Professional Documents
Culture Documents
CONCISE REPORT
B
ehçet’s disease (BD) is a complex chronic and relapsing acrylamide gel, and 1–4 ml of amplified product was directly
inflammatory disorder that has been extensively described submitted to sequencing in both directions with M13 universal
in young adults from Eastern Asia and Mediterranean primers using the Big Dye Terminator V.3.1 kit (Applied
countries. Its essential manifestations are oral and genital Biosystems, Foster City, California, USA), following the manu-
ulcerations, folliculitis, erythema nodosum and uveitis. The facturer’s suggestions. Sequencing products were run on an ABI
presence of vasculitis worsens the prognosis, introducing the Prism 3100 Genetic Analyzer (Applied Biosystems). MVK exon 11
potential for life-threatening complications such as throm- was amplified using 1176 and 1381 primers6 and the PCR
bophlebitis, arterial aneurysms and occlusion. The aetiology of
fragments were digested with BsmA1 to examine V377I, the most
BD is unknown. Because BD shares clinical similarities with frequent hyperimmunoglobulinemia D and periodic fever syn-
certain well-recognised autoinflammatory disorders, we won-
drome (HIDS) mutation.)
dered whether the gene responsible for familial Mediterranean
The two known PAPA mutations were analysed by PCR
fever (MEFV) could be involved. We have previously demon-
amplification using primers PST10FM13 (tgtaaaacgacggccag-
strated a higher frequency of MEFV mutations in patients with
tactgggcttccagcagagag) and PST10RM13 (caggaaacagctatgacct-
BD, with respect to their ethnicity.1 Other groups have
gagctgctgaggcctgaga), followed by sequencing in both directions
confirmed these data and found an association between the
for mutation A230T, and primers PST11FM13 (tgtaaaacgacggc-
presence of MEFV mutations and the severity of vasculitis.2
cagtcacaatggcctgtgaggag) and PST11RM13 (caggaaacagctatgac-
Recently, the R92Q mutation in the TRAPS (tumour necrosis
caagggagctgtgagctac), followed by BstN1 digestion for mutation
factor receptor-associated periodic syndrome) gene, which is
E250Q.
responsible for another defect of innate immunity, was reported
to have increased in patients with BD.3 In view of these
findings, and because BD is a multifactorial disease, we decided Abbreviations: BD, Behçet’s disease; CAPS, cryopyrin-associated periodic
syndromes; CIAS1, cold-induced autoinflammatory syndrome 1; HIDS,
to test additional autoinflammatory genes—namely mevalo- hyper IgD syndrome; FMF/MEFV, familial Mediterranean fever MKD,
nate kinase (MVK), cold-induced autoinflammatory syndrome mevalonate kinase deficiency; MVK, mevalonate kinase; PAPA, pyogenic
1 (CIAS1) and proline/serine/threonine phosphatase-interact- sterile arthritis, pyoderma gangrenosum and acne; PSTPIP1, proline/
ing protein 1 (PSTPIP1)—responsible for mevalonate kinase serine/threonine phosphatase interacting protein 1
www.annrheumdis.com
Gene mutations in Behçet’s disease 833
In FEVERS11
Diseases Paediatric BD, Non paediatric BD, In this study Frequency of data
(transmission) Genes n = 32 n = 65 n = 51 mutations in controls
BD, Behçet’s disease; CAPS, cryopyrin-associated periodic syndromes; CIAS1, cold-induced autoinflammatory
syndrome 1; MKD, mevalonate kinase deficiency; MVK, mevalonate kinase; PAPA, pyogenic sterile arthritis, pyoderma
gangrenosum and acne; PSTPIP1, proline/serine/threonine phosphatase interacting protein 1.
*c.741+33_741+34insertGT.
www.annrheumdis.com
834 Koné -Paut, Sanchez, Quellec, et al
Table 2 Clinical features of patients with Behçet’s disease carrying autoinflammatory gene mutations
Age at onset Age at diagnosis
Patient number Genes Mutations Gender Country (years) of BD (years) Clinical features
BD, Behçet’s disease; CIAS1, cold-induced autoinflammatory syndrome 1; F, female; MKD, mevalonate kinase deficiency; M, male.
www.annrheumdis.com