What is DNA and What does it do?

DNA contains information

Traits: an inherited characteristic controlled by genes found on DNA
Chromosomes
Structural unit containing part or all of an organisms genome consisting of
DNA and its associated proteins
Pairs
One of the pair is inherited from the father and one from the
mother, in sexually reproducing organisms.
•These pairs are called Homologus pairs

Karyotype
A pictorial arrangement of a full set of an organisms chromosomesIn
humans there are 22 pairs of autosomes and 1 pair of sex chromosomes

Chromatids
One of the two identical strands of chromatin or half of a replicated
chromosome
Genes
A segment of a chromosome that carries specific information about a trait.
A gene contains information about anything your body needs.
Sometimes genes carry mutations that cause disease or changes in traits.
How do genes detirmine traits?
Here is a piece of a chromosome: Each word represents a gene:
grow make black insulin heart strong hair muscle
If this chromosome is in your pancreas, the cell reads the genes: make
insulin
If this chromosome is in your scalp it reads:
grow black hair
If this chromosome is in your heart it reads:
make strong muscle
Chromatin
DNA wrapped around proteins
DNA
Deoxyribonucleic acid: The primary information bearing molecule of life.
Composed of two chains of nucleotides linked together in the form of a
double helix.
The Genome
A complete collection of a species genetic information
DNA Manages information
DNA stores information
DNA duplicates information when needed
DNA Transfers and decodes information when needed
Transfers information to the next generation

Stores information
The structure itself is the storage of information. Set of three bases on DNA
is called a codon.
A codon is like a word in a sentence.
The gene is the sentence
Duplicates information
DNA replicates itself when the cell divides.
Therefore it passes along the information to the new cell.
Transfers and decodes information
Through special processes in the cell, DNA transfers and decodes the
information that the cell requires to manufacture what it needs.
Transfers information to the next generation
Information contained in the DNA from two individuals combines to form a
new unique individual.
DNA Structure
Nucleotide: consists of a sugar, phosphate and a base
Nucleotides are bonded together into a long “thread” called the backbone.
Two backbones are then bonded together at the bases forming a ladder
The ladder it futher twisted into a spiral
Bases in DNA
A-------T
G-------C
Adenine “A”
Thymine “B”
Cytosine “C”
Guanine “G”
Base order is important!
The base order is the code for important substances the organism needs and
carries information about the traits.
grow make black insulin heart strong hair muscle
Each word is composed of a specific order of bases:
grow may be ACTTGTGCCATG
make may be TTGGCGGTGCAGTC
insulin may be AGGGGCTCTCTGAGTGTACGGAGA
Mutation
Any change in the order of bases
Insertion
Deletion
Substitution
Transposition
DNA Replication
Enzyme “unzips” DNA like a zipper.
Enzyme adds new nucleotides to each side of the zipper
Two new strands of DNA are formed. Each strand is identical….unless????
Mitosis
The separation of a cell’s duplicated/replicated chromosomes prior to the
cell physically spitting
DNA becomes condenses and becomes visible
Nuclear membrane begins to break down
Chromosomes line up on the equator of the cell
Chromatids face opposite poles
Chromatids separate,
Chromosomes reach poles
Cytokinesis
Cell tightens in center
Tightens until membranes touch each half forms a new cell.
DNA decondenses, nuclear membrane reforms
Daughter cells form
Plant cell Mitosis
Prokaryotic cell division
Plasmids
Transfer antibiotic resistance!
Variations
Brain and nerve cells form in embryos and then never divide.
Many leaf cells: divide as young leaves, stop dividing and simply increase in
size by growing
Bone marrow cells:divide rapidly: forming as many as 20,000 new
cells/minute
Cancer
Two part Failure in the Cell cycle
Part I
Protooncogenes (“before cancer”)
They control the checkpoints in the cell cycle and cell division:
G1: cell size, function, regulators, available nutrients
G2: DNA replication, cell size
Metaphase: chromosomes lined up correctly
Mutations in Protooncogenes
Mutations in the DNA of protooncogenes cause them to become oncogenes
Cause an overstimulation of cell division and overrides the checkpoints in
cell cycle
Part II
Supressor genes: P53 gene
Gene that carry instructions to stop cell cycle and division when conditions
are not favorable
Can detect and repair damage to DNA or tell cell to commit suicide if the
damage is not fixable
Mutations to P53 allow cell to divide continuously, passing along any
mutations present.
Cancer cells
Mutated oncogenes found in 30% of all cancers
Mutated P53 genes found in 50% of all cancers
Cancer process: ovarian cancer
Normal cells: protooncogenes and P53 genes regulate the ovarian cells.
Normal cell growth and division occurs.
Mutation to Protooncogenes
Normal protooncogene becomes mutated: called HER2 (now an oncogene)
Cell division is overstimulated.
Suppressor genes may override oncogene, repair DNA damage and suppress
tumor growth.
Mutation to P53
Mutation of P53, called BRCA 1 and 2 genes
Genes do not supress and repair DNA damage.
Cells divide continuously and pass along DNA damage
Cancerous Tumor form
Benign Tumors
Tumors of large numbers of cells that continue to grow.
Remain localized
Malignant Tumors
Angiogenisis: the ability to cause blood vessels to reroute to feed the growth
of rapidly dividing cells.
Problems
Malignant tumors
Normal cells stop dividing when in contact with other cells, Contact
Inhibition.
Normal cells need some contact with an underlayer in order to remain in
place, Anchorage dependance
Normal cells divide only 70-100x.
Malignant cells: No contact inhibition or anchorage dependance
Immortal
Metastasis
Anchorage dependance keep cells in their appropriate locations
Mutation of the normal genes, called Metastasis Genes allow the cells to
break off and relocate to another part of the body.
Normal cells
1.Protooncogenes: control cell division
2.Suppressor genes: repair and suppress growth or cause cell suicide
3.Anchorage dependance: maintain cells in appropriate location
4.Limited lifespan
Cancer Cells
1. Oncogenes: cause uncontrolled cell division
2. Suppressor genes: uable to turn off growth, repair DNA or cause cell
suicide
3. Metastasis genes: cause cells to migrate
4. Immortal
Detecting Cancer
Risk factors: Chemicals, Sun exposure, nutrition and health, age
Genetic Testing: looking for mutations
Detecting chemicals in the blood: certain cancer cells secrete proteins that
are detectable in the blood
Biopsy: take a portion of tumor and examine the cells
Treating cancer
Removing the Tumor
Treating Cancer
Chemotherapy: highly toxic chemicals that will kill cells.
Mustard gasses first used, discovered during WWII. Now, many types of
agents used
Cancer cells become resistant at 1 cell per million. Average tumor contains
1 billion cells, ~1000 resistant cells.
Potential cause of cancer
Pallative, Curative , Adjuvant
Treating Cancer
Radiation therapy: high energy radiation pointed at tumor cells will destroy
DNA, therefore destroying the cell
Pallative, Curative , Adjuvant
Potential cause of cancer
The Immune System’s role in Cancer
Cancer cells can sometimes be recognized by the immune system and T-
cells can mount an attack and destroy cancerous cells.
Immune system may become less effective at finding and destroying cancer
cells as we age.
Cancer cells are part of the body and sometimes do not cause a strong
immune response.
Many tumors secrete substances that suppress the immune system.
Preventing Cancer
Sun exposure
Chemical exposure
Diet/nutrition
Exercise
Genetic testing
Vaccines: New frontier in preventing Cancer: Genital Herpes vaccine
Age?????