Ragadiini is hypothesized. Origins of the group remain unclear,
but the basal position of most of the Nearctic genera is discussed.
Ó 2004 Elsevier Inc. All rights reserved.

Keywords: COI; EF-1a; Molecular systematics; Butterflies; Euptychia; Selaginella

1. Introduction ships among European satyrines and the validity of


MillerÕs (1968) classification as it related to those taxa,
Satyrinae is the second largest nymphalid butterfly and although regional in scope, found paraphyly at
subfamily with 2500–3000 species worldwide, yet has re- the higher taxonomic levels. The question of monophyly
ceived little attention from systematists, and many tradi- of the subfamily is equally ambiguous (Harvey, 1991).
tional taxonomic groups are untested. There has been Neither Miller (1968) nor authors following him were
only one comprehensive treatment of the Satyrinae able to delineate the Satyrinae with synapomorphies
(Miller, 1968), downranked here to reflect accepted clas- (Ackery, 1984; Garcı́a-Barros and Martı́n, 1991; Har-
sification of satyrines as a subfamily as opposed to a vey, 1991). The enlarged forewing costal vein and the
family (Ackery, 1984; de Jong et al., 1996; Ehrlich, closed hindwing discal cell are often cited as the defining
1958; Harvey, 1991; Kristensen, 1976). Miller (1968) characteristics, however there are numerous exceptions,
provided few diagnostic characters for tribal and sub- and these traits are not unique to satyrines (Ackery
tribal groupings, and his proposed phylogeny was not et al., 1999). One genus has been moved from Satyrinae
based on an explicit data matrix or cladistic analysis. to Morphinae, and the placement of other genera is
Martı́n et al. (2000) investigated phylogenetic relation- questioned (Ackery, 1984; DeVries et al., 1985). Re-
cently two molecular studies found a non-monophyletic
*
Corresponding author. Fax: +850 645 1323. Satyrinae. Brower (2000), based on limited satyrine
E-mail address: murrayde@uky.edu (D. Murray). exemplars within a larger Nymphalidae study and using

1055-7903/$ - see front matter Ó 2004 Elsevier Inc. All rights reserved.
doi:10.1016/j.ympev.2004.08.014
68 D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

one gene, found a polyphyletic Satyrinae, although only netic analysis for the subtribe. DNA sequence data were
his successive weighting tree produced resolution among used to infer relationships among euptychiine genera,
satyrine taxa. Wahlberg et al. (2003) reported similar investigate monophyly of the delimited genera, and test
findings based on fewer satyrine taxa but more genes. monophyly of the subtribe.
However, the authors concluded that more sampling is
needed to resolve relationships among Satyrinae and
its sister groups. 2. Materials and methods
The majority of satyrine species are found in the neo-
tropics, represented by a small ancestral tribe, Haeterini, 2.1. Taxon sampling
and two diverse Satyrini subtribes, Euptychiina and
Pronophilina. Historically, the two latter subtribes were Fifty-eight species of the butterfly subtribe Euptychi-
delineated in part based on geography (Miller, 1968), ina, representing 28 genera, were included in this study
with euptychiines occurring in the lowlands and prono- (Table 1). Because the taxonomic status of many eupty-
philines in the highlands. Neither subtribe has been the chiine groups is questionable, more than one exemplar
subject of a published phylogenetic study. Euptychiina, was included from 14 genera to explore hypotheses of
the focus of this work, currently includes over 300 species monophyly. Samples suitable for DNA extraction were
grouped into 43 genera, 12 of which are monotypic. Spe- not obtained for some euptychiine groups, including
cies range from central United States to Argentina, occur- several monotypic genera with narrowly distributed spe-
ring in all habitat types from lowlands to cloud forests. cies. Species names follow Lamas (unpublished). Speci-
Like most all satyrines, euptychiine host plants are exclu- mens listed as ‘‘nr’’ could not be accurately placed
sively monocots with one exception found in Euptychia. within known species and likely represent new species.
The subtribe was circumscribed based on a few wing, Basic taxonomic work is lacking for most euptychiine
antennal, and leg characters (Miller, 1968), but none un- groups, and undescribed species, synonyms, and unre-
ique to Euptychiina. Most euptychiine genera were solved species groups are common.
erected by Forster (1964) in his study of the Bolivian fau- Several satyrine outgroups were used in this study,
na. However, he did not delineate the genera with diag- representing all major groups in the subfamily. Higher le-
nostic characters, but instead referred to line drawings vel relationships within the subfamily have not been
of male genitalia, leaving it up to the reader to deduce gen- tested, and the sister group to the euptychiines is un-
eric differences. No structural detail was shown in his fig- known. Morphological studies (Miller, 1968; Murray,
ures, suggesting he examined only overall gross 2001a) suggested that Haeterini is an ancestral satyrine
morphology, ignoring potentially informative characters. tribe. Two exemplars from this tribe were used to root
The lack of diagnostic characters for the subtribe Eupty- the tree, Cithaerias pireta and Haetera piera. The remain-
chiina is compounded by the fact that Miller placed For- ing outgroups were not designated as such in analyses.
sterÕs ill-defined genera within the subtribe without From the diverse Satyrini tribe, representatives of the
examination, citing time constraints. Based on the ques- high Andean subtribe Pronophilina and Old World sub-
tionable taxonomic history of the Euptychiina, some tribe Ypthimina were selected. Ypthimina was hypothe-
authors instead use Euptychia sensu lato or Cissia as sized to be closely related to the Euptychiina (Miller,
catch-all genera (DeVries, 1987; Emmel and Austin, 1968; Ackery, 1988). Two exemplars, one Asian (Ypt-
1990). In addition to poorly delimited genera, no work hima confusa) and one African (Y. doleta), were included.
has addressed euptychiine interrelationships. The few Two representatives from the Pronophilina, Nelia
revisions published have focused on a single genus (Mill- nemyroides and Neomaneus monachus, were also selected,
er, 1972, 1974, 1976, 1978) or species group (Singer et al., as both this group and the euptychiines have been sepa-
1983), without information on higher level classification rated in part due to their geographic location (Miller,
nor the use of rigorous phylogenetic methods. In an effort 1968). Finally, representatives from two other putative
to clarify euptychiine taxonomy, Lamas (unpublished), as ancestral tribes were included, Bicyclus madetes, B. fune-
part of a larger project on neotropical butterflies, assem- bris, Enodia portlandia and Lethe mekara from Elymini-
bled an annotated checklist of euptychiine species, synon- ini and Melanitis leda from Biini. Preliminary analyses
omizing species and placing some within genera that suggested that at least two euptychiine genera, Euptychia
Forster did not. However, his work was not based on and Oressinoma, diverged early in satyrine evolution and
intensive morphological study or phylogenetic analysis. these outgroups were included to explore those results.
In summary, little is known of evolutionary relation-
ships within Euptychiina. The general goal of this work 2.2. Molecular methods
is to advance our understanding of a poorly studied, di-
verse group of organisms, the satyrines, with an intense For most samples, field collected tissues were stored
study of one of the more speciose subtribes, the Eupty- in 95% EtOH, preserving whole bodies or only abdo-
chiina. In doing so, this paper presents the first phyloge- mens and legs. DNA was extracted using a QIAGEN
D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80 69

Table 1
Species examined in this study, their localities, and GenBank accession numbers
Tribe (Subtribe) species Collecting locality COI EF-1a
Outgroup
Haeterini (Haeterina)
Cithaerias pireta (Cramer) Ecuador: Napo Province AY508517 AY509045
Haetera piera (Linnaeus) Peru: Madre de Dı́os Province AY508518 AY509046
Biini (Melanitina)
Melanitis leda (Linnaeus) Australia: Queensland AY508560 AY509086
Elyminiini (Lethina)
Enodia portlandia Fabricius USA: Louisiana AY508536 AY509062
Lethe mekaraa Moore Malaysia AY508550 AY509076
Elyminiini (Mycalesina)
Bicyclus funebrisa Gúeria-Méneville Ghana: Ashanti Region AY508520 AY509048
Bicyclus madetes Hewitson Ghana: Ashanti Region TreeBaseb Treebaseb
Satyrini (Ypthimina)
Ypthima confusaaShirozu and Shima Thailand: Chiang Mai Province AY508584 AY509109
Ypthima doletaa Kirby Ghana: Ashanti Region AY508585 AY509110
Satyrini (Pronophilina)
Nelia nemyroidesa (Blanchard) Chile: Los Lagos Region AY508562 AY509088
Neomaenas monachusa (Blanchard) Chile: Los Lagos Region AY508563 AY509089
Ingroup
Satyrini (Euptychiina)
Caeruleuptychia nr. caerulea Peru: Madre de Dı́os Province AY508522 AY509050
Caeruleuptychia coelicaa (Hewitson) Ecuador: Napo Province AY508524 AY509051
Caeruleuptychia umbrosa (Butler) Ecuador: Napo Province AY508523
Caeruleuptychia sp. Peru: Madre de Dı́os Province AY508521 AY509049
Cepheuptychia cephus (Fabricius) Ecuador: Napo Province AY508525 AY509052
Chloreuptychia agathaa (Butler) Ecuador: Napo Province AY508526 AY509053
Chloreuptychia arnaca (Fabricius) Ecuador: Napo Province AY508527 AY509054
Chloreuptychia heresis (Godart) Ecuador: Napo Province AY508528 AY509055
Cissia confusa (Staudinger) Costa Rica: Heredia Province AY508532 AY509059
Cissia myncea (Cramer) Peru: Madre de Dı́os Province AY508556 AY509082
Cissia penelope (Fabricius) Ecuador: Napo Province AY508530 AY509057
Cissia similis (Butler) Belize: Orange Walk District AY508529 AY509056
Cissia terrestris (Butler) Peru: Madre de Dı́os Province AY508531 AY509058
Cissia sp. Ecuador: Pichincha Province AY508533
Cyllopsis gemma (Hübner) USA: North Carolina AY508534 AY509060
Cyllopsis rogersi (Godman and Salvin) Costa Rica: Heredia Province AY508535 AY509061
Erichthodes erichtho (Butler) Peru: Madre de Dı́os Province AY508537 AY509063
Euptychia picea Butler Ecuador: Napo Province AY508542 AY509068
Euptychia westwoodi Butler Costa Rica: Heredia Province AY508543 AY509069
Euptychia sp. Ecuador: Pichincha Province AY508541 AY509067
Euptychoides albofasciataa (Hewitson) Ecuador: Sucumbios Province AY508540 AY509066
Euptychoides nossis (Hewitson) Ecuador: Pichincha Province AY508539 AY509065
Euptychoides eugenia (C Felder and R Felder) Ecuador: Pichincha Province AY508538 AY509064
Forsterinaria boliviana (Godman) Ecuador: Pichincha Province AY508545 AY509071
Forsterinaria inornata (C Felder and R Felder) Ecuador: Pichincha Province AY508544 AY509070
Harjesia sp. Ecuador: Napo Province AY508546 AY509072
Hermeuptychia harmonia (Butler) Ecuador: Pichincha Province AY508549 AY509075
Hermeuptychia hermes (Fabricius) Costa Rica: Puntarenas Province AY508548 AY509074
Hermeuptychia sosybius (Fabricius) USA: Louisiana AY508547 AY509073
Magneuptychia alcinoe (C Felder and R Felder) Ecuador: Pichincha Province AY508551 AY509077
Magneuptychia fugitiva Lamas 1997 Peru: Madre de Dı́os Province AY508552 AY509078
Magneuptychia nr lea Peru: Madre de Dı́os Province AY508554 AY509080
Magneuptychia moderata (Weymer) Ecuador: Napo Province AY508553 AY509079
Magneuptychia tiessa (Hewitson) Ecuador: Pichincha Province AY508557 AY509083
Magneuptychia sp. Ecuador: Napo Province AY508555 AY509081
Megeuptychia antonoe (Cramer) Ecuador: Napo Province AY508559 AY509085
Megisto cymela (Cramer) USA: Louisiana AY508558 AY509084
Neonympha areolata (J.E. Smith) USA: Louisiana AY508564 AY509090
Oressinoma sorata Salvin and Godman Ecuador: Pichincha Province AY508561 AY509087
Paramacera allyni L.D. Miller USA: Arizona AY508565 AY509091
Parataygetis lineata (Godman and Salvini) Ecuador: Pichincha Province AY508569 AY509095
Pareuptychia hesionides Forster Ecuador: Napo Province AY508567 AY509093
(continued on next page)
70 D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

Table 1 (continued)
Tribe (Subtribe) species Collecting locality COI EF-1a
Pareuptychia metaleuca (Boisduval) Ecuador: Pichincha Province AY508566 AY509092
Pareuptychia ocirrhoe (Fabricius) Ecuador: Napo Province AY508568 AY509094
Pindis squamistrigaa R Felder Mexico: Guanajuato AY508570 AY509096
Posttaygetis penelea (Cramer) Ecuador: Napo Province AY508571 AY509097
Pseudodebis marpessa (Hewitson) Peru: Madre de Dı́os Province AY508573 AY509099
Pseudodebis valentina (Cramer) Ecuador: Napo Province AY508574 AY509100
Satyrotaygetis satyrina (H.W. Bates) Costa Rica: Puntarenas Province AY508575 AY509101
Splendeuptychia ashna (Hewitson) Peru: Madre de Dı́os Province AY508576 AY509102
Splendeuptychia itonis (Hewitson) Ecuador: Napo Province AY508577
Taygetis celia (Cramer) Ecuador: Pichincha Province AY508572 AY509098
Taygetis laches (Fabricius) Ecuador: Napo Province AY508581 AY509106
Taygetis puritana (A.G. Weeks) Ecuador: Pichincha Province AY508578 AY509103
Taygetis sosis Hopffer Ecuador: Napo Province AY508580 AY509105
Taygetis virgilia (Cramer) Belize: Orange Walk District AY508579 AY509104
Yphthimoides erigone (Butler) Ecuador: Napo Province AY508583 AY509108
Yphthimoides renata (Stoll) Belize: Orange Walk District AY508582 AY509107
Vouchers held by primary author except where noted.
a
Vouchers at Oregon State Arthropod Collection.
b
From Monteiro and Pierce (2001) data matrix submitted to TreeBase.

DNeasy Tissue Kit (QIAGEN, Valencia, CA) from For three samples extracted from dried specimens,
either the thorax or the anterior abdomen. The remain- recovered DNA material was low and sequences could
ing body and wings were kept as voucher material. For a not be obtained from the nuclear gene EF-1a. Samples
few butterflies where no fresh material was available, were retained in the partitioned COI analyses and coded
DNA was extracted from dried specimens. as missing data for combined analyses.
Two genes were selected, a mitochondrial gene, cyto-
chrome oxidase I (COI) and a nuclear gene, elongation 2.3. Phylogenetic analyses
factor-1a (EF-1a). Both have been used extensively in
insect molecular systematics (Caterino et al., 2000; Si- Data were analyzed using three approaches, maxi-
mon et al., 1994). COI was amplified using olgionucleo- mum parsimony (MP), maximum likelihood (ML),
tide primers as published in Simon et al. (1994) (forward and Bayesian inference. Parsimony analyses were per-
Ron = CI-J-1751, reverse Nancy = CI-N-2191; forward formed in PAUP* 4.0b10 (Swofford, 2002) using heuris-
Jerry = CI-J-2183) with the exception of Pat2 (reverse tic searches with tree-bisection-reconnection (TBR)
50 TCCATTACATATAATCTGCCATATTAG). EF- branch swapping and 1000 random-addition sequence
1a primers were taken from Cho et al. (1995) (M3, replicates with 10 trees held at each step. Initially data
rcM51-1, M46-1, rcM4). Reactions contained 2.5 U sets were not weighted, but preliminary results and pre-
Taq DNA polymerase, 1.5 mM MgCl2, 200 lM dNTP, vious studies have shown potential problems with COI,
0.5 lM of each primer, and 1–5 ll of template DNA. including saturation and rate heterogeneity. Potential
Thermal conditions were 1 min denaturing at 95 °C, saturation in the data set was assessed visually, plotting
1 min annealing at 45 °C, and 1.5 min extension at transitions and transversions for each codon position
72 °C for 26 cycles, with a 5 min final extension at against genetic distance. When rates curves suggested
72 °C. Samples were purified using QIAGEN PCR Puri- saturation at the third codon position for COI, MP
fication kit (QIAGEN, Valencia, CA). searches were conducted with these sites removed and,
Cleaned products were cycle-sequenced using floures- as suggested by previous authors (Barker and Lanyon,
cent dye-labeled terminators (ABI Big Dye Terminator 2000; Griffiths, 1997; Reeder, 1995), with differentially
Cycle Sequencing Kit, Applied Biosystems, Perkin–El- weighted transitions with respect to transversions (ti:tv),
mer) and then run on an ABI 377 sequencer. Amplifica- here weighted as 1:2 and 1:3. Differing rates of nucleo-
tion profile was 96 °C for 15 s, 50 °C for 20 s, and 60 °C tide substitution among the two genes and codon posi-
for 4 min, cycled 25 times. The resulting samples were tion were also explored using ML.
cleaned using recommended manufacturing protocol Prior to maximum likelihood analyses, best-fit mod-
for ethanol precipitation. Samples were sequenced in els of nucleotide substitution were selected with likeli-
both directions to minimize base calling errors and hood ratio tests as implemented by Modeltest (version
ambiguities. Aligning and editing of sequences were per- 3.06) (Posada and Crandall, 1998). Models of evolution
formed in SeqEd 1.0.3 (Applied Biosystems 1992). and parameters were estimated for data partitioned by
BLAST searches were conducted on all sequences to gene and also combined. For each likelihood ratio test,
check for possible contamination. Modeltest selected the general time reversible model
D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80 71

with variable sites assumed to follow a discrete gamma (resampling estimated log-likelihood) method and 1000
distribution and some sites assumed to be invariable bootstrap replicates.
(GTR + I + C) (Yang, 1994). ML searches were imple-
mented in PAUP* using model parameters and the
TBR branch swapping. 3. Results
Bayesian analyses were conducted in MrBayes (Huel-
senbeck and Ronquist, 2001) under the GTR + I + C 3.1. Molecular characterization
model, using four Markov Chain Monte Carlo
(MCMC) chains, three heated and one cold, and a ran- A 1291 bp fragment of COI and a 1263 bp fragment
dom starting tree. Parameter values were not specified of EF-1a were sequenced, with 25 ambiguous sites from
but estimated as part of the analyses. To assess coverage the fragment ends excluded from the data set. Base pair
of tree space, duplicate analyses continued for either composition of COI showed a strong AT bias (71%),
100,000 or 1 million generations, with trees sampled typical for insect mitochondrial DNA (Clary and Wol-
every 10 generations. Log likelihoods were viewed stenholme, 1985; Crozier and Crozier, 1993). Significant
graphically, and all trees before stationary were dis- base composition heterogeneity was found only at the
carded as burn-in. If the resulting consensus trees from third codon position of COI. Relative rates of nucleotide
duplicate analyses were in agreement, no more runs were substitution were greater for COI than EF-1a (Table 2),
initiated. and more than two times faster at the third codon posi-
Bootstrap support values and posterior probabilities tion. Second codon position nucleotides of EF-1a
were used to assess the robustness of the findings. Boot- showed the slowest rate of substitution and had fewer
strap values were computed from 1000 pseudoreplicates informative sites than any other position for either gene.
randomized 10 times with TBR addition sequence. Due Overall average mean sequence divergence among in-
to computational time, calculations of bootstrap values group taxa for COI was 8.9% (excluding paraphyletic
under the maximum likelihood criterion were conducted taxa), with intrageneric divergences of monophyletic
with ‘‘fast’’ heuristic searches replicated 100 times. With genera ranging from 0.05% to 7.2%. For EF-1a, se-
large replicates, fast bootstrapping produces similar re- quence divergences among the ingroup range from 3%
sults as full bootstrapping methods (DeBry and Olm- to 9% (excluding paraphyletic taxa) and 0.01–5% for
stead, 2000; Mort et al., 2000). intrageneric comparisons (monophyletic genera only).
Dataset congruence between gene partitions was
tested using the partition homogeneity test (Swofford, 3.2. Combined analyses
2002), also referred to as the incongruence length differ-
ence (ILD) test (Farris et al., 1994) as implemented in An ILD test of the two genes failed to reject the null
PAUP*. Several recent papers have pointed out prob- hypothesis of homogeneity (P = 0.30). In a combined
lems with this test (Cunningham, 1997; Dowton and gene data set, the subtribe Euptychiina was not found
Austin, 2002), but it can be a useful measure of incon- to be monophyletic (Figs. 1 and 2). Euptychia species
gruence for data sets of equal size, as they are in this and Oressinoma sorata were excluded from the ingroup,
study. strongly supported in Bayesian analysis (Table 3). The
The Shimodairan Hasegawa test statistic (Goldman unweighted MP analysis resulted in a soft polytomy at
et al., 2000; Shimodaria and Hasegawa, 1999) was used the basal ingroup node. When weighting schemes were
to compare alternative phylogenetic hypotheses. For implemented, this was resolved to paraphyly of Eupty-
each analysis all topologies obtained were compared chiina with both genera basal to the remaining ingroup
simultaneously to statistically test whether or not they and nodal support of 99%. When euptychiine mono-
were significantly worse than the optimal ML tree. phyly was constrained, the unweighted MP tree length
The SH tests were conducted in PAUP* using the RELL increased by only eight steps (TL = 6581, CI = 0.243,

Table 2
Base composition and variable sites by codon position
Gene Position A C G T v2 P Informative sites % CI Relative rate
COI First 0.297 0.158 0.228 0.317 22.396 1.000 100 23.6 0.294 0.559
Second 0.191 0.241 0.147 0.422 5.832 1.000 27 6.38 0.463 0.092
Third 0.395 0.074 0.010 0.521 527.724 0.000 352 83.21 0.184 3.446
All 0.295 0.157 0.128 0.420 102.714 1.000 479 38.00 0.209 1.300
EF-1a First 0.247 0.305 0.175 0.273 76.351 1.000 22 5.30 0.470 0.134
Second 0.284 0.177 0.383 0.156 11.279 1.000 10 2.41 0.616 0.051
Third 0.173 0.357 0.192 0.277 147.123 0.996 317 76.39 0.293 1.698
All 0.259 0.263 0.245 0.233 56.451 1.000 349 28.01 0.314 0.700
72 D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

Fig. 1. Phylogram of the majority rule consensus tree of 8000 trees after burn-in from a 100,000 step MCMC simulation based on combined
COI + EF-1a data matrix. Bayesian posterior probabilities are given above nodes. Values below nodes are posterior probabilities when taxa with
missing data are removed from analysis. Outgroup taxa shown in bold. Dark bar marks putative ingroup. Exemplars marked with (*) are
paraphyletic taxa. Shaded boxes mark clades.

RI = 0.383). However, this topology and the MP tree species remained paraphyletic with respect to the in-
were significantly worse explanations of the data than group. Distant outgroups, then, did not appear to influ-
the others (diff ln L = 42.48, P < 0.016; diff ln ence erroneous pairings, but instead added phylogenetic
L = 92.42, P 6 0.000 respectively). signal to the overall results, and in particular to the ba-
Although the non-monophyly of Euptychiina was a sal groups.
consistent result, relationships among outgroups, the ex- Eight of the 14 euptychiine genera represented by
cluded euptychiine genera, and among the most basal more than one species were polyphyletic or paraphyletic
members of the ingroup remained poorly resolved. Be- in all analyses of the combined data set (Table 4). Six
cause distant outgroups could be affected by long species were included from a particularly large genus,
branch attraction (Felsenstein, 1978; Smith, 1994), Magneuptychia, and none formed a monophyletic group
resulting in erroneous groupings, C. pireta, H. piera, with any other member. Similar evidence for artificial
M. leda, E. portlandia, and L. mekara were sequentially groupings was found for the genera Cissia and Eupty-
removed and the data set re-analyzed. Results showed choides. Five euptychiine genera were well supported
reduced resolution among basal taxa and to a lesser ex- as monophyletic in all analyses (Table 4). The one area
tent, among the ingroup taxa, but did not change the of incongruence revolved around Caeruleuptychia,
respective topologies and both O. sorata and Euptychia weakly suggested as monophyletic in MP and ML anal-
D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80 73

Fig. 2. Strict consensus of four most parsimonious trees (tree length = 6573, CI = 0.243, RI = 0.383) based on COI + EF-1a data matrix and
unweighted analysis. Bootstrap values above 50% shown on nodes. Dark bar marks putative ingroup clade. Outgroups shown in bold. Exemplars
marked with (*) are paraphyletic taxa. Shaded boxes mark clades.

Table 3
Paraphyletic taxa by partition and analysis
Taxa COI COI COI EF-1a EF-1a EF-1a Combine Combine Combine
MP ML Bayes MP ML Bayes MP ML Bayes
Oressinoma sorataa 26 19 60 71 31 91 99c 35 92
Euptychia species 31 29 100 71 31 91 99c 35 92
Paramacera allynia 26 0b 67
Cyllopsis species 26
Cissia penelopea 0b 0b 60
Bootstrap and posterior probabilities percentages given for node with highest value that supports the exclusion of the taxon from the ingroup.
a
Tested with more than one individual.
b
Not found paraphyletic in bootstrap consensus tree.
c
From weighted analysis.

yses. Because the disagreement in gene topologies could Removal of the taxa did not resolve the question of
have been affected by missing data for Caeruleuptychia Caeruleuptychia monophyly, but did affect results under
umbrosa, this taxon and the other two taxa with missing the Bayesian method. Posterior probabilities were
data for EF-1a were removed and the data re-analyzed. slightly higher for many nodes, suggesting that the miss-
74 D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

Table 4
Assessment of monophyly of euptychiine genera where more than one species of the genus is present in data set
Taxa COI MP COI ML COI Bayes EF-1a MP EF-1a ML EF-1a Bayes Combine MP Combine ML Combine Bayes
a
Caeruleuptychia 36 16 81 0 0 0 28 0 0
Chloreuptychia 0 0 0 0 0 0 0 0 0
Cissia 0 0 0 0 0 0 0 0 0
Cyllopsis 88 86 100 91 92 100 93 100 95
Euptychia 72 72 100 98 92 100 99 96 100
Euptychoides 0 0 0 0 0 0 0 0 0
Forsterinaria 100 100 100 100 100 100 100 100 100
Hermeuptychia 100 100 100 100 100 100 100 100 100
Magneuptychia 0 0 0 0 0 0 0 0 0
Pareuptychia 93 92 100 97 100 100 100 100 100
Pseudodebis 0 0 51 0 0 0 0 0 0
Splendeuptychia 0 0 0 ? ? ? 0 0 0
Taygetis 0 0 0 0 0 0 0 0 0
Yphthimoides 0 0 0 0 0 0 0 0 0
Bootstrap percentages or posterior probabilities presented for monophyletic genera. A ‘‘0’’ indicates no support for monophyly found (i.e., para-
phyletic or polyphyletic). Posterior probabilities given as percentages. A‘‘?’’ designates missing data.
a
Not found monophyletic in bootstrap consensus tree.

ing data contributed to some noise in the data set. Sig- neither weighted analyses nor removal of third codon
nificantly, basal nodes near where Splendeuptychia itonis position sites improved results.
was placed increased to 1.00PP (Fig. 1) and the node All analyses produced congruent well supported re-
separating Caeruleuptychia sp. + Caeruleuptychia umb- sults for the monophyletic euptychiine genera (Table
rosa from the remaining Cissia clade increased from 4) except for Caeruleuptychia, monophyletic in COI
0.78PP to 0.97PP. Topologies remained mostly un- but not EF-1a analyses, and Pseudodebis, weakly sug-
changed except the Chloreuptychia + Cepheuptychia gested as monophyletic only in COI Bayesian analysis.
group was found to be sister to the Pareuptychia clade, No analyses found any of the remaining seven tested
a result that was more consistent with morphology. euptychiine genera monophyletic.
Conversely, removal of the taxa had no affect on MP All analyses found the Taygetis, Pareuptychia, and
topologies or bootstrap values. Cissia clades monophyletic except again the COI parti-
Within the ingroup three large lineages were recov- tion under MP unweighted criteria. Differences were
ered, referred to as the ‘‘Cissia,’’ ‘‘Pareuptychia,’’ and confined to two exemplars, Yphthimoides renata and
‘‘Taygetis clades.’’ Clades contained identical members Euptychoides eugenia (Fig. 3). The placement of both
in all analyses and branching patterns were largely con- taxa was unique, especially Y. renata, typically found
gruent within the clades. The Taygetis clade was most near the base of the ingroup clustered with Megisto cym-
congruent and the Cissia clade most divergent, due to ela. Weighted trees produced a topology more consistent
the variable placement of Cissia terrestris and Caer- with ML and Bayesian analyses in this regard.
uleuptychia spp. Support for clades ranged from weak
(ML analyses) to strong (Bayesian, all 1.00 PP).
4. Discussion
3.3. Phylogenetic analysis based on individual genes
This study represents the first phylogenetic analysis of
Individual gene phylogenies were generally congruent the satyrine butterfly subtribe Euptychiina. Indeed, this
with respect to several findings. Euptychiina was recov- is the first significant contribution to understanding neo-
ered as polyphyletic, the majority of the euptychiine gen- tropical satyrine evolution, where two hyperdiverse sub-
era were not monophyletic, and the three named clades tribes, Pronophilina and Euptychiina, compose the
were monophyletic, with one exception discussed below majority of satyrine species. Both groups were hypothe-
(Figs. 3 and 4). Regions of notable conflict between the sized to have moved into South America from Paleotrop-
gene phylogenies revolved around genera excluded from ical origins as two independent radiations. Findings from
the ingroup, the monophyly of Caeruleuptychia and this study suggest a more complex evolutionary history
Pseudodebis, and the placement of Yphthimoides renata for the lowland satyrines than previously thought. Ram-
and Euptychoides eugenia. pant paraphyly and polyphyly among euptychiine genera
All single gene analyses, except EF-1a MP analysis, demonstrate the great need for a species level revision of
found other genera in addition to Euptychia species these butterflies. Diversification of the group is found in
and O. sorata excluded from the ingroup (Table 3). three main lineages and these clades can serve as the basis
COI MP analysis was most incongruent (Fig. 3), and for future systematic inquiry.
D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80 75

Fig. 3. Strict consensus of 25 most parsimonious trees (tree length = 4309, CI = 0.209, RI = 0.334) based on COI data matrix. Results incongruent
with respect to all other analyses. Bootstrap values above 50% shown on nodes. Dark bar marks putative ingroup clade. Outgroups shown in bold.
Taxa marked with (*) paraphyletic. Shaded boxes illustrate clades.

4.1. Monophyly of Euptychiina exclusion of the nominant genus, Euptychia, with high
posterior probabilities found in all analyses. In evaluat-
A monophyletic Euptychiina was not recovered un- ing the results, Bayesian posterior probabilities were
der any optimality criteria, data partition, or weighting viewed with caution as the possibility of overinflated
scheme. Moreover, a constrained monophyletic Eupty- values has been suggested in the literature (Alfaro
chiina was a significantly worse explanation of the et al., 2003; Douady et al., 2003). However, combined
data. However, evidence for evolutionary relationships weighted parsimony (99%) also strongly supported
among basal taxa was weak, and topologies were char- these results. The Euptychia clade was typically found
acterized by short internodes with little branch sup- with only the distant outgroups the Haeterini and M.
port. The difficulty lies in resolving relationships of leda as more basal and are as distant from the ingroup
the euptychiine genera not found as members of the in- (12%) as they are from the outgroups (12–13%), sug-
group, but with unknown relationships to other saty- gesting that Euptychia diverged early in satyrine evolu-
rines. Increased outgroup sampling was included in tion. Oressinoma sorata was also consistently basal to
an effort to break up long branches among these taxa, the ingroup, with more support for this result provided
but this did not greatly increase basal phylogenetic res- by the EF-1a data. Oressinoma is a small genus com-
olution. Nonetheless, the data suggest Oressinoma and posed of two closely related species and is morpholog-
Euptychia do not share a common ancestor with the ically distinct from other euptychiines, and neotropical
remaining subtribe. Strongest support comes from the satyrines in general, by having swollen medial and sub-
76 D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

Fig. 4. Phylogram of the majority rule consensus tree of 8000 trees after burn-in from a 100,000 step MCMC simulation based on EF-1a data matrix.
Bayesian posterior probabilities are given above nodes. Outgroup taxa shown in bold. Dark bar marks putative ingroup. Paraphyletic taxa marked
with a (*). Shaded boxes illustrate clades.

medial but not costal veins on the forewing (Miller, of a more derived clade containing other Satyrini sub-
1968; DeVries, 1987). Results from Murray (2001a) tribes (0.99PP). Brower (2000) found similar results in
suggested long-branch attraction between C. penelope weighted parsimony analysis.
and O. sorata in the COI data set, and problematic Correct resolution of the basal nodes may depend on
placement of C. penelope is seen here as well, where the addition of critical southern taxa. In a morphologi-
it clusters with either pronophiline outgroups or with cal analysis containing partial characters for representa-
other euptychiine genera, including Oressinoma, within tives of several large Brazilian genera, Parythimoides,
a clade containing outgroups. Previous work has also Moneuptychia, and Pharneuptychia, the genera clustered
suggested that Oressinoma is not closely related to with other basal ingroup taxa (Murray, 2001a). In addi-
the euptychiines. Huelsenbeck et al. (2001) applied tion, Yphthimoides is a large genus with most species en-
Bayesian analysis to the data set of Brower (2000) demic to southern Brazil, as are most Pharneuptychia,
and found a polyphyletic Euptychiina. Although the Parythimoides, and Moneuptychia species. Therefore,
taxon sampling of euptychiines was low, Oressinoma an important biogeographical area is absent from this
clustered with another basal satyrine Tisiphone study, and these taxa are linked to the basal node of
(0.83PP), while the remaining euptychiines were part the subtribe where resolution is weakest.
D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80 77

4.2. Relationships within Euptychiina are sister to lowland groups, suggesting multiple inva-
sions into the more atypical higher altitude habitats.
With one exception, all analyses recovered three ma- The Cissia clade encompasses some of the more spec-
jor lineages containing identical members, labeled ‘‘Cis- iose Euptychiina genera. The clade is characterized by
sia,’’ Pareuptychia,’’ and ‘‘Taygetis clades.’’ Certain numerous short internodes and poor support for inter-
monophyletic groups were consistently recovered within nal branching, especially basal nodes, indicative most
these clades and were well supported with high posterior likely of rapid diversification within the clade and/or
probabilities and bootstrap values. However, little can the inadequate amount of sampling and genes to cor-
be surmised of the relationships among the clades them- rectly resolve relationships. The clade does not contain
selves. The Taygetis clade was most often basal to the any monophyletic genera except possibly Caeruleupty-
more derived Pareuptychia and Cissia clades, but inter- chia, where monophyly is not resolved by the results.
nodes were extremely short and poorly supported. All other genera have exemplars found outside the clade.
Branching patterns were most congruent within the Therefore, they may be only distantly related to other
Taygetis clade. All members of this clade were once in- members of their respective genera, an indication of
cluded within Taygetis until Forster (1964) split them the complex taxonomic problems within the group. Cis-
into several genera. Although many of his genera are sia is perhaps not the most apt name for this clade, given
artificial (i.e. Magneuptychia), at least some of the Tay- that the type species for the genus Cissia, C. penelope, is
getis clade genera appear valid based on morphological not a member of the clade, but until the genera are taxo-
data (Murray, 2003). However, placement of Taygetis nomically revised, the name will hold as many of the
celia and T. puritana within Pseudodebis renders the members of this clade are generally ‘‘Cissia-like.’’ Singer
genus paraphyletic. Both Taygetis and Pseudodebis are et al. (1983) recognized several sub-groups within Cissia
morphologically similar, supported by only a few syna- based on larval data. Although they did not discuss
pomorphies (Murray, 2001b), but molecular results sug- whether or not the genus was monophyletic, they sepa-
gest two distinct clades. Genetic distance between the rated C. penelope from other Cissia species, results cor-
two clades is on average 6.3% and within the two clades roborated here. The robustly supported C.
4.6 and 3.8%. Although Miller correctly surmised that confusa + Cissia sp. + C. myncea + M. fugitiva clade
neither T. celia nor T. puritana belong within Taygetis corresponds to one of their other sub-groups. C. pseudo-
(Miller personal communication), his proposed new confusa also falls within this clade (data not shown).
genus for these two species would still leave Pseudodebis As mentioned, basal relationships within the ingroup
paraphyletic by these results. One other genus formerly are unclear, but there are a few well supported clades.
within Taygetis, Satyrotaygetis, is clearly not related to Cyllopsis + Paramacera is consistently well supported
the remaining group, and at least the nominant species and placed most often as sister to the remaining in-
is closely related to Magneuptychia tiessa, which appears group. M. cymela is often sister to Y. renata + C. penel-
to be its South American replacement. ope, but support for this is much weaker.
The namesake of the Pareuptychia clade, Pareupty- Hermeuptychia, a well supported monophyletic genus,
chia, is consistently well supported as monophyletic. is also often basal within the ingroup, sister to the rest
Addition of other species within the genus also results of the ingroup or sister to the Taygetis clade. However,
in a robustly supported clade (data not shown). This support is lacking and placement is not consistent.
genus is united morphologically by atypical black egg Placement of other non-clade members is even more var-
coloration, not known from any other satyrine group iable. These include species of Chloreuptychia, Ceph-
or perhaps any butterfly species. The eggs are actually euptychia, Magneuptychia, and Splendeuptychia.
translucent white as most euptychiine eggs, but darken Splendeuptychia itonis is often linked with Pindis
to opaque black within 24 h and become indistinguish- squamistriga, a surprising result morphologically, but
able from parasitized euptychiine eggs (Murray, this relationship is not supported. However, S. itonis is
2001a). Support for other branching patterns within clearly not closely related to S. ashna, a result supported
the Pareuptychia clade is weaker, with the exception of by morphological evidence (Murray, 2001a). Splen-
S. satyrina + M. tiessa. One surprising result was the deuptychia is the most speciose Euptychiina genus, with
polyphyly of the Euptychoides, a genus composed of an estimated 50 species (Lamas, unpublished), and ap-
10 species which are superficially similar and one of pears composed of two disparate groups, represented
the few groups which have invaded the Andean cloud here by S. itonis and S. ashna. Splendeuptychia ashna
forests. When preliminary results suggested non-mono- is well supported as a member of the Cissia clade, but
phyly of the original two species, a third member was in- the placement of S. itonis is uncertain. Although both
cluded, but this species failed to form a monophyletic are specialized feeders on bamboo, S. ashna is a detriti-
clade with either of the other species. E. albofasciata is vore on dead bamboo leaves on the forest floor (Mur-
most often sister to S. satyrina + M. tiessa, also found ray, 2001a). A detritivorous feeding habit is not
within cloud forests. However the remaining species known among other satyrine butterflies.
78 D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

4.3. Evolutionary history suggested to be the sister clade to the remaining ingroup.
Only Neonympha occupies a more derived placement in
Currently our knowledge of satyrine relationships is the phylogeny, clustered with other members of the
sketchy, and hypotheses on the evolutionary origins of Pareuptychia clade where species are neotropical in dis-
neotropical satyrines remain highly speculative (Viloria, tribution. Although extensive floral and faunal exchange
2003). Satyrines are thought to have originated in the from South America across the isthmus began after the
Neotropics during the Cretaceous (Miller, 1968), based Pliocene (Marshall, 1985; Stehi and Webb, 1985), eupty-
largely on the endemic distribution of the purported chiines likely had already diversified by this time.
ancestral satyrine tribe, Haeterini, in the neotropics Among these genera, secondary invasion of the Nearctic
and the neotropical distribution of close relatives the with the connection of the land bridge may have oc-
Brassolinae and Morphinae. Grasses, an important host curred only within Neonympha.
for satyrines, are also thought to have originated during The nominant genus, Euptychia, was found basal to
the Cretaceous period and then diversified in the early the ingroup. Robustly supported as monophyletic in this
Tertiary, 65–25 mya (Clark et al., 1995; Judziewicz study, the genus is also supported by larval synapomor-
et al., 1999). Although grasses may have played a vital phies and a highly unusual host (DeVries, 1987; Murray,
role in the subsequent diversification of satyrines, early 2001a; Singer et al., 1983). All known hosts for satyrines
groups such as the Haeterini utilize other monocots are monocots, except for Euptychia species and members
which arose earlier than grasses. Few satyrine fossils of a small Indo-Australian tribe, Ragadiini. The major-
are known, but the fossil record suggests that by the Oli- ity of hosts for these groups are members of Selaginell-
gocene, satyrines had become well established. The ear- aceae, with a few Euptychia species also recorded from
liest known satyrine, an undescribed species near the Bryopsida (mosses) (DeVries, 1985, 1987; Fukuda,
tribe Elyminiini, dates from the lower middle Eocene, 1983; Murray, 2001a; Singer et al., 1971; Singer and
48–51 mya (Durden and Rose, 1978). Satyrines from Mallet, 1985). Lycopsida is an archaic plant order dom-
the subtribe Lethina are well represented in eastern Eur- inant from the late Devonian to late Carboniferous peri-
ope from the upper Oligocene (Nel et al., 1993). How- ods and represented today primarily by Selaginella.
ever, lacking a phylogenetic analysis of the subfamily Although many insect orders were present during the
and resolution of satyrine monophyly, a neotropical ori- Carboniferous period and some are thought to have
gin for the group cannot be evaluated. fed on lycopsids (Kukalová-Peck, 1991), few species
What are the likely origins for euptychiine butter- are recorded on them today (Mound et al., 1994). Saty-
flies? Miller (1968) hypothesized that the group colo- rines are the only Lepidoptera recorded using Selagi-
nized the neotropics from distant relatives in the nella as larval food plants.
Paleotropics, or more specifically, from the earliest Miller (1968) pointed out several distinctive features
Ypthimina butterflies. Support for a sister relationship of ragadiines that ‘‘set them apart’’ from other satyrines,
of the euptychiines and ypthimines was not found in but was unsure of their systematic placement, believing
this study, although sampling among satyrines other the group was intermediate between more ancestral
than the focal group was sparse. Surprisingly, pronophi- satyrines, the Elymniini, and the Satyrini, and felt that
lines were suggested as sister to the remaining ingroup, Euptychiina (including Euptychia) was only distantly re-
although results were complicated by inconsistent place- lated to Ragadiini. Considering that the data suggest
ment of paraphyletic taxa, i.e., P. allyni + pronophi- Euptychia is only distantly related to the remaining sub-
lines. A close relationship between euptychiines and tribe, the intriguing hypothesis can be proposed of a
pronophilines has not been given consideration in the close relationship between the euptychiines and the rag-
literature and is not supported by morphology (Miller, adiines based on novel host use. There is some support
1968; Viloria, 2003). Most likely this sister relationship for this from larval morphology. Satyrines worldwide
is an artifact of inadequate sampling. However, both are conserved not only in gross morphology, but also
Brower (2000) and Huelsenbeck et al. (2001) in a re- in mouthparts and setal arrangements (Garcı́a-Barros,
analysis of BrowerÕs data, found a euptychiine + pron- 1987; Murray, 2001a,b, 2003; Sourakov, 1996), there-
ophiline clade. fore the presence of large tubercles on the dorsum in
The data do suggest an interesting pattern among the both Euptychia and Ragadia species is striking. Other
more ancestral members of the ingroup. Basal taxa are shared traits include the extremely large stemma 3 and
overwhelmingly Nearctic in distribution. The Nearctic the shape of the adfrontal suture and mandibles. How-
euptychiine genera are represented by Neonympha, Meg- ever, these similarities could be explained by conver-
isto, Paramacera, Pindis, Cyllopsis, and Hermeuptychia. gences associated with a unique diet and not due to
The latter two speciose genera have broad distributions common ancestry. A close relationship of the ragadiines
into Central and South America, but the majority of and Euptychia species would involve a more complex
Cyllopsis species are found in northern Central America. biogeographical scenario to the colonization of the trop-
In the combined analyses, Cyllopsis + Paramacera are ical Americas than is currently hypothesized, and this
D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80 79

pattern may represent a deep gondwanian relationship. Clark, L.G., Zhang, W., Wendel, J.F., 1995. A phylogeny of the grass
However, a better understanding of the biogeographical family (Poaceae) based on ndnF sequence data. Systematic Botany
20, 436–460.
history of Euptychia must await a comprehensive study Clary, D.O., Wolstenholme, D.R., 1985. The mitochondrial DNA
of higher level satyrine relationships. molecule of Drosophila yakuba: Nucleotide sequence, gene organi-
zation, and genetic code. Journal of Molecular Evolution 22, 252–
271.
Acknowledgments Crozier, R.H., Crozier, Y.C., 1993. The mitochondrial genome of the
honeybee Apis mellifera: Complete sequence and genome organi-
zation. Genetics 133, 97–117.
We appreciate the assistance and support from Cunningham, C.W., 1997. Can three incongruence tests predict when
numerous colleagues. We thank Chris Carlton, Fred data should be combined?. Molecular Biology and Evolution 14,
Sheldon, and Andy Brower for comments on an earlier 733–740.
draft of the manuscript. The Organization of Tropical DeBry, R.W., Olmstead, R.G., 2000. A simulation study of reduced
Studies, Rı́o Bravo Research Station, Yasuni Biological tree-search effort in bootstrap resampling analysis. Systematic
Biology 49, 171–179.
Station, and Maquipucuna Research Station provided de Jong, R., Vane-Wright, R.I., Ackery, P.R., 1996. The higher
excellent support during field collecting trips. We thank classification of butterflies (Lepidoptera): problems and prospects.
Lee Miller and Gerardo Lamas for useful discussion on Entomologica Scandinavica 27, 65–101.
satyrine taxonomy and evolution. This project was sup- DeVries, P.J., 1985. Hostplant records and natural history notes on
ported by funds from the Department of Entomology at Costa Rican butterflies (Papilionidae, Pieridae & Nymphalidae).
Journal of Research on the Lepidoptera 24, 290–333.
Louisiana State University, the Rice Endowment at DeVries, P.J., 1987. The butterflies of Costa Rica and their natural
Oregon State University, the Organization for Tropical history, vol. I: Papilionidae, Pieridae, and Nymphalidae. Princeton
Studies, American Women in Science, Sigma Xi, and University Press, Princeton.
the US Peace Corps. Many people also provided DNA DeVries, P.J., Kitching, I.J., Vane-Wright, R.I., 1985. The systematic
material and we are grateful to Jim Tuttle, Dan Lang, position of Antirrhea and Caerois, with comments on the classi-
fication of the Nymphalidae (Lepidoptera). Systematic Entomol-
Andy Brower, Susan Pell, Chris Carlton and Victoria ogy 10, 11–32.
Moseley. Murray also greatly appreciates the generosity Douady, C.J., Delsuc, F., Boucher, Y., Doolittle, W.F., Douzery, E.,
of André Freitas for allowing her to examine his collec- 2003. Comparison of Bayesian and maximum likelihood bootstrap
tion of larvae. measures of phylogenetic reliability. Molecular Biology and Evo-
lution 20, 248–254.
Dowton, M., Austin, A.D., 2002. Increased congruence does not
necessarily indicate increased phylogenetic accuracy. The behavior
References of the incongruence length difference test in mixed-model analyses.
Systematic Biology 51, 19–31.
Ackery, P.R., 1984. Systematic and faunistic studies on butterflies. In: Durden, C.J., Rose, H., 1978. Butterflies from the Middle Eocene: the
Vane-Wright, R.I., Ackery, P.R. (Eds.), The Biology of Butterflies. earliest occurrence of fossil Papilionoidea. Pierce-Sellards Series of
Princeton University Press, Princeton, pp. 9–21. the Texas Memorial Museum 29, 1–25.
Ackery, P.R., 1988. Hostplants and classification: a review of Ehrlich, P.R., 1958. The comparative morphology, phylogeny and
nymphalid butterflies. Biological Journal of the Linnean Society higher classification of the butterflies (Lepidoptera: Papilionoidea).
33, 95–203. University of Kansas Science Bulletin 39, 307–370.
Ackery, P.R., de Jong, R., Vane-Wright, R.I., 1999. The butterflies: Emmel, T.C., Austin, G.T., 1990. The tropical rain forest butterfly
Hedyloidea, Hesperioidea and Papilionoidea. Handbook of Zool- fauna of Rondonia, Brazil: Species diversity and conservation.
ogy 4, 263–300. Tropical Lepidoptera 1, 1–12.
Alfaro, M.E., Zoller, S., Lutzoni, F., 2003. Bayes or bootstrap? A Farris, J.S., Källersjö, M., Kluge, A.G., Bult, C., 1994. Testing
Simulation study comparing the performance of Bayesian Markov significance of incongruence. Cladistics 10, 315–320.
Chain Monte Carlo sampling and bootstrapping in assessing Felsenstein, J., 1978. Cases in which parsimony or compatibility
phylogenetic confidence. Molecular Biology and Evolution 20, methods will be positively misleading. Systematic Zoology 27, 401–
255–266. 410.
Barker, F.K., Lanyon, S.M., 2000. The impact of parsimony weighting Forster, V.W., 1964. Beiträge zur Kenntnis der Insektenfauna Boliv-
schemes on inferred relationships among toucans and neotropical iens XIX. Veröffentlichungen der Zoologischen Staatssammlung,
barbets (Aves: Piciformes). Molecular Phylogenetics and Evolution München 8, 51–188.
15, 215–234. Fukuda, H., 1983. Life histories of two satyrid butterflies feeding on
Brower, A.V.Z., 2000. Phylogenetic relationships among the Nymp- selaginellas. Tyô to Ga 33, 132–144.
halidae (Lepidoptera) inferred from partial sequences of the Garcı́a-Barros, E., 1987. Morphology and chaetotaxy of the first
wingless gene. Proceedings of the Royal Society of London, Series larvae of six species of the Satyrus series (Lepidoptera: Nymphal-
B 267, 1201–1211. idae). Systematic Entomology 12, 332–344.
Caterino, M.S., Cho, S., Sperling, F.A.H., 2000. The current state of Garcı́a-Barros, E., Martı́n, J., 1991. Immature stages of Hipparchia
insect molecular systematics: A thriving tower of babel. Annual Fabricius and the systematics of the ÔSatyrus seriesÕ (Lepidoptera:
Review of Entomology 45, 1–54. Nymphalidae: Satyrinae). Systematic Entomology 16, 407–426.
Cho, S., Mitchell, A., Regier, J.C., Mitter, C., Poole, R.W., Goldman, N., Anderson, J., Rodrigo, A., 2000. Likelihood-based tests
Friedlander, T.P., Zhao, S., 1995. A highly conserved nuclear gene of topologies in phylogenetics. Systematic Biology 49, 652–670.
for low-level phylogenetics: elongation factor-1a recovers mor- Griffiths, C.S., 1997. Correlation of functional domains and rates of
phology-based tree for Heliothine moths. Molecular Biology and nucleotide substitution in cytochrome b. Molecular Phylogenetics
Evolution 12, 650–656. and Evolution 7, 352–365.
80 D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

Harvey, D.J., 1991. Higher classification of the Nymphalidae. In: Murray, D.L., 2003. Immature stages and biology of Posttaygetis
Nijhout, H.F. (Ed.), The Development and Evolution of Butterfly penelea Cramer (Lepidoptera: Nymphalidae: Satyrinae). Proceed-
Wing Patterns. Smithsonian Institution Press, Washington DC, pp. ings of the Entomological Society of Washington 105, 548–554.
259–274. Nel, A., Nel, J., Balme, C., 1993. Un nouveau Lepidoptere Satyrinae
Huelsenbeck, J.P., Ronquist, F., 2001. MrBayes: Bayesian inference of fossile de lÕOligocene du Sud-Est de la France (Insecta, Lepidoptera,
phylogenetic trees. Bioinformatics 17, 754–755. Nymphalidae). Linneana Belgica 14, 20–36.
Huelsenbeck, J.P., Ronquist, F., Nielsen, R., 2001. Bayesian inference Posada, D., Crandall, K.A., 1998. Modeltest: Testing the model of
of phylogeny and its impact on evolutionary biology. Science 294, DNA substitution. Bioinformatics 14, 271–275.
2310–2314. Reeder, T.W., 1995. Phylogenetic relationships among Phrynosomatid
Judziewicz, E.J., Clark, L.G., Londoño, X., Stern, P., 1999. American lizards as inferred from mitochondrial ribosomal DNA sequences:
Bamboos. Smithsonian Institution Press, Washington D.C. Substitutional bias and information content of transitions relative
Kristensen, N.P., 1976. Remarks on the family-level phylogeny of to transversions. Molecular Phylogenetics and Evolution 4, 203–
butterflies. Zeitschrift fuer Zoologische Systematic und Evolu- 222.
tionsforschung 14, 25–33. Shimodaria, H., Hasegawa, M., 1999. Multiple comparisons of log-
Kukalová-Peck, J., 1991. Fossil history and the evolution of hexapod likelihoods with applications to phylogenetic inference. Molecular
structures. In: The Insects of Australia. Melbourne University Biology and Evolution 13, 964–969.
Press, Melbourne, pp. 141–179. Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., Flook, P.,
Marshall, L.G., 1985. Geochronology and land-mammal biochronol- 1994. Evolution, weighting, and phylogenetic utility of mitochon-
ogy of the trans-American faunal interchange. In: Stehli, F.G., drial gene sequences and a compilation of conserved polymerase
Webb, S.D. (Eds.), The Great American Biotic Interchange. chain reaction primers. Annals of the Entomological Society of
Plenum Press, New York, pp. 49–85. America 87, 651–701.
Martı́n, J.F., Gilles, A., Descimon, H., 2000. Molecular phylogeny and Singer, M.C., Mallet, J., 1985. Moss-feeding by a Satyrinae butterfly.
evolutionary patterns of the European satyrids (Lepidoptera: Journal of Research on the Lepidoptera 24, 392.
Satyridae) as revealed by mitochondrial gene sequences. Molecular Singer, M.C., Ehrlich, P.R., Gilbert, L.E., 1971. Butterfly feeding on
Phylogenetics and Evolution 15, 70–82. lycopsid. Science 172, 1341–1342.
Miller, L.D., 1968. The higher classification, phylogeny and zoogeog- Singer, M.C., DeVries, P.J., Ehrlich, P.R., 1983. The Cissia confusa
raphy of the Satyridae (Lepidoptera). Memoirs of the American species-group in Costa Rica and Trinidad (Lepidoptera: Satyrinae).
Entomological Society 24, 1–174. Zoological Journal of the Linnean Society 79, 101–119.
Miller, L.D., 1972. Revision of the Euptychiini (Satyridae): 1. Smith, A.B., 1994. Rooting molecular trees: Problems and strategies.
Introduction and Paramacera Butler. Bulletin of the Allyn Biological Journal of the Linnean Society 51, 279–292.
Museum 8, 1–18. Sourakov, A., 1996. Notes on the genus Calisto with descriptions of
Miller, L.D., 1974. Revision of the Euptchiini (Satyridae): 2. Cyllopsis the immature stages (Part 1) (Lepidoptera: Nymphalidae: Satyri-
R. Felder. Bulletin of the Allyn Museum 20, 1–98. nae). Tropical Lepidoptera 7, 91–112.
Miller, L.D., 1976. Revision of the Euptychiini (Satyridae): 3. Megisto Stehi, F.G., Webb, S.D., 1985. A kaleidoscope of plates, faunal and
Hubner. Bulletin of the Allyn Museum 33, 1–23. floral dispersals, and sea level changes. In: Stehi, F.G., Webb, S.D.
Miller, L.D., 1978. Revision of the Euptychiini (Satyridae): 4. Pindis (Eds.), The Great American Biotic Interchange. Plenum Press, New
R. Felder. Bulletin of the Allyn Museum 50, 1–12. York, pp. 3–6.
Mort, M.E., Soltis, P.E., Soltis, D.E., Mabry, M.L., 2000. Comparison Swofford, D.L., 2002. PAUP* Phylogenetic analysis using parsimony
of three methods for estimating internal support on phylogenetic and other methods. Test version 4.0b5. Sinauer, Sunderland, MA.
trees. Systematic Biology 49, 160–171. Viloria, A., 2003. Historical biogeography and the origins of the
Mound, L.A., Martin, J.H., Polaszek, A., 1994. The insect fauna of satyrine butterflies of the tropical Andes (Lepidoptera: Rhopalo-
Selaginella (Pteridophyta: Lycopsida), with description of three cera). In: Morrone, J.J., Bousquets, J.L. (Eds.), Una Perspectiva
new species. Journal of Natural History 28, 1403–1415. Latinoamericana de la Biogeografı́a. Las Prensas de Ciencias,
Murray, D.L., 2001. Systematics of euptychiine butterflies (Nymphal- Facultad de Ciencias Mexico City, pp. 247–261.
idae: Satyrinae: Euptychiina) based on larval morphology and Wahlberg, N., Weingartner, E., Nylin, S., 2003. Towards a better
DNA sequence data and the evolution of life history traits. Ph.D. understanding of the higher systematics of Nymphalidae (Lepi-
dissertation, Louisiana State University, Baton Rouge, LA. doptera: Papilionoidea). Molecular Phylogenetics and Evolution
Murray, D.L., 2001b. Immature stages and biology of Taygetis 28, 473–484.
Hübner (Lepidoptera: Nymphalidae). Proceedings of the Entomo- Yang, Z., 1994. Estimating the pattern of nucleotide substitution.
logical Society of Washington 103, 932–945. Journal of Molecular Evolution 39, 105–111.