Arch Microbiol (2008) 189:27–41
DOI 10.1007/s00203-007-0290-1
ORIGINAL PAPER
Growth phase-associated changes in the transcriptome
and proteome of Streptococcus pyogenes
Michelle A. Chaussee Æ Alexander V. Dmitriev Æ
Eduardo A. Callegari Æ Michael S. Chaussee
Received: 3 May 2007 / Revised: 19 June 2007 / Accepted: 4 July 2007 / Published online: 31 July 2007

Springer-Verlag 2007
Abstract Streptococcus pyogenes is responsible for
approximately 500,000 deaths each year worldwide. Many
of the associated virulence factors are expressed in a
growth phase-dependent manner. To identify growth
phase-associated changes in expression on a genomescale,
the exponential and stationary phase transcriptomes and
proteomes of S. pyogenes strain NZ131 (serotype M49)
were compared by using Affymetrix NimbleExpress gene
chips and two-dimensional gel electrophoresis. At the
transcript level, the expression of 689 genes, representing
approximately 40% of the chromosome, differed by two-
fold or more between the two growth phases. The majority
of transcripts that were more abundant in the early-sta-
tionary phase encoded proteins involved in energy con-
version, transport, and metabolism. At the protein level, an
average of 527 and 403 protein spots were detected in the
exponential and stationary phases of growth, respectively.
Tandem mass spectrometry was used to identify 172 pro-
tein spots, 128 of which were growth phase regulated.
Communicated by Erko Stackebrandt.
Electronic supplementary material The online version of this
article (doi:10.1007/s00203-007-0290-1) contains supplementary
material, which is available to authorized users.
M. A. Chaussee
A. V. Dmitriev
E. A. Callegari

M. S. Chaussee (&)
Division of Basic Biomedical Sciences,
The Sanford School of Medicine of the University of South
Dakota, Lee Medical Building, 414 East Clark Street,
Vermillion, SD 57069-2390, USA
e-mail: mchausse@usd.edu
A. V. Dmitriev
Department of Molecular Microbiology,
Institute of Experimental Medicine, Saint-Petersburg, Russia
Enzymes involved in glycolysis and pyruvate metabolism
and several stress-responsive proteins were more abundant
in the stationary phase of growth. Overall, the results
identified growth phase-regulated genes in strain NZ131
and revealed significant post-transcriptional complexity
associated with pathogen adaptation to the stationary phase
of growth.
Keywords 2-DE
Proteomics
Transcriptome

Growth phase
Group A streptococcus
Bacterial
pathogenesis
Abbreviations
THY Todd-Hewitt yeast extract broth
2-DE Two-dimensional gel electrophoresis
Introduction
Streptococcus pyogenes is the cause of significant morbidity
and mortality worldwide. Colonization can result in
asymptomatic carriage or uncomplicated pharyngitis, as
well as life-threatening diseases such as streptococcal toxic
shock and necrotizing fasciitis. Each year, approximately
1.8 million people in the United States are diagnosed with
streptococcal pharyngitis, with an associated cost of over
$100 million (Neuner et al. 2003). Worldwide, nearly
700,000 people acquire an invasive infection, which has a
mortality rate as high as 50% (Davies et al. 1996; Carapetis
et al. 2005). Prompt treatment of pharyngitis is effective in
preventing post-infection autoimmune sequelae, such as
rheumatic fever and acute glomerulonephritis (Cunningham
2000). The importance of adequate medical care is reflected
in the observation that the incidence of these sequelae is
123
28
approximately 20 times higher in developing countries
(Carapetis et al. 2005). Overall, S. pyogenes causes
approximately half a million deaths each year worldwide
(Carapetis et al. 2005). Thus, the impact of S. pyogenes on
human health is significant, despite the fact that all isolates
are currently sensitive to b-lactam antibiotics.
During the initial stages of pharyngeal infection, S. py-
ogenes competes with normal flora for host cell receptors
and nutrients. To maintain colonization, the pathogen
presumably must use a variety of carbon sources and adapt
to the accumulation of metabolic endproducts. Such
adaptation is thought to require extensive changes in gene
expression. Many bacteria use secondary sigma factors to
alter gene expression in response to changes in the envi-
ronment. For example, the Bacillus subtilis genome en-
codes at least 17 sigma factors, including SigB, which is
involved in stationary-phase expression of a variety of
stress responsive genes (Helmann and Moran 2002). In
contrast, the genome of S. pyogenes encodes one alterna-
tive sigma factor known as SigX, which controls the
expression of competence-associated genes (Woodbury
et al. 2006). Thus in contrast to many bacterial pathogens,
S. pyogenes is thought to change growth phase-associated
patterns of gene expression by interactions among tran-
scriptional regulators (Kreikemeyer et al. 2003).
Batch culture is a convenient method to investigate
bacterial adaptation to the depletion of preferred carbon
and energy sources and the accumulation of metabolic
endproducts. The relevance of the model to pathogenesis is
supported by the finding that many virulence-associated
factors of S. pyogenes are expressed in a growth phase-
dependent manner (Kreikemeyer et al. 2003). When grown
with Todd-Hewitt media, S. pyogenes preferentially fer-
ments glucose and produces lactic acid as the primary
metabolic endproduct (Chaussee et al. 1997; Neijssel et al.
1997). The transition to the early-stationary phase of
growth is associated with the depletion of glucose and
acidification of the media to a pH of approximately 5.5
(Chaussee et al. 2003). Therefore, examining the tran-
scriptome of S. pyogenes at different growth phases may
provide insight into the adaptive responses of S. pyogenes
to nutrient limitation and the accumulation of metabolic
endproducts. Moreover, because such adaptation is likely
to involve both post-transcriptional and post-translational
mechanisms of regulation, it is also of interest to compare
the exponential and stationary phase proteomes.
In this study, Affymetrix NimbleExpess DNA micro-
arrays and two-dimensional gel electrophoresis (2-DE)
were used to compare the transcriptomes and proteomes of
S. pyogenes during the exponential and stationary phases of
growth. The results indicate that entry of strain NZ131 into
the stationary phase is associated with transcriptional, post-
transcriptional, and post-translational changes in the
123
Arch Microbiol (2008) 189:27–41
expression of genes associated with metabolism, stress
responses, and virulence.
Materials and methods
Culture conditions
Streptococcus pyogenes strain NZ131 (serotype M49) was
grown at 37C with 5% CO2 in 50 ml Todd-Hewitt broth
containing 0.2% (w/vol) yeast extract (THY; Difco Labo-
ratories, Detroit, MI, USA) without agitation until either
the mid-exponential (OD600 = 0.35; approximately 3.5 h of
incubation), early-stationary (OD600 = 0.7; approximately
6.5 h incubation), or stationary (OD600 = 0.7; approxi-
mately 18 h of incubation) phase of growth.
DNA microarray analysis
RNA was isolated with an RNeasy Mini Kit (QIAGEN,
Valencia, CA, USA) from 40 ml cultures, as previously
described (Dmitriev et al. 2006). The concentration and
quality of RNA was assessed with an Agilent 2100 Bio-
analyzer (Agilent, Palo Alto, CA, USA) using an RNA
6000 Nano LabChip Kit (Agilent). cDNA synthesis and
labeling was done as previously described (Dmitriev et al.
2006). Affymetrix NimbleExpress Arrays were purchased
from Affymetrix (Santa Clara, CA, USA). The array design
was based on the S. pyogenes strain SF370 genome se-
quence (Ferretti et al. 2001) and consisted of 2,543 quali-
fiers representing 1,694 predicted S. pyogenes ORFs and
804 intergenic region probes. In addition, 45 control oligos
were used for spike-ins. The GeneChips were hybridized
and washed with an automated Affymetrix GeneChip
Fluidics Station 450 (Dmitriev et al. 2006). The arrays
were scanned at 570 nm at a resolution of 1.56 lm using a
confocal GC3000 laser scanner (Affymetrix) and gene
expression levels were determined with GeneSpring 7
software and normalized with the per chip algorithm (Sil-
icon Genetics, Redwood City, CA, USA). For each growth
condition, two independently isolated RNA samples were
analyzed. The average signal intensity value of each gene
was transformed to a log2 (log base 2) value. The change
between two experimental conditions (n-fold) was calcu-
lated by taking the ratio of the signal intensity (difference
of the log2 value) between experimental conditions. Present
and absent calls were assessed and genes with a twofold
difference in RNA levels were considered to be differen-
tially expressed (Table S1). Statistically significant (t test;
P < 0.05) differences of fivefold or greater are summarized
in Table 2.
All of the microarray data are available through the
Gene Expression Omnibus data repository at NCBI (http://
Arch Microbiol (2008) 189:27–41 29

www.ncbi.nlm.nih.gov/geo/) via accession number GSE

CACTGATAATCGTGTCACCCTTTCTTATCCTAAGACTC

TTGGTCAAGGTGTTATTAGCAACTCTTACTGAGGAA
3989.

TTCATGAATATCTTTGCTCCAATGGTTGATAAAGC
CAAAAGTGACCTCTGACAAGGCTAA TAACAGAGGTCCATCAGGGACAAAACAAGGAT

TCTTGATTTAGGTTTAGGTGCTGGGCCTTACC

CCAAAAGAGACTGACGAAGACAAGGCTGCT
Quantitative reverse transcription (RT)-PCR

ATGATGGCGCAAGCAAGTACCTAAACGA
ACTGTATCCAACAGCAGCGCGAAGATTT

TATGACCGTAATGAAACCACTCGCA
Oligonucleotide primers and TaqMan probes (Table 1)

TGAAATTGGCTGACCGCCTGCATA
were designed with Primer Express 2.0 software (ABI
Prism, PE Biosystems, Framingham, MA, USA) and pur-

Fluorescent probe (5¢–3¢)d

TACTGGTGGCGGCGCACC
chased from Sigma-Genosys (The Woodlands, TX, USA).
Amplification and detection were done with the ABI Prism
7700 Sequence Detection System (PE Applied Biosystems)
using TaqMan One-Step RT-PCR Master Mix reagents
(Roche, Indianapolis, IN, USA), as recommended by the
manufacturer. Each assay was done in triplicate with at
least two independently isolated RNA samples. The

AAATAAGTCCGCTCTGTCAGACAGT
quantity of cDNA for each gene was normalized to the

CTGTCATTGAATGTCCAAGCTAATG

Fold changes in gene transcripts in the early-stationary phase in comparison with mid-exponential phase as determined by RT-PCR
AAAGGAAGCCACACCACTACCA
quantity of gyrA cDNA in each sample, and the standard

GGTGCAAGGCTAAGATGGTTTT

ACAGCACTTTGGTAACCGTTGA
CTTCTGGGAAATGAGCCTTGAT

CCAAGTGCCATAGTGGAGCAT

CGAAATGCGCTCTTGTTTGTC

TTCGACCATGAGGGTCATCA
CAAGTTCGTCCCCACCTTCA
error was determined as previously published (Chaussee
et al. 2003).

Covalently linked at the 5¢ end to 5-carboxyfluorescein and at the 3¢ end to N, N, N-tetramethyl-6-carboxyrhodamine

Two-dimensional gel electrophoresis
Reverse (5¢–3¢)
Cytoplasmic proteins were isolated from S. pyogenes, as

Spy numbers are based on annotation of SF370 S. pyogenes strain complete genome (Ferretti et al. 2001)
previously described (Chaussee et al. 2006). Briefly, 40 ml
cultures centrifuged and the pellets were suspended in lysis
buffer. Proteins were isolated and clarified using FastPrep

AAGTCAACAAAGGAAAAGAACCTTTT

Gene designations are in italics, and the corresponding protein designations are in parentheses
CACAGGTCTCAAATGATGTTGTTCT
CACCTACACTAAAAAACCGCATCA

protein isolation and PlusOne 2-D Clean-up kits (GE

GGTGGTGGTAAAGTGCCTATGGT

CGCACTAAACCCTTCAGCTCTT
Healthcare, Piscataway, NJ, USA) to remove non-protein
Table 1 Primers and TaqMan probes used for quantitative reverse transcription (RT)-PCR

CCGAAAACCATCGCAAAATG

ACCTGGTTTCTGCCGTTTTTG
GAGTGGATGAGCACCGCTTT
TTGGAATGTTGGCAGCCTTT
CCCTTTTACGTGGGCATCTG
ACCCGCTTGTTTGGTTTGAG

contaminants. Protein determinations were done with a

PlusOne 2-D Quant kit (GE Healthcare), as described by
the manufacturer. Isoelectric focusing (IEF) was done
Fold changes in Forward (5¢–3¢)

using 24 cm immobiline dry strips with a linear pH range

of 4 to 7 (GE Healthcare). Following IEF, SDS-poly-
acrylamide gel electrophoresis (SDS-PAGE) separation
was done with a DALT II six electrophoresis apparatus
(GE Healthcare) and 10% acrylamide resolving gels. The
proteins were stained with Sypro Ruby (Molecular Probes),
transcriptsc

and digital images were acquired with a Typhoon 9410

imager (GE Healthcare). Analysis of the gels, including
gene

protein spot detection and quantitation, was done with

0.6
4

5
3
11

79

16

PDQuest software (Bio-Rad, Hercules, CA, USA). Gels

norA (putative antibiotic resistance protein

were normalized based on the sum of all protein spots

None (putative phosphotransferase system
None (putative regulatory protein - RofA

detected in each sample. For each phase of growth, proteins

None (putative serine cycle enzyme)
(PTS), enzyme II, component C)
nga (nicotine adenine dinucleotide

were isolated on three independent occasions and statisti-

relA ((p)ppGpp synthetase, GTP
phosphoribosyltransferase)

cally significant differences were determined using

speB (pyrogenic exotoxin B)
glycohydrolase precursor)

rgg (transcription regulator)

arcA (arginine deiminase)

PDQuest software (t test; P < 0.05).

pyrophosphokinase)
pyrE (putative orotate

mf (mitogenic factor)

Protein identification
Designationb

related)

NorA)

Proteins of interest were excised from the SDS-PAGE gels

with a robotic spot cutter (Bio-Rad) and identified with
tandem mass spectrometry, as previously described
1059

1547
1856

1981

2039
2042
2043
2084
no.a
Spy

165

216

901

(Chaussee et al. 2004). Spectra were obtained in positive

b

d
a

123
30 Arch Microbiol (2008) 189:27–41

Table 2 Growth phase-associated differences in the transcriptome greater than fivefold (P < 0.05)
SPya Gene Description Fold change
(stat/exp)

More abundant in early stationary phase

Translation
552 – Hypothetical protein 5
Transcription
2172 – Hypothetical protein 15
1763 hrcA Putative heat shock transcription repressor protein 11
1259 – Transcriptional regulator 8
1602 – Transcriptional regulator 8
1285 – Transcriptional regulator 7
1817 scrR Putative sucrose operon repressor 5
2177 – Putative transcriptional regulator (TetR AcrR 5
family)
Replication, recombination and repair
1846 dinP DNA-damage-inducible protein P 14
1510 mutT Mutator protein 8
185 polA DNA polymerase1 6
550 – Hypothetical protein 6
1314 uvrB Excinuclease (subunit B) 5
1369 deaD2 Putative RNA helicase 5
Defense mechanisms
837-838b –/yknZ ABC transporter-hypothetical protein 8–9
1286 – ABC transporter 7
Signal transduction mechanisms
1780 – Hypothetical protein 7
584 ptsK Hpr kinase phosphatase 5
Cell wall/membrane biogenesis
836 – Hypothetical protein 10
585 lgt Prolipoprotein diacylglycerol transferase 5
716 agaS Tagatose-6-phosphate aldose ketose isomerase 5
2059 pbp2A Penicillin-binding protein 2a 5
Posttranslational modification, protein turnover, chaperones
888 clpL ATP-dependent protease 22
1509 clpE ATP-dependent protease 14
1759-1760-1761 dnaJ/dnaK/grpE Heat shock proteins/Hsp-70 cofactor 10-9-12
2105 nrdG Putative anaerobic ribonucleotide reductase 8
activator
2037 – Peptidylprolyl isomerase 7
2072 groES Heat shock protein 6
395 clpP ATP-dependent protease subunit 6
2079 ahpC Putative alkyl hydroperoxidase 5
Energy production and conversion
1191 oadA Oxaloacetate decarboxylase alpha chain 21
1189 citF Citrate lyase, alpha subunit 19
1184-1186 –/citD Decarboxylase, beta subunit- citrate lyase, gamma 14-18
subunit
1683-1684 glpO/glpK Alpha-glycerophosphate oxidase-glycerol kinase 9-9
352 – Acylphosphatase 8
512 – NADH-flavin oxidoreductase 8

123
Arch Microbiol (2008) 189:27–41 31

Table 2 continued
SPya Gene Description Fold change
(stat/exp)

839 – Glycerophosphodiester phospohodiesterase 8

2049 pflD Pyruvate formate lyase-2 6
801 – Ferredoxin 5
1029 acoC Putative dihydrolipoamide S-acetyltransferase 5
1192 citC Putative citrate lyase synthetase (citrate (pro-3S)- 5
lyase ligase)
2047 gldA Glycerol dehydrogenase 5
Carbohydrate transport and metabolism
1188 citE Citrate lyase, beta subunit 15
1816 scrB Sucrose-6-phosphate hydrolase 9
1287 – Hypothetical protein 8
1599 – Beta glucosidase 8
1604 – Alpha-mannosidase 8
1707-1708-1709-1710-1711 lacB.1A.1/–/–/– Galactose-6-phosphate isomerase-PTS 7-11-6-8-6
1976 msmK Multiple sugar metabolism transporter 7
1592 – Hypothetical protein 6
1682 glpF Glycerol uptake facilitator 6
1918-1919-1921-1922 lacFD.2C.2B.2 PTS-tagatose-PTS-system-1,6-diphosphate aldolase- 5-6-5-5
tagatose 6-phosphate kinase- galactose-6-
phosphate isomerase
Amino acid transport and metabolism
1544 arcB Putative ornithine transcarbamylase 107
1542 – Putative Xaa-His dipeptidase 95
1547 arcA Arginine deiminase 41
511 gloA Lactoylgutathione lyase 9
513 pepQ Putative XAA-PRO dipeptidase 7
183-184 opuAAABC Glycine betaine proline ABC transporter-glycine- 7-7
betaine binding permease protein
1111 Alcohol dehydrogenase 6
1991 trpG Anthranilate synthase component II 5
Nucleotide transport and metabolism
2110 nrdD Anaerobic ribonucleoside-triphospate reductase 8
Coenzyme transport and metabolism
1096 folC.1 Folyl-polyglutamate synthetase 6
Lipid transport and metabolism
1190 citX Hypothetical protein 20
1183 – Decarboxylase, gamma chain 17
Inorganic ion transport and metabolism
1715 copA Putative cation-transporting ATP-ase 9
158 – Toxic anion resistance protein 7
408 – Hypothetical protein 6
2115 Hypothetical protein 5
General function prediction only
1546 – Hypothetical protein 63
2170 – Hypothetical protein 11
775, 1339 – Hypothetical proteins 8
2106-2107 – Hypothetical protein-putative oxidoreductase 7-7
357, 500, 588 – Hypothetical proteins 5

123
32 Arch Microbiol (2008) 189:27–41

Table 2 continued
SPya Gene Description Fold change
(stat/exp)

Function unknown
1543 – Hypothetical protein 85
1260-1261-1262-1263-1264-1265 – Hypothetical proteins 19-15-12-19-11-12
2173 yoxJ Hypothetical protein 16
238 – Hypothetical protein 15
470 – Myosin-crossreactive antigen 12
1603, 1686 – Hypothetical proteins 7
1440 – Putative holin - phage associated 5
Not in COGs
2040 – Hypothetical protein 44
2043 mf Mitogenic factor 18
1156-1157 – Hypothetical proteins 9-15
1436 mf3 Putative deoxyribonuclease 11
2039 speB Pyrogenic exotoxin B 11
577, 802 – Hypothetical proteins 6
1600 – Hyaluronidase 6
997 hylP2 Hyaluronidase phase associated 5
159, 492, 553, 578, 914, 1405, 1437 – Hypothetical proteins 5
Less abundant in early stationary phase
Translation, transcription, replication, recombination and repair
870 fms Polypeptide deformylase –7
307 – Hypothetical protein –5
847 – 16S rRNA processing protein –5
Defense mechanisms
1205 – Putative antimicrobial resistance factor –15
Posttranslational modification, protein turnover, chaperons
850 – Thioredoxin reductase –6
Transport and metabolism
323 braB Putative branched-chain amino acid transport –16
protein
1506-1507 – Putative amino acid ABC transporter –11–11
1270 – Amino acid symporter –8
386 – Ferrichrome ABC transporter –7
1136-1137 xpt/- Santhine phosphoribosyltransferase-purine –7–5
permease
1114 – Hypothetical protein –7
2193 – Hypothetical protein –5
General function prediction only, function unknown, not in COGs
1139 – 4-oxalocrotonate tautomerase –8
314 – Hypothetical protein –7
312, 1735 – Hypothetical proteins –6
1206-1208 – ABC transporter-hypothetical protein –6–5
305-306 – Hypothetical proteins –5–5
421 yoaK Hypothetical protein –5
1203 – hypothetical protein –5
a
SPy numbers are based on the SF370 S. pyogenes genome annotation (Ferretti et al. 2001)
b
Contiguous genes likely to be co-transcribed are grouped together

123
Arch Microbiol (2008) 189:27–41
ion mode, deconvoluted, and analyzed with MassLynx 4.0
software (Waters Corp., Milford, MA, USA). Protein Lynx
Global Server v. 2.1 (Waters) was used to search databases
consisting of S. pyogenes genome sequences and the NCBI
v20060512 non-redundant genomic databases. The
parameters for the search were as follows: the modification
on cysteine residue by carboxyamidomethylation was set
as fixed; asparagine and glutamine deamidation, and
methionine oxidation were considered as variable modifi-
cations. The maximum number of missed cleavages was
one. Monoisotopic masses were considered, and the pep-
tide and fragment tolerances were 100 ppm and 0.25 Da,
respectively. Proteins were identified by matching MS/MS
spectra from at least two tryptic peptides or by de novo
peptide sequence determination, when only one MS/MS
match was identified.
Results
Growth phase-associated changes in the transcriptome
and proteome
Growth phase-associated changes in the S. pyogenes
NZ131 transcriptome were identified with Affymetrix
NimbleExpress whole-genome chips. RNA was isolated
during the mid-exponential and early-stationary phases of
growth. The transcript levels of 689 genes, representing
approximately 40% of the chromosome, changed by two-
fold or more upon entry into the early-stationary phase of
growth; 522 and 167 gene transcripts were more and less
abundant, respectively (Table S1). Quantitative RT-PCR
was used to measure transcripts of 11 genes (Table 1) in
both the mid-exponential and early-stationary phases of
growth and the results correlated with the microarray data,
which supports the validity of the array data (Fig. S1). The
genes selected included several known or putative viru-
lence-associated genes and regulators, which are of general
Transport and metabolism (513)
Energy production and conversion (62)
Posttranslational modification, protein turnover, chaperones (56)
Cell wall and membrane biogenesis (76)
Signal transduction mechanisms (70)
Replication, recombination and repair (128)
Transcription (133)
Translation (152)
0 10
Fig. 1 Growth phase-associated changes in functionally categorized
gene transcripts in NZ131. The percentages of more-abundant (open
bars) and less-abundant (closed bars) gene transcripts in each
functional category during the early-stationary phase of growth
33
interest. In addition, metabolic genes likely to be growth
phase-regulated were selected. The majority of growth
phase-responsive genes encoded proteins involved in
metabolism and transport, stress responses, protein trans-
lation, cell-wall metabolism, and protein synthesis (Fig. 1).
Transcript changes fivefold or greater are reported in Ta-
ble 2. In addition to the transcriptome analysis, changes in
the proteome were identified by using 2-DE and repre-
sentative gels are shown in Fig. 2. An average of 527 and
403 protein spots were detected in gels containing samples
from the exponential and stationary phases of growth,
respectively. Several hundred protein spots were excised
from gels containing both exponential and stationary-phase
proteins and analyzed with tandem mass spectrometry. The
results were used to confirm protein spot matching among
the gel set. Among the spots analyzed, 172 unique proteins
were identified, which represented 96 loci (Table S2). 128
protein spots, representing 80 loci, were altered in a growth
phase-specific manner. Statistically significant changes
(P < 0.05) are summarized in Table 3.
Growth phase-associated changes in regulatory genes
In the absence of a stationary phase-specific secondary
sigma factor, genomewide changes in expression are
thought to result from interactions among regulons. In the
early-stationary phase of growth, changes in the transcrip-
tome correlated with increases in transcripts encoding glo-
bal regulatory proteins (Table S1). These included: (a) codY
(threefold), which controls the cellular response to nitrogen
starvation (Fisher 1999). (b) relA (twofold), which mediates
the stringent response to amino acid starvation (Steiner and
Malke 2000). and (c) luxS (twofold), which synthesizes an
autoinducing quorum sensing molecule (Lyon et al. 2001).
The increase in codY expression was associated with
changes in the CodY regulon (Malke et al. 2006). For
example, genes involved in peptide and amino acid trans-
port (oppBCD and dppBCDE, and braB) were less abundant
20 30 40 50 60
compared to those during the mid-exponential phase of growth are
shown. The number of genes within each category is indicated in
parentheses
123
34
Fig. 2 Representative 2-DE gels of S. pyogenes proteins isolated
during the a exponential and b stationary phases of growth. The SPy
numbers (based on the SF370 genome annotation) of proteins
identified with tandem mass spectrometry are indicated
in the early-stationary phase of growth compared to the
exponential phase. Similarly, the increase in relA transcripts
was associated with increased expression of murE, rplL, and
fus, which are part of the stringent response. The expression
of several other regulatory gene transcripts was also altered
coincident with entry into the early-stationary phase of
growth (Table S1). The only change in regulatory proteins
detected with 2-DE gels was PyrR (SPy 830), which was
detected only in protein samples from stationary phase
cultures (Table 3). The absence of other regulatory proteins
in the 2-DE gels is not surprisingly given that they are
typically expressed at relatively low levels.
Growth phase-associated changes in metabolic genes
In THY broth, S. pyogenes obtains energy primarily from
the fermentation of glucose. All of the glycolytic enzymes,
123
Arch Microbiol (2008) 189:27–41
except glucose kinase, were identified in 2-DE gels and
were more abundant in the stationary phase of growth
(Fig. 3). The increase correlated with transcriptome results
(Table S1). Proteins involved in pyruvate metabolism were
also elevated in the stationary phase of growth including
pyruvate dehydrogenase (AcoB, SPy 1028; AcoL, SPy
1031), which converts pyruvate to acetyl CoA and CO2,
and L-lactate dehydrogenase (LDH) (Fig. 3, Table 3).
Presumably, the increase in central metabolic enzymes
enhances the ability of the pathogen to scavenge carbo-
hydrates present at very low concentrations (Harder and
Dijkhuizen 1983). In this regard, Escherichia coli adapts to
glucose-limiting conditions by increasing the expression of
genes involved in central metabolism (Hua et al. 2004) and
the abundance of proteins involved in glucose uptake
(Wick et al. 2001). Such adaptation may be particularly
important during infection of tissues in which the con-
centration of carbohydrates is very low.
Transcripts associated with the transport and metabo-
lism of lactose, sucrose, mannose, and amylase were also
more abundant during the stationary phase of growth
(Table S1). Similarly, transcripts encoding arginine dei-
minase (arcA) and serine dehydratase (sdh), which are
involved in the catabolism of arginine and serine,
respectively, were elevated in the stationary phase of
growth (Table S1). The changes in the expression of
amino acid catabolic enzymes were associated with in-
creased expression of several genes encoding putative
peptidases, such as pepA, pepC, pepD, pepP, pepQ,
pepXP. Several of the changes were cognate with those
obtained with 2-DE (Table 2). Finally, transcripts encod-
ing the citrate lyase complex (citDEFX) and oxaloacetate
decarboxylase (oadA) were more abundant in the early-
stationary phase of growth (Table S1). Together, the
changes in genome expression are consistent with the
de-repression of genes involved in the metabolism of non-
glucose carbon sources.
Growth phase-associated changes in stress responsive
genes
Nutrient limitation and decreasing pH trigger a variety of
bacterial stress responses (Len et al. 2004). Not surpris-
ingly, the abundance of several stress responsive proteins
was elevated in the stationary phase of growth (Table 3)
including DnaK (SPy 1760), ClpE (SPy 1509), and Nox1
(SPy 2080); the cognate transcripts were elevated by 9, 14,
and 6-fold, respectively (Table 2).
In some instances, growth phase-associated changes in
stress responsive proteins were detected at either the tran-
script or the protein level. For example, transcript levels of
clpL, groEL, groES were more abundant upon entry into
the stationary phase of growth (Table 2); however, no
Arch Microbiol (2008) 189:27–41 35

Glucose
Glucose kinase
(SPy1529) (not
detected in 2-DE
Fold change (stat/exp)
gels)
Exponential Stationary mRNA Protein
Glucose-6-Phosphate

Glucose-6-P isomerase
(SPy0215) 2 6
Fructose-6-Phosphate

Phosphofructokinase
(SPy1283) 3 3

Fructose-1,3-Bisphosphate

Fructose bisphosphate aldol-

ase (SPy1889) 3 2

Glyceraldehyde-3-Phosphate
Glyceraldehyde 3-P
dehydrogenase 3 22
(SPy0274)

1,3-bisphosphoglycerate

Phosphoglycerate kinase
(SPy1881) nd 4

3-phosphoglycerate

Phosphoglycerate
mutase (SPy1429) 2 3
2-phosphoglycerate

Enolase
(SPy0731) 4 2
phosphoenolpyruvate

Pyruvate kinase
(SPy1282) 3 12

lactate pyruvate acetyl-CoA

L-lactate Pyruvate dehydrogenase (SPy1028)
dehydrogenase (SPy1151) Dihydrolipoamide dehydrogenase (SPy1031)

Exponential Stationary
Exponential Stationary

SPy1028 4 2
3 2

SPy1031 4 uc

Fig. 3 Growth phase-associated differences in the abundance of transcript levels were determined by DNA microarray analysis. ‘‘uc’’
proteins involved in glycolysis and pyruvate metabolism. Selected indicates that the ratio cannot be calculated and ‘‘ND’’ indicates the
enzymes are circled and proteins indicated in the pathway diagram. value was not determined
The fold change in protein and transcript levels is indicated. The

difference was detected at the protein level. In contrast, the
peptidyl-prolyl cis-trans isomerase RopA (SPy 1896),
which is required for the secretion of the cysteine protease
SpeB (Neely et al. 2003), was more abundant during the
stationary phase; however, changes in ropA transcripts
were not detected. Similarly, the abundance of cysteine
synthase CysM (SPy 1618) increased sevenfold in the
stationary phase and a proton translocating ATPase AtpA
(SPy 0758) was only detected among stationary phase
proteins (Table 3); however, no changes in the corre-
sponding transcripts were observed (Table S1). Thus, post-
transcriptional mechanisms of regulation are involved in
the adaptation of S. pyogenes to the culture conditions
associated with the stationary phase of growth.

123
36 Arch Microbiol (2008) 189:27–41

Table 3 Growth phase-associated changes in the proteome (P < 0.05)

SPya Gene Description Exponential Stationary Fold
phaseb phaseb changec
(stat/exp)

Translation
0273 fus EF-G 630 112 –6
0273 fus EF-G NDd 476 uce
0273 fusf EF-G 102 1006 10
0611 tufA EF-Tu 6626 1222 -5
1688 glyS Glycyl-tRNA synthetase (beta subunit) ND 725 uc
2093 tsf EF-Ts 45 1,950 43
Cell wall/membrane biogenesis
0763 – UDP N acetylglucosamine 1 carboxyvinyltransferase ND 423 uc
0784 rmlD dTDP 4 keto L rhamnose reductase 467 2686 6
1280 glmS L glutamine D fructose 6 phosphate amidotransferase ND 777 uc
1525 murD UDP-N-acetylmuramoylalanine-D-glutamate ligase ND 114 uc
Posttranslational modification, protein turnover, chaperones
1509 clpE ATP dependent protease ND 197 uc
1509 clpE ATP dependent protease ND 103 uc
1760 dnaK Heat shock protein 70 2263 6355 3
1896 ropA Trigger factor (prolyl isomerase) 1305 7530 6
Energy production and conversion
0226 gpsA NAD(P)H-dependent glycerol-3-phosphate 70 552 8
dehyrodgenase
0758 atpA Proton translocating ATPase alpha subunit ND 1047 uc
0759 atpG Proton-translocating ATPase, gamma subunit ND 972 uc
1028 acoB Pyruvate dehydrogenase (beta chain) 2372 4562 2
1028 acoB Pyruvate dehydrogenase (beta chain) ND 166 uc
1031 acoL Pyruvate dehydrogenase, component E3 31 921 29
1069 – NADH dehydrogenase ND 657 uc
1128 pta Phosphotransacetylase 975 4011 4
1151 ldh L-lactate dehydrogenase 1109 238 -5
1151 ldh L-lactate dehydrogenase 4210 9286 2
1371 gapN NADP-dependent glyceraldehyde-3-phosphate 2232 5602 3
dehydrogenase
1371 gapN NADP-dependent glyceraldehyde-3-phosphate 41 367 9
dehydrogenase
Carbohydrate transport and metabolism
0215 pgi Glucose-6-phosphate isomerase 252 1427 6
0613 tpi Triosephosphate isomerase 4938 1360 -4
0731 eno Enolase 385 ND uc
0731 eno Enolase 21888 41572 2
1282 pyk Pyruvate kinase 605 6499 12
1283 pfk 6-Phosphofructokinase 2748 7889 3
1372 pstI Phosphoenolpyruvate:sugar phosphotransferase system 1930 5763 3
enzyme I
1429 gpmA Phosphoglycerate mutase 2728 7412 3
1676 tkt Transketolase 1255 4467 4
1881 pgk Phosphoglycerate kinase 1933 288 –7
1881 pgk Phosphoglycerate kinase 2152 405 –5
1881 pgk Phosphoglycerate kinase 1133 297 –3
1881 pgk Phosphoglycerate kinase 296 4463 15

123
Arch Microbiol (2008) 189:27–41 37

Table 3 continued
SPya Gene Description Exponential Stationary Fold
phaseb phaseb changec
(stat/exp)

Amino acid transport and metabolism

0911 bcaT Branched-chain-amino-acid transferase 2212 656 -3
1070 – Dipeptidase 1149 4053 4
1316 – ABC transporter 2179 4373 2
1541 arcC Carbamate kinase 1081 3585 3
1544 arcB Ornithine transcarbamylase ND 115 uc
1618 cysM O-acetylserine lyase 1380 10213 7
Nucleotide transport and metabolism
0160 purA Adenylosuccinate synthetase 84 404 5
0830 pyrR Pyrimidine regulatory protein ND 346 uc
0892 punA Purine nucleoside phosphorylase 2279 4621 2
2206 guaB Inosine monophosphate dehydrogenase ND 139 uc
2206 guaB Inosine monophosphate dehydrogenase 38 1160 31
Lipid transport and metabolism
1637 atoB Acetyl CoA acetyltransferase 18 233 13
1748 fabF Beta-ketoacyl-ACP synthase II 796 2,010 3
Secondary metabolites biosynthesis, transport, and catabolism
0647 – Acetoin reductase 990 4423 5
General function prediction only
0044 adhA Alcohol dehydrogenase I 3166 6250 2
1150 nox NADH oxidase 536 5180 10
a
SPy numbers are based on the SF370 S. pyogenes genome annotation (Ferretti et al. 2001). More than one isoform of each protein may have
been detected and the corresponding quantity is shown on a separate line
b
Mean quantity of protein was determined with PDQuest 7.3.0 2-D analysis software
c
The fold change in protein abundance in the exponential compared to the stationary phase. Negative values indicate the protein was more
abundant in the exponential phase
d
Protein spot not detected
e
Unable to calculate ratio because one spot was not detected
f
Protein spot quantities are reported for each isoform identified

Growth phase-associated regulation of virulence genes Protein isoforms

Several virulence factors of S. pyogenes are expressed in a
growth phase-dependent manner (Kreikemeyer et al.
2003). Surprisingly, a difference in the expression of the
Mga-regulated operon, which is known to be expressed
primarily in the exponential phase of growth, was not
detected in strain NZ131. The RNA was isolated from
cultures in the early-stationary phase of growth. Thus is
seems likely that Mga-regulated transcripts decrease at
later times in the stationary phase. Nonetheless, the
expression of several genes encoding secreted proteins,
such as mf-1, mf-3, hyluronidase, speB, cfa, and sagA
increased in the stationary phase of growth (Table S1), as
expected.
Post-translational protein modifications such as phosphor-
ylation, glycosylation, acetylation, and proteolysis can alter
the migration of proteins in 2-DE gels. In this study, 33 loci
were identified that encoded proteins with multiple iso-
forms. Together, the isoforms were among the most abun-
dant proteins and accounted for 30% of the total amount of
protein detected. Among the isoforms, the migration of 25
proteins deviated from the predicted Mr by more than
10,000 Da; the migration of five proteins deviated from the
predicted pI by more than 1.0 (Table S2). Proteins with the
most isoforms included enolase (Eno; SPy 0731), elonga-
tion factor Tu (EF-Tu; SPy 0611), elongation factor G (EF-
G; SPy 0273), phosphoglycerate kinase (Pgk; SPy 1881),

123
38
triosephosphate isomerase (SPy 0613), cell division initia-
tion protein (DivIVAS; SPy 1514), heat-shock protein 70
(DnaK; SPy 1760), O-acetylserine lyase (CysM; SPy 1618),
and elongation factor Ts (EF-Ts; SPy 2093).
The abundance of several isoforms changed in a growth
phase-associated manner. For example, one LDH isoform
was more abundant during the exponential phase of growth
while a different isoform was more abundant during the
stationary phase of growth (Table 3); the corresponding ldh
transcripts were threefold more abundant upon entry in the
stationary phase of growth (Table S1). Similarly, the
abundance of one DivIVAS isoform (Table S2) was greater
during the exponential phase of growth, while the abun-
dance of three other isoforms increased in the stationary
phase of growth. Growth phase-associated changes in
divIVAS transcripts were not detected, suggesting that
DivIVAS changes are mediated post-transcriptionally.
Further analysis of tryptic peptides revealed that one
DivIVAS isoform was phosphorylated, at the threonine
residue (position 205). This modification was similar to a
previous report of growth phase-associated phosphorylation
of DivIVAS in Mycobacterium tuberculosis (Kang et al.
2005). The nature of the other modifications and the func-
tional significance of the changes remain to be determined.
Discussion
Growth phase-associated changes in gene expression have
been used as a convenient, albeit imperfect, method to
study pathogen adaptation to changing environmental
conditions. Many of the established virulence factors of S.
pyogenes are regulated in a growth phase dependent fash-
ion, which suggests that the model is relevant to the study
of pathogenesis. In this study, differences in gene expres-
sion between the exponential and early-stationary phases of
growth were identified at both the transcript and protein
level in strain NZ131 (serotype M49). The results showed
de-repression of operons involved in non-glucose based
catabolism, increased expression of stress responsive
genes, and increased expression of a variety of virulence-
associated genes in the stationary phase of growth. Results
obtained with DNA microarrays provided much informa-
tion on the expression of genes likely to be present at low
concentrations in the cell, such as regulatory proteins. The
complementary proteomic approach revealed the formation
of growth phase-associated isoforms and identified changes
in protein abundance not evident at the transcript level. In
addition, several open reading frames previously annotated
as hypothetical proteins were identified in the 2-DE gels.
Together, the results help to define growth phase specific
patterns of gene expression in a serotype M49 strain of
S. pyogenes.
123
Arch Microbiol (2008) 189:27–41
Growth phase-associated transcriptional changes
in vitro, in vivo and during growth with human saliva
DNA microarrays were recently used to characterize S.
pyogenes gene expression during soft-tissue infections of
mice (Graham et al. 2006). Over 80% of the transcripts that
were most abundant during soft-tissue infections are also
growth-phase regulated in strain NZ131. Moreover, genes
that are highly expressed in mice were typically expressed
in the early-stationary phase of growth in the present study.
These include genes involved in maltodextrin utilization
(SPy 1299, 1302, and 1304), a variety of stress response
related genes including dnaK, grpE, hrcA (SPy 1760-
1763), and a cluster of hypothetical protein genes (SPy
1260-1265). One of the genes annotated as a hypothetical
protein (SPy 1260) is similar to Gls24 of Enterococcus
faecalis, which is expressed in response to nutritional stress
and contributes to virulence (Giard et al. 2000; Hew et al.
2006). Similarly, several genes expressed at a low level in
soft tissue infections were also less abundant in the sta-
tionary phase of growth in strain NZ131. Exceptions to this
trend included the hypothetical proteins SPy 308-314 and
2191-2193. Both soft-tissue infection and the stationary
phase of growth are associated with low concentrations of
glucose, which is consistent with the shared patterns of
gene expression.
The transcriptome of S. pyogenes MGAS5005 has also
been characterized during growth with human saliva
(Shelburne et al. 2005). Among the 20 most abundant gene
transcripts during the stationary phase of growth in saliva,
80% were more abundant during the early-stationary phase
of growth of NZ131 with THY. Among the differences,
SPy 0084 (annotated as a hypothetical protein) was the
most highly expressed transcript in saliva but was less
abundant during batch culture of NZ131 (Table S1). Other
noteworthy differences were among the malAC and prtS
genes, which were more abundant in the stationary phase of
growth with saliva but not when grown with THY, prob-
ably because THY does not contain a significant amount of
maltodextrins.
Growth phase regulation in different strains
of S. pyogenes
Previously, growth phase-associated changes in the tran-
scriptome of S. pyogenes strain 591, which is also a sero-
type M49 strain, were analyzed using DNA microarrays
(Beyer-Sehlmeyer et al. 2005). Among the growth phase-
regulated genes identified in strain 591, 145 genes were
also regulated in growth phase-specific manner in strain
NZ131. For 64 loci, a growth phase-associated change in
expression was detected in strain 591 but not in strain
NZ131. For 16 genes, opposing results were noted. The
Arch Microbiol (2008) 189:27–41
discrepancies between the two studies typically involved
relatively minor changes in transcript levels. For example,
in NZ131 deoB transcripts, encoding phosphopentomutase
(SPy 0890), were threefold more abundant in the early-
stationary phase compared to the exponential phase. In
contrast, the transcripts were twofold more abundant dur-
ing the exponential phase in strain 591. Minor differences
in experimental reagents (such as media composition) and
techniques may account for some of the differences. In
contrast to results obtained with serotype M49 strains, only
seven transcripts (sagA, sagI, arcT, arcA, sda and a
transposase gene designated SPyM3_0221), were elevated
in strain MGAS315 (serotype M3) upon entry into the
stationary phase of growth (Barnett et al. 2007). Interest-
ingly, in strain MGAS315, transcript levels of the arc op-
eron varied among the genes in the operon and only arcT
and arcA were elevated 2.3 and 4.8-fold, respectively, in
the stationary phase of growth. In contrast, in strain NZ131,
transcript levels of all six genes in the presumptive poly-
cistronic operon were elevated over 40-fold in the early-
stationary phase of growth (Table 1). In strain MGAS315
gene-specific degradation of mRNA is an important feature
of growth phase-associated gene regulation (Barnett et al.
2007). In this regard, the extent to which the rate of mRNA
decay in strain NZ131 contributes to regulation remains to
be determined. The differences in growth phase regulation
among these strains, suggests that the clinical and pheno-
typic diversity characteristic of S. pyogenes may result, at
least in part, from differences in the regulation of gene
expression.
Responses to changing culture conditions
The abundance of two LDH (SPy 1151) isoforms changed
in a growth phase-associated manner. One isoform was
more abundant during the exponential phase of growth
while another was more abundant in the stationary phase of
growth (Table 3). Similar results were obtained with S.
pneumoniae (Lee et al. 2006). In addition, LDH levels in-
crease nearly twofold when S. mutans is exposed to acidic
conditions (Wilkins et al. 2002). Moreover, changes in the
migration of LDH in S. pyogenes were similar to those in S.
mutans. For example, one LDH isoform from S. pyogenes
migrated to a position 1.8 kDa and 0.2 pI units greater than
the predicted values (Table S2), which is identical to the
changes in the migration of an LDH isoform in S. mutans
under acidic conditions (Wilkins et al. 2002). Thus, at least
some of the growth phase-associated changes in the abun-
dance of protein isoforms identified in S. pyogenes, are
likely to result from acidification of the media.
AtpA, CysM, and Nox1 were more abundant in the
stationary phase of growth (Table 3). In E. faecalis, AtpA
controls cytoplasmic pH under acidic conditions (Voyich
39
et al. 2003) and thus the increase correlates with decreasing
culture pH. CysM is essential for the survival of Pseudo-
monas putida during cold shock (Reva et al. 2006), and
contributes to the resistance of Staphylococcus aureus to
tellurite, hydrogen peroxide, and acidic conditions (Lith-
gow et al. 2004). In addition, CysM was more abundant
when S. pyogenes was grown in the presence of human
plasma (Johansson et al. 2005). Nox1 may help S. pyogenes
survive oxidative stress and its activity is decreased in the
presence of glucose (Gibson et al. 2000). Therefore, it is
not surprising to see an increase in Nox1 during the sta-
tionary phase of growth when glucose is depleted. Thus in
addition to well-characterized stress responsive proteins,
additional growth phase-regulated proteins were identified
which are likely to contribute to adaptation to the changing
environmental conditions.
Comparison of array and proteomic-derived results
The results obtained with DNA microarrays were signifi-
cantly more comprehensive compared to those obtained
with 2-DE, due to the relatively low sensitivity of protein
detection. The total number of unique proteins identified in
this study corresponded to 9% of the predicted proteins
within the pI range of analysis (4–7), which is similar to
results obtained in related studies (Jungblut et al. 2000;
Guillot et al. 2003; Folio et al. 2004). In general, changes in
protein abundance correlated with changes in transcript
levels. Nonetheless, the proteomic-derived dataset pro-
vided the following information. First, several proteins are
post-translationally modified in a growth phase-dependent
manner. The nature and functional significance of the
modifications remain to be determined. Second, several
growth phase-associated changes in protein abundance
were identified that were not associated with changes in the
corresponding transcript levels. Of particular note, proteins
involved in cell wall and membrane biogenesis, including
RmlD, GlmS, MurD were more abundant in the stationary
phase of growth, although a change in transcript level was
not detected. Third, several hypothetical open reading
frames were found to encode expressed proteins, some of
which are also expressed in a growth phase dependent
manner.
In summary, genomewide differences in expression
were identified between the exponential and early-station-
ary phase of growth in a serotype M49 S. pyogenes strain.
The changes are mediated by mechanisms that do not ap-
pear to rely on secondary sigma factors, which may ac-
count for the diversity in growth phase-associated gene
regulation among various strains of S. pyogenes. Clearly,
identifying the mechanisms of growth phase-mediated
control of gene expression is necessary to understanding
the control of virulence factor expression in S. pyogenes.
123
40
Acknowledgments We thank Emily McDowell for completing the
quantitative RT-PCR assays. This work was supported by NIAID/
NIH grant RO1 AIO52147 to M.S.C and NIH Grant Number 2 P20
RR016479 from the INBRE Program of the National Center for
Research Resources.
References
Barnett TC, Bugrysheva JV, Scott JR (2007) Role of mRNA stability
in growth phase regulation of gene expression in the group A
streptococcus. J Bacteriol 189:1866–1873
Beyer-Sehlmeyer G, Kreikemeyer B, Horster A, Podbielski A (2005)
Analysis of the growth phase-associated transcriptome of
Streptococcus pyogenes. Int J Med Microbiol 295:161–177
Carapetis JR, Steer AC, Mulholland EK, Weber M (2005) The global
burden of group A streptococcal diseases. Lancet Infect Dis
5:685–694
Chaussee MS, Phillips ER, Ferretti JJ (1997) Temporal production of
streptococcal erythrogenic toxin B (streptococcal cysteine pro-
teinase) in response to nutrient depletion. Infect Immun
65:1956–1959
Chaussee MS, Somerville GA, Reitzer L, Musser JM (2003) Rgg
coordinates virulence factor synthesis and metabolism in Strep-
tococcus pyogenes. J Bacteriol 185:6016–6024
Chaussee MA, Callegari EA, Chaussee MS (2004) Rgg regulates
growth phase-dependent expression of proteins associated with
secondary metabolism and stress in Streptococcus pyogenes. J
Bacteriol 186:7091–7099
Chaussee MA, McDowell EJ, Rieck LD, Callegari EA, Chaussee MS
(2006) Proteomic analysis of a penicillin-tolerant rgg mutant
strain of Streptococcus pyogenes. J Antimicrob Chemother
58(4):752–759
Cunningham MW (2000) Pathogenesis of group A streptococcal
infections. Clin Microbiol Rev 13:470–511
Davies HD et al (1996) Invasive group A streptococcal infections in
Ontario, Canada. Ontario Group A Streptococcal Study Group. N
Engl J Med 335:547–554
Dmitriev AV, McDowell EJ, Kappeler KV, Chaussee MA, Rieck LD,
Chaussee MS (2006) The Rgg regulator of Streptococcus
pyogenes influences utilization of nonglucose carbohydrates,
prophage induction, and expression of the NAD-glycohydrolase
virulence operon. J Bacteriol 188:7230–7241
Ferretti JJ et al (2001) Complete genome sequence of an M1 strain of
Streptococcus pyogenes. Proc Natl Acad Sci USA 98:4658–4663
Fisher SH (1999) Regulation of nitrogen metabolism in Bacillus
subtilis: vive la difference! Mol Microbiol 32:223–232
Folio P, Chavant P, Chafsey I, Belkorchia A, Chambon C, Hebraud M
(2004) Two-dimensional electrophoresis database of Listeria
monocytogenes EGDe proteome and proteomic analysis of mid-
log and stationary growth phase cells. Proteomics 4:3187–3201
Giard JC, Rince A, Capiaux H, Auffray Y, Hartke A (2000)
Inactivation of the stress- and starvation-inducible gls24 operon
has a pleiotrophic effect on cell morphology, stress sensitivity,
and gene expression in Enterococcus faecalis. J Bacteriol
182:4512–4520
Gibson CM, Mallett TC, Claiborne A, Caparon MG (2000) Contri-
bution of NADH oxidase to aerobic metabolism of Streptococcus
pyogenes. J Bacteriol 182:448–455
Graham MR et al (2006) Analysis of the transcriptome of group A
Streptococcus in mouse soft tissue infection. Am J Pathol
169:927–942
Guillot A, Gitton C, Anglade P, Mistou MY (2003) Proteomic
analysis of Lactococcus lactis, a lactic acid bacterium. Proteo-
mics 3:337–354
123
Arch Microbiol (2008) 189:27–41
Harder W, Dijkhuizen L (1983) Physiological responses to nutrient
limitation. Annu Rev Microbiol 37:1–23
Helmann JD, Moran CP (2002) RNA polymerases and sigma factors.
ASM Press, Washington DC
Hew CM, Korakli M, Vogel RF (2006) Expression of virulence-
related genes by Enterococcus faecalis in response to different
environments. Syst Appl Microbiol 30(4):257–267
Hua Q, Yang C, Oshima T, Mori H, Shimizu K (2004) Analysis of
gene expression in Escherichia coli in response to changes of
growth-limiting nutrient in chemostat cultures. Appl Environ
Microbiol 70:2354–2366
Johansson BP, Levander F, von Pawel-Rammingen U, Berggard T,
Bjorck L, James P (2005) The protein expression of Strepto-
coccus pyogenes is significantly influenced by human plasma. J
Proteome Res 4:2302–2311
Jungblut PR et al (2000) Comparative proteome analysis of Helicob-
acter pylori. Mol Microbiol 36:710–725
Kang CM, Abbott DW, Park ST, Dascher CC, Cantley LC, Husson
RN (2005) The Mycobacterium tuberculosis serine/threonine
kinases PknA and PknB: substrate identification and regulation
of cell shape. Genes Dev 19:1692–1704
Kreikemeyer B, McIver KS, Podbielski A (2003) Virulence factor
regulation and regulatory networks in Streptococcus pyogenes
and their impact on pathogen-host interactions. Trends Microbiol
11:224–232
Lee KJ, Bae SM, Lee MR, Yeon SM, Lee YH, Kim KS (2006)
Proteomic analysis of growth phase-dependent proteins of
Streptococcus pneumoniae. Proteomics 6:1274–1282
Len AC, Harty DW, Jacques NA (2004) Stress-responsive proteins
are upregulated in Streptococcus mutans during acid tolerance.
Microbiology 150:1339–1351
Lithgow JK, Hayhurst EJ, Cohen G, Aharonowitz Y, Foster SJ (2004)
Role of a cysteine synthase in Staphylococcus aureus. J Bacteriol
186:1579–1590
Lyon WR, Madden JC, Levin JC, Stein JL, Caparon MG (2001)
Mutation of luxS affects growth and virulence factor expression
in Streptococcus pyogenes. Mol Microbiol 42:145–157
Malke H, Steiner K, McShan WM, Ferretti JJ (2006) Linking the
nutritional status of Streptococcus pyogenes to alteration of
transcriptional gene expression: the action of CodY and RelA.
Int J Med Microbiol 296:259–275
Neely MN, Lyon WR, Runft DL, Caparon M (2003) Role of RopB in
growth phase expression of the SpeB cysteine protease of
Streptococcus pyogenes. J Bacteriol 185:5166–5174
Neijssel OM, Snoep JL, Teixeira de Mattos MJ (1997) Regulation of
energy source metabolism in streptococci. Soc Appl Bacteriol
Symp Ser 26:12S-19S
Neuner JM, Hamel MB, Phillips RS, Bona K, Aronson MD (2003)
Diagnosis and management of adults with pharyngitis. A cost-
effectiveness analysis. Ann Intern Med 139:113–122
Reva ON et al (2006) Functional genomics of stress response in
Pseudomonas putida KT2440. J Bacteriol 188:4079–4092
Shelburne SA 3rd, Sumby P, Sitkiewicz I, Granville C, DeLeo FR,
Musser JM (2005) Central role of a bacterial two-component
gene regulatory system of previously unknown function in
pathogen persistence in human saliva. Proc Natl Acad Sci USA
102:16037–16042
Steiner K, Malke H (2000) Life in protein-rich environments: the
relA-independent response of Streptococcus pyogenes to amino
acid starvation. Mol Microbiol 38:1004–1016
Voyich JM et al (2003) Genome-wide protective response used by
group A Streptococcus to evade destruction by human polymor-
phonuclear leukocytes. Proc Natl Acad Sci USA 100:1996–2001
Wick LM, Quadroni M, Egli T (2001) Short- and long-term changes
in proteome composition and kinetic properties in a culture of
Escherichia coli during transition from glucose-excess to
Arch Microbiol (2008) 189:27–41 41

glucose-limited growth conditions in continuous culture and vice
versa. Environ Microbiol 3:588–599
Wilkins JC, Homer KA, Beighton D (2002) Analysis of Streptococcus
mutans proteins modulated by culture under acidic conditions.
Appl Environ Microbiol 68:2382–2390
Woodbury RL, Wang X, Moran CP Jr (2006) Sigma X induces
competence gene expression in Streptococcus pyogenes. Res
Microbiol 157:851–856

123