3106 Electrophoresis 2004, 25, 3106–3116

Ying Huang Multiple sample amplification and genotyping

Jack Shirajian
Astrid Schroder integrated on a single electronic microarray
Zuxu Yao
Tamara Summers We report a novel method that allows simultaneous in situ amplification and then gen-
Dalibor Hodko otyping of single nucleotide polymorphism (SNP) for multiple samples on a single
Ron Sosnowski electronic microarray. The locus coding for one of the common inherited thrombosis
risk factors, Factor V Leiden (FVL), was chosen as a model system for SNP analysis.
Nanogen Inc.,
This method combines strand displacement amplification (SDA) with electrophoretic
San Diego, CA, USA
movement and concentration of DNA on electronic microarrays to provide a single
platform for DNA amplification and analysis. The method includes: electronic anchor-
ing of allele-specific SDA amplifiable primers (APs) and a nonamplifiable primer (NAP)
to different electrodes, electronic hybridization of genomic DNA from different samples
to those primers, in situ amplification of target DNA, and genotyping of FVL. Compared
to previous anchored SDA methods, the addition of a NAP improves detection signals
by at least 20-fold. The sensitivity of this method is dependent on the amplification
time. Using this method, nine different genomic DNA samples with known FVL geno-
types were amplified and correctly genotyped on a single electronic microarray without
any contamination between samples. The present method could streamline develop-
ment of nucleic acid-based assays in applications of molecular diagnostic, point-of-
care testing, and forensic detection, which often require the capability to analyze mul-
tiple samples efficiently.

Keywords: Electronic microarray / Factor V Leiden mutation / Genotyping / Miniaturization /

Multiplex samples / Single nucleotide polymorphism DOI 10.1002/elps.200406075

1 Introduction Electronic microarrays have the potential to provide such

DNA microarrays and microchips represent new technol-
ogies that allow many important molecular biological
analyses to be performed in a fast and comprehensive
way. Some massively parallel microarray chips permit
thousands of gene profiles to be monitored simultaneously
on DNA microarrays [1]. With other microfluidic chips DNA
size separation can be realized in seconds on electropho-
retic microchips [2, 3]. However, both technologies mainly
serve as detection platforms for molecular biological
analyses, often requiring some off-chip DNA sample pre-
parations such as amplifying DNA using polymerase chain
reaction (PCR). Therefore, technologies integrating multi-
ple molecular processing steps on a single platform are
needed to streamline molecular biological analyses and
move DNA chips from the exclusive realm of research.
Correspondence: Dr. Ying Huang, Nanogen, 10398 Pacific Cen-
ter Court, San Diego, CA 92121, USA
E-mail: yhuang@nanogen.com
Fax: 1858-410-4650
Abbreviations: AP, amplification primer; FVL, Factor V Leiden;
NAP, nonamplifiable primer; SDA, anchored strand displacement
amplification; SNP, single-nucleotide polymorphism
technologies. An electronic microarray utilizes an electric
field to facilitate the rapid transport and selective
addressing of DNA probes/targets to any electrode posi-
tion on the array surface [4, 5]. Use of an electric field to
concentrate DNA achieves the acceleration of com-
plementary strand hybridization. It can also facilitate the
rapid discrimination of single-base mismatches [6]. Be-
cause of its unique capability, electronic microarray tech-
nology provides a platform for a variety of applications
including single nucleotide polymorphism (SNP) analysis
[7], forensics analysis [8], biowarfare agent detection [9,
10], cell separations [11, 12], and gene expression analy-
sis [12, 13]. Recently, a multiplex amplification method,
which combines strand displacement amplification (SDA)
and the electronic microarray by anchoring SDA primers
in distinct locations on the microarray, hybridizing target
DNA, and performing in situ SDA on the microarray, has
been demonstrated to amplify multiple genes on elec-
tronic microarrays [14, 15].
Unlike PCR, SDA is an isothermal amplification tech-
nique. An additional difference is the requirement for the
combined actions of a restriction endonuclease and DNA
polymerase to amplify DNA target through a repeated

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Electrophoresis 2004, 25, 3106–3116 Simultaneous amplification and genotyping of SNP 3107

nicking-extension-strand displacement procedure: the 2 Materials and methods

restriction endonuclease nicks a hemi-modified recogni-
tion site and the polymerase displaces a downstream
strand during extension [16]. The isothermal feature has
made SDA a better candidate for developing an in situ
amplification on a microarray system, since it is not nec-
essary to develop instrumentation with precise control of
rapid temperature changes. An additional advantage is
that it is a very rapid method, with some loci yielding
detectable target in as little as 30 min [14].
Electronic microarrays create spatially separated amplifi-
cation reaction sites by permitting amplification primers to
be addressed to selected electrodes. This provides dis-
tinct amplification locations on the electronic arrays since
the biotin-labeled primers become anchored to discrete
electrodes. Subsequently, the target DNA may be elec-
tronically addressed and hybridized to all or a subset of the
previously selected electrodes. The unique combination of
SDA and electronic microarrays has made anchored SDA
a powerful method for multiplex molecular analyses, an
application formerly limited largely to multiplex PCR [17].
We present here findings that represent a step forward in
the integration and automation of DNA testing. This has
been accomplished through the use of anchored SDA,
which allows simultaneous in situ amplification and then
genotyping of SNP Factor V Leiden (FVL) from different
DNA samples on a single electronic microarray. FVL
mutation occurs when guanine (G) alters to adenine (A) in
position 1691 of the blood coagulation factor V gene [18].
This mutation is one of the common inherited thrombosis
risk factors and has a prevalence of 2–5% in US and Eu-
ropean populations [19]. We demonstrate the ability to
simultaneously amplify and genotype the FVL locus from
2.1 Enzymes and oligonucleotides
Restriction endonucleases AvaI and polymerase Bst were
purchased from New England Biolabs (Beverly, MA,
USA). The sequences of the oligonucleotides used in
anchored SDA assays are given in Table 1. SDA amplifi-
able primer (AP) (forward and reverse) and nonamplifiable
primer (NAP) are biotinylated (Integrated DNA Technolo-
gies, ITD, Coralville, IA, USA) for attachment to streptavi-
din in the permeation layer of the electronic microarray.
Both APs contain the AvaI recognition sequence CTC
GGG (underlined in Table 1), which is nicked when the
duplex is hemimethylated or contains a thiol-modified
nucleotide. NAP does not contain AvaI recognition
sequence and therefore the extension from the 3’-end of
NAP produces a target strand that can not be nicked.
Both nonbiotinylated bumper primers (forward and
reverse), which are additional primers for initialization of
SDA reaction [14–16], were purchased from IDT. The FVL
reporter system contained several oligonucleotides with
the sequence and relationship listed in Table 1. FVL sta-
bilizer, which is complementary to the target strand and
the terminal nucleotide at the 5’-end is immediate down-
stream of the SNP to be analyzed, was provided by
Nanogen (San Diego, CA, USA). Both wild-type and
mutant discriminators (Nanogen) contain sequences
complementary to the appropriate SNP genotype (bold in
Table 1) at the 3’-terminals, and sequences (underlined in
Table 1) complementary to the appropriate Universal
Reporters [20] at 5’-terminals. The Universal Reporters
(Nanogen) are labeled at the 3’-terminals with Alexa 532
(green emission) for wild-type and Alexa 647 (red emis-

Miniaturization
nine different DNA samples on one single electronic sion) for mutant. We took advantage of base-stacking
microarray, an important milestone towards the develop- energy transfer techniques to report and discriminate FVL
ment of useful sample-to-answer devices. [8, 15, 20]. Base-stacking reporters were used such

Table 1. Oligonucleotides for FVL-anchored SDA and analysis

Function Sequence

SDA forward AP
SDA reverse AP
SDA NAP
SDA forward Bumper
SDA reverse Bumper
Wild-type universal reporter
Wild-type discriminator
Wild-type reference
Stabilizer
Mutant reference
Mutant discriminator
Mutant universal reporter
5’-Bio-CAT CAT GAG AGA CAT CGC CTC CTC GGG AAT AGG ACT AC-3’
5’-Bio-AAA TTC TCA GAA TTT CTG AAA CTC GGG TTC AAG GAC AA-3’
5-Bio-ACT TCT AAT CTG TAA GAG CAG ATC CCT-3’
5’-ACT ACA GTG ACG TGG ACA TC-3’
5’-TGT TAT CAC ACT GGT GCT AA-3’
5’-CTCAATGTTCGGACTCAG-Alexa532–3’
3’-CTCCTTATGTCCTGAGTTACAAGCCTGAGTC-5’
5’-Bio-GGACTACTTCTAATCTGTAAGAGCAGATCCCTGGACAGGCGAGGAATACAGGTATTT-3’
3’-ATTAGACATTCTCGTCTAGGGACCTGTCCG-5’
5’-Bio-GGACTACTTCTAATCTGTAAGAGCAGATCCCTGGACAGGCAAGGAATACAGGTATTT -3’
3’-TTCCTTATGTCCTACAGTTCGCTATATGACG-5’
5’-TGTCAAGCGATATACTGC-Alexa647–3’

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

3108 Y. Huang et al.
that the 3’-end of the discriminators would base stack
alongside the stabilizer. If the amplified target presented a
perfect match to the discriminator, then the base-stack-
ing energies between the stabilizer and the discriminator
would be favorable, allowing the discriminator to remain
hybridized to the amplified target at elevated tempera-
ture. However, if the amplified target presented a mis-
match to the discriminator, then the base-stacking energy
of the stabilizer would be absent, allowing removal of the
discriminator at elevated temperature. FVL Ratio Refer-
ences (Oligos Etc., Wilsonville, OR, USA), which are bio-
tinylated synthetic oligonucleotides equivalent to the tar-
get strand sequence in the SNP region, were used for
determining a standard for relative fluorescence.
2.2 DNA samples
Genomic DNA was prepared from human whole blood
from San Diego Blood Bank (San Diego, CA, USA), using
Qiagen Midi DNA Kit (Qiagen, Valencia, CA, USA). The pu-
rified DNA was then desalted using Millipore MultiScreen-
PCR desalting plates (Millipore, Bedford, MA, USA) and
resuspended in deionized H2O. The desalted DNA sam-
ples were stored at 2207C until use. The genotypes of nine
different DNA samples (Mut S1, Mut S2, Het S1, Het S2,
Het S3, Wt S1, Wt S2, Wt S3, and Wt S4) for Factor V were
determined by sequencing analysis (Retrogen, San Diego,
CA, USA) of the PCR products from each sample.
2.3 Nanochip Electronic Microarray and
Molecular Biological Workstation
Both Nanochip Electronic Microarray and Molecular Biol-
ogy Workstation were obtained from Nanogen (San
Diego, CA, USA). The electronic microarray has been
described in detail elsewhere [5, 13]. Briefly, each elec-
tronic microarray contains 100 platinum microelectrodes
(80 mm in diameter and 200 mm center-to-center spacing)
laid out in a 10610 grid, surrounded by auxiliary outer
electrodes as counter electrodes. Each microelectrode,
served as a test site, can be individually biased with cur-
rent or voltage to carry a positive or negative electronic
charge. Electronic addressing and hybridization are per-
formed by applying a positive direct current (DC) bias to
one or more selected microelectrodes; outer electrodes
are countercharged to create the electric field necessary
to transport and concentrate the negatively charged
nucleic acids in the bulk solution to specific test sites. The
electronic microarray is also covered with a thin hydrogel
permeation layer containing streptavidin [5, 13], allowing
retention of biotinylated molecules (e.g., SDA primers)
after the electric field is discontinued. Operations of
 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Electrophoresis 2004, 25, 3106–3116
electronic microarrays are automatically controlled by the
Nanochip Molecular Biological Workstation. The work-
station consists of three major subsystems: (i) the Loader
for electronically addressing the microarray, (ii) the
Reader, a laser-based fluorescence scanner for detection
of assay results, and (iii) computer hardware and software
for controlling and analyzing the data. The Loader con-
tains a 96- or 384-well plate holder, a robotic arm, syringe
pumps for performing wash between addressing, and a
microarray tray, which can hold up to four Nanochip
electronic microarrays. Using a Loader map programmed
by a user, samples can be transferred from a 96- or 384
well plate to the microarray by the robotic arm and then
addressed to selected microelectrode. The Reader
accommodates a laser-excited two-color fluorescence
(635 nm and 532 nm) system, syringe pumps for per-
forming wash, and a temperature-controllable microarray
tray for holding one Nanochip electronic microarray. Each
microelectrode can be scanned with both colors at cer-
tain temperature through a programmed Reader protocol.
2.4 Anchored SDA assay
The scheme for anchored SDA comprises four steps:
(i) addressing SDA primers and genomic DNA, (ii) an-
chored SDA, (iii) denaturing SDA products, and (iv) de-
tection and data analysis (Fig. 1).
2.4.1 Addressing SDA primers and genomic
DNA samples using loader
A primer set consisting of 50 nM forward and reverse APs
and 200 nM NAP in 50 mM histidine was addressed to
selected electrodes on the electronic microarray for 1 min
at 2 V using the Loader. Genomic DNA, which had been
heat denatured at 957C for 20 min, were addressed to
selective electrodes for 2 min at 2 V using the Loader.
These conditions yield electronically hybridized com-
plexes of primers with complementary sequences in the
genomic DNA. There was 3 times histidine wash between
each addressing. After addressing, the Nanochip elec-
tronic microarray was taken out from the Loader.
2.4.2 Anchored SDA
40 mL Enzyme Mix (containing 35.5 mM K2HPO4, pH 7.6,
40 mM KCl, 5 mM dCTPaS, 0.2 mM each dATP, dGTP, and
dTTP, 8 mM Mg(OAc)2, 50 nM each bumper primer, 500 U
restriction endonucleases AvaI, and 1.34 U Bst poly-
merase) was pipetted to cover the Nanochip electronic
microarray. The microarray was then incubated at 507C
for various times as indicated in the text.
Electrophoresis 2004, 25, 3106–3116
Figure 1. Schematic representation of anchored SDA (for
simplification, only a partial reaction is depicted). (A) Bio-
tinylated SDA primers are addressed to selected electrode
sites. Primer sets can include amplifiable and nonamplifi-
able oligonucleotides. Then denatured genomic DNA
(gDNA) is electronically concentrated at selected sites. (B)
A reaction mix including enzymes, a buffer and bumper
primer is placed in the flow cell. Primer extension and
nicking occur resulting in exponential amplification of tar-
get locus. (C) After the reaction is terminated and the
reaction mix is removed, the nonattached strand of the
amplification product is removed, leaving single-stranded
plus and minus strands of the target locus. (D) Reporter
Mix is then added to the flow cell. After hybridization,
stringency conditions are applied so that mismatch re-
porter is denatured but match reporter remains hybridized.
2.4.3 Denaturing SDA products
After anchored SDA, the Nanochip electronic microarray
was washed with deionized H2O before it was treated with
0.3 N NaOH for 5 min to denature in situ amplification prod-
ucts. The microarray was washed 3 times with 200 mL H2O.
 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Simultaneous amplification and genotyping of SNP 3109
2.4.3 Detection and data analysis using Reader
Reporter mix containing 1 mM stabilizer, 500 nM wild-type
discriminator, 500 nM mutant discriminator, 500 nM Alex-
532-labeled Universal Reporter, and 500 nM Alex-647-
labeled Universal Reporter oligonucleotides (Table 1) was
pipetted into the Nanochip electronic microarray. The
microarray was then placed in the Reader and the tem-
perature was set to ramp down from 567C to 307C, the
discrimination temperature, at which mismatched dis-
criminators were denatured and matched discriminators
remained hybridized due to difference in base-stacking
transfer energies (see Section 2.1). Unbound reporters
were subsequently removed with three washes of a high-
salt buffer containing 50 mM sodium phosphate and
500 mM sodium chloride (pH 7.0), and three washes of a
low-salt buffer containing 50 mM sodium phosphate
(pH 7.0). The microarray was cooled to 247C, and each
microelectrode was individually scanned by a 635 nM red
laser and a 532 nm green laser. The fluorescence signals
were then detected with the photomultiplier tube setting
at low gain and accumulation time at 1024 ms or by de-
termining the time required to reach a set fluorescence
level. After placing the Nanochip electronic microarray in
the Reader all steps were automatically controlled by
internal robotics and software. The fluorescent signals
were stored and analyzed. Signals on relevant micro-
electrodes were normalized against the signals on ratio
references electrodes and plotted as a mean value with
standard deviations. To determine the genotypes, the
ratio of two fluorescent signals (either green to red or red
to green) on each electrode is calculated. A homozygote
(either wild-type or mutant) genotype is determined when
the ratio is greater than 10, and a heterozygote genotype
call is made when the ratio is less than 2.
3 Results
3.1 NAP helps increase the signal
The principle of NAP is illustrated schematically in Fig. 2.
For simplicity, only one SDA primer is drawn. It is
important to note that SDA is not a synchronous pro-
cess and that different steps on the process can occur
simultaneously. Nicking can occur on an AP/target
complex without the polymerase encountering the nick
site and extending and displacing the target. That is the
condition depicted in Figs. 2A and B. In this case, a
complex that has been extended is nicked by the
restriction enzyme. If the reaction is stopped at this
point, the complex will appear as in Fig. 2B. When the
amplicons are subsequently denatured, the target
sequence is lost (Fig. 2C). Therefore, in the detection
3110 Y. Huang et al.
stage, the attached targets will consist of extensions from
a mixture of AP and NAP. Therole of NAP in the same cir-
cumstances can be seen in Figs. 2D–F. Unlike previous
anchored SDA [14, 15], biotinylated NAP is also anchored
to the electrode along with AP during primer addressing.
This biotinylated NAP would hybridize with displaced tar-
get sequence that it encountered from the solution. Poly-
merase would extend the sequence from the primer/tar-
get hybrid, creating an attached strand that would be
complementary for the reporter probes. Since it cannot
be nicked, the target sequence strand is not lost after
denaturation.
To test this model, a series of experiments were per-
formed. First, different ratios of AP/NAP were tested for
their ability to produce detectable amplicons (Fig. 3) in a
60 min amplification. In previous work, 60 min was deter-
mined to be the optimal time for amplification with AP
primers alone (not shown). Three concentrations of AP
without NAP were tested to find a baseline concentration
for that reagent. As seen in Fig. 3, 50 nM AP yields good
results and that concentration was selected for further
experimentation. Primer sets were addressed that had
increasing concentrations of NAP ranging from 25 to
1000 nM. The data shows that an optimal AP/NAP ratio for
amplification in these conditions was between 50/50 and
50/200. A concentration ratio of 50/200 was selected for
the remainder of this work.
 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Electrophoresis 2004, 25, 3106–3116
Figure 2. Model for the role of
the NAP in anchored SDA.
These cartoons model what
occurs with a primer containing
a nick site (amplifiable primer)
versus one without (NAP). (A),
(D) Each primer may be exten-
ded by polymerase after a tem-
plate has been hybridized. (B)
The amplifiable primer is acted
upon by the restriction enzyme
AvaI under conditions that result
in a single-strand nick. (E) Nick-
ing cannot occur on the NAP. (C)
Upon application of denatura-
tion conditions, the template
and the nicked target strand will
be removed from the test site.
(F) Target sequence poly-
merized from a NAP remains
attached to the test site.
Figure 3. Effect of AP/NAP ratios on detectable ampli-
fication product. Different concentration ratios of AP
and NAP were addressed to selected electrodes in the
array. Equal amounts (10 ng/mL) of wild-type genomic
DNA were then hybridized to the primer containing
electrodes. The resulting complexes were amplified for
60 min, then denatured and analyzed for the presence
of the attached target strand. To accommodate the
broad dynamic range of this experiment, relative fluo-
rescence was determined by measuring the time
required for the instrument to detect a fixed amount of
fluorescence. Therefore the fluorescence values differ
from other experiments. RR is the FVL Ratio Refer-
ences.
Electrophoresis 2004, 25, 3106–3116
In a second series of experiments, it was determined that
the addition of NAP to the primer set could increase the
sensitivity threshold for anchored SDA. Primer sets with
and without NAP were addressed to different electrodes
on a Nanochip electronic microarray. Genomic DNA at a
concentration of either 2 or 20 ng/mL was then electro-
nically hybridized to selected primer-addressed elec-
trodes. After a 60 min SDA reaction, signals were detect-
ed on the Reader. As shown in Fig. 4, target sequence
could be detected from 2 ng/mL concentration of genomic
DNA with an AP/NAP primer set, but not with AP primers
alone. Previous work determined that the lower threshold
for detection of target in genomic DNA was 10 ng/mL (not
shown). Also, a greater than 20-fold signal improvement
is observed with the NAP and 20 ng/mL gDNA.
Figure 4. NAPs lower the detection threshold for genomic
DNA. Primer sets with and without NAPs were addressed
to various electrodes. Genomic DNA at a concentration of
either 2 or 20 ng/mL was hybridized to electrodes with each
type of primer set. The AP/NAP ratio was 1:4. The resulting
hybrids were amplified and analyzed. The histogram illus-
trates the amount of fluorescence at the electrodes with
each type of primer set. RR is the FVL Ratio References.
a) This value is at or near saturation.
3.2 Effects of DNA concentration and
amplification time
To determine the relationship between genomic DNA
concentration and time of amplification, DNA at 1, 2, and
5 ng/mL were addressed to electrodes on six different
Nanochip electronic microarrays (Fig. 5). Individual micro-
arrays were subjected to 15, 30, 45, 60, 80, or 120 min of
amplification. DNA concentration of 1 ng/mL can only be
detected at amplification times of 60 min or greater. At
30 min, a 2 ng/mL is reaching the detection threshold and a
5 ng/mL sample is producing a robust signal. Interestingly,
signal decreases for all DNA concentrations between 80
and 120 min. This is likely due to some loss of target
sequence as depicted in Figs. 2A–C since 25% of the
addressed primer set is amplifiable primer.
 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Simultaneous amplification and genotyping of SNP 3111
Figure 5. Effects of amplification time and DNA con-
centration. Sets of SDA primers at AP/NAP ratio of 1:4
were addressed to various electrodes on six different
electronic microarrays. Genomic DNA at concentrations
of 1, 2, and 5 ng/mL was then hybridized to those primers.
Each DNA concentration was addressed to eight elec-
trodes per cartridge. The amplification was stopped at
various times (15, 30, 45, 60, 80, or 120 min) and the cor-
responding fluorescent signals were analyzed for the
presence of target sequence. The three curves corre-
spond to three different concentrations of genomic DNA
used for generating target hybridization complexes. Data
at each time point were taken from different cartridges.
Each data point is the mean value of the eight electrodes
with CV , 55%.
3.3 Multiple sample amplification
Although each electrode in the array can be individually
controlled by regulating the applied electric field, all elec-
trodes share a common solution. Therefore, experiments
were performed to determine if multiple samples could be
amplified simultaneously without cross-contamination
causing incorrect genotyping. In one experiment, primer-
only electrodes were placed adjacent to primer plus DNA
electrodes. Here, primer sets (AP/NAP at 1/4) were
addressed to 666 microelectrodes on a Nanochip elec-
tronic microarray and a DNA sample (10 ng/mL) was only
addressed to 18 electrodes in a checkerboard way
(Fig. 6A). Figure 6B is a pseudo-image of the results,
showing that amplification occurred mainly at the elec-
trodes that had been hybridized with DNA. The mean
fluorescent signals are plotted in Fig. 6C with standard
deviations. Although a slight amount of fluorescent signal
(mean = 95) is detected on primer only electrodes, it is
noticed the fluorescent signal on primer plus DNA elec-
trodes has reached the saturated value (= 1044). Thus,
the real percentage of the signals on primer-only elec-
trodes over the signals on primer plus DNA electrodes
could be less than 7.6% as indicated in Fig. 6C.
3112 Y. Huang et al. Electrophoresis 2004, 25, 3106–3116

Figure 6. Differences in anchored SDA signals between

adjacent hybridized and nonhybridized electrodes. (A)
Map of reagents addressed to electrode sites shown in
(B). Gray sites were addressed with primer sets only. Yellow sites were addressed with ratio reference control oligonu-
cleotides. Green sites were addressed with primers and then hybridized with wild-type genomic DNA. (B) Results after
anchored SDA. Detectable signal is seen mainly at sites with both primers and genomic DNA. (C) Histogram of data from
experiment described by C. RR is the FVL Ratio References.

Another experiment was conducted to place the primer-
only electrodes further away from the primer plus DNA
electrodes. Primer sets (AP/NAP at 1/4) were addressed to
nine different locations on a Nanochip electronic microarray
and a DNA sample (10 ng/mL) was only addressed to the four
electrodes in the center (Fig. 7A). Figure 7B is a pseudo-
image of the results. The mean fluorescent signal on primer-
only electrodes is 4 and the mean signal on primer plus DNA
electrodes is about 1237 with 3 out of 4 electrodes reaching
saturation value, indicating that amplification occurred only
at electrodes that had been hybridized with DNA if the
primer-only electrodes were placed further away (2 elec-
trodes distance) from the primer plus DNA electrodes.
Using similar addressing configuration (Fig. 7C), primer sets
(AP/NAP at 1/4) were addressed to nine different locations
on a Nanochip electronic microarray and nine different DNA
samples including three heterozygous, two mutant, and
four wild-type homozygous samples were addressed in
series to those nine locations with histidine wash between
each addressing. Each DNA sample was addressed to four
electrodes. Fig. 7D is a pseudo-image of the final results
after addressing, conducting SDA, and reporting. The mean
fluorescent signals for each sample are plotted in Fig. 7E
with standard deviations. Based on the mean values, all the
genotyping determinations are correct and can be made
unambiguously. It is noticed that one of the four green sig-
nals in the upper right corner for Wt S3, and two from the
cluster in the middle right side for Wt S4 are missing (Fig. 7D)
as reflected by the big standard deviations in Fig. 7E. Sev-
eral factors could cause this “missing” phenomenal: (i) var-
iations between different DNA samples due to extraction
procedure; (ii) multiple sample amplification not efficient
enough as single sample amplification, indicated by the
reduced fluorescent signals in Fig. 7E compared to the sig-
nals in Fig. 6C; (iii) variations between the physical proper-
ties of different electrodes.

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Electrophoresis 2004, 25, 3106–3116
3.4 Signal variations within and between
Nanochip electronic microarrays
Experiments were designed to compare the signal varia-
tions derived from the present anchored SDA method
with the method that directly addresses biotinylated PCR
products to Nanochip electronic microarray for detection
 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Simultaneous amplification and genotyping of SNP 3113
Figure 7. Anchored SDA at site clusters do not affect results
at genotypically variant clusters in the same array. (A) Map of
reagents addressed to electrode sites shown in (B). Gray
sites were addressed with primer sets only. Yellow sites were
addressed with ratio reference control oligonucleotides.
Green sites were addressed with primers and then hybridized
with wild-type genomic DNA. (B) Results after anchored
SDA. Detectable signal is seen only at sites with both primers
and genomic DNA. (C) Map of reagents addressed to elec-
trode sites shown in (D). All colored sites except yellow have
primer sets. Yellow sites have ratio reference controls. Red
sites have mutant genotype DNA hybridized to them. Green
sites have wild-type DNA. Purple sites have heterozygote
DNA. (D) Pseudo-image of the results from the experiment
outlined in (C). (E) Histogram of data from experiment
described by (C). RR is the FVL Ratio References.
[21]. To test the signal variations within and between
Nanochip electronic microarrays, four different micro-
arrays were used. On each microarray, three different
samples representing wild-type homozygous, mutant
homozygous and heterozygous genotypes were ad-
dressed in serial with ten electrodes per sample. After
addressing, anchored SDA and reporting, red and green
3114 Y. Huang et al.
fluorescent signals and the ratio values (either red to
green or green to red) on each of the ten electrodes were
calculated for mean and standard deviations in order to
determine the signal variations within a microarray
(Table 2). The mean fluorescent signal ratios for homo-
zygous (wild-type or mutant) samples range between 50
and 285, well above the genotyping determination value
of 10 (see Section 2.4.3). Thus for homozygous samples,
the signal variations within Nanochip electronic micro-
arrays are only measured by the fluorescent signals. As
listed in Table 2, these within-microarray signal variations
for homozygous samples are comparable to those re-
ported in [21] with a standard deviation , 232 (or coeffi-
cient of variance (CV) , 26%). For heterozygous samples,
the mean fluorescent signal ratios range between 1.3–1.4
with a standard deviation , 0.5 (or CV , 31%).
Signal variations between microarrays were measured by
the mean and standard deviations of the averaged fluo-
rescent signals and the ratios on each microarray for each
 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Electrophoresis 2004, 25, 3106–3116
sample. Again, the mean fluorescent signal ratios for
homozygous (wild-type or mutant) samples range be-
tween 141 and 206, and the fluorescent signals represent
signal variations between microarrays with a standard
deviation , 62 (CV , 7%). For heterozygous samples, the
mean fluorescent signal ratio between microarrays is 1.4
with a standard deviation 0.1 (CV = 5%). The signal var-
iations between microarrays are also comparable to
those reported in [21] where biotinylated PCR products
were addressed on Nanochip electronic microarrays.
4 Discussion
Anchored SDA, which combines an electronic microarray
with strand displacement amplification, has been demon-
strated for amplification of multiple loci on a single micro-
array [14, 15]. Because each electrode in the microarray
shares a common solution and target strands can be
released into solution during anchored SDA, there have
been concerns about expanding the utility of this method
to the analysis of multiple samples for the same locus. In
this manuscript, we have demonstrated the ability to
simultaneously amplify then analyze nine samples for the
same locus.
We also demonstrate the utility of a novel oligonucleotide,
an NAP for increasing the robustness of the anchored
SDA reaction. While this primer does not take part in the
logarithmic amplification of target sequence, it does line-
arly amplify the target by providing a primer from which a
hybridized template is copied. However, since this primer
has no recognition site for the nicking enzyme, each
primer is rendered nonamplifiable once it has been
extended. The advantage of NAP is to provide target
sequence that cannot be removed from the electrodes by
restriction enzyme cleavage. This reaction chain can be
thought of as a two-part system, where the amplifiable
primers exponentially synthesize a diffusible target
sequence product that populates NAP to ultimately yield
a stable captured product. For the FVL model system this
improved method increased the detection sensitivity by
20-fold relative to amplification without NAP. Another ad-
vantage of using NAP may be to limit the amount of diffu-
sible amplification product that can migrate beyond the
limits of an individual electrode. The NAP will hybridize
target sequence in solution that might otherwise con-
taminate adjacent electrodes. This is an important feature
for assays with multiple samples for the same locus.
The NAP method provides an additional parameter for
coordinating multiple locus amplifications. One of the dif-
ficulties in multiplexing loci for anchored SDA is finding
ways to get equivalent amplification yields for different
Electrophoresis 2004, 25, 3106–3116 Simultaneous amplification and genotyping of SNP 3115

Table 2. Within- and between- Nanochip electronic microarrays signal variations for FVL-anchored
SDA

Nanochip Sample Fluorescent signal Ratioa)

electronic
Mean 6 Std. Mean 6 Std.
microarray
(N =10) (N =10)
Red (R) Green (G) R/G or G/R

S7C8362-335 S1 (Wt) 865 1209b) 6 0 219b) 6 119

S2(Mut) 911 6 158 30 6 25 50 6 33
S3(Het) 382 6 220 405 6 301 1.3 6 0.2
S7C8362-340 S1(Wt) 763 1217b) 6 141 221b) 6 90
Within- S2(Mut) 889 6 232 9 6 11 285 6 290
microarray S3(Het) 296 6 118 347 6 211 1.4 6 0.3
S7C8362-341 S1(Wt) 11 6 8 1234b) 6 192 214b) 6 183
S2(Mut) 861 6 159 18 6 15 164 6 298
S3(Het) 449 6 172 330 6 102 1.5 6 0.5
S7C8362-343 S1(Wt) 10 6 6 1241b) 6 26 168b) 6 83
S2(Mut) 770 6 225 18 6 10 64 6 66
S3(Het) 491 6 136 428 6 194 1.4 6 0.3
Between- N=4 S1(Wt) 962 1125b) 6 15 206b) 6 25
microarrays S2(Mut) 857 6 62 19 6 9 141 6 109
S3(Het) 405 6 85 378 6 47 1.4 6 0.1

Data are from ten microelectrodes for each sample, S1, S2, and S3. Ratios were determined from the
red and green signal on an individual microelectrode.
a) Ratio values were calculated by dividing the highest fluorescence value by the lowest fluorescence
value (either red (R)/green (G) or G/R).
b) These green signals were at or near the camera saturation threshold. This will result in an under-
estimation of green signal for these samples. Therefore, the G/R ratios for these samples will be
underestimated.

sequences. Some adjustments can be made by regulat-
ing the amount of amplifiable primer addressed to locus
specific sites. The NAP method permits the ratio of AP/
NAP to be adjusted as well.
The variation of the data obtained with this method is
comparable to results reported in [21] where biotinylated
PCR products were addressed and detected on Nano-
chip Electronic Microarrays. While this level of variation
may be regarded as high relative to some other quantita-
tive methods [22], it is appropriate for a genotyping
application. The biologically significant result requires
determination of the presence or absence of a genetic
variant. Therefore, results do not need to disclose subtle
quantitative differences between samples. The critical
parameters for genotyping are passing the threshold
levels used to designate the alleles present in the sample.
The data presented here indicate that this method yields
results that clearly allow correct designations of geno-
type.
Additionally, the present method has the following three
unique characteristics in comparison to previous reported
anchored SDA method [14, 15]. First, this is the only
report so far of anchored SDA being performed on Nano-
chip Electronic Microarray using Molecular Biology
Workstation. Second, this is the first time that multiplex
samples were simultaneously amplified and genotyped
for same SNP, FVL, instead of multiple genes. Third, this is
the first time a universal reporter system [20] was used for
genotyping, as opposed to using specific reporters [15].
The present method could streamline development of
nucleic acid-based assays in applications of molecular
diagnostic, point-of-care testing, and forensic detection,
which often requires the multiplex capability.
This work was supported in part by a research grant from
National Institute of Justice (97-LB-VX-004). We would
like to thank Ms. Huong Tang, Drs. Antonio Reyes, and
Karen Menge for valuable discussion.
Received March 24, 2004

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

3116 Y. Huang et al.
5 References
[1] Chee, M., Yang, R., Hubbell, E., Berno, A., Huang, X., Stern,
D., Winkler, J., Lockhart, D., Morries, M., Fodor, S., Science
1996, 274, 610–614.
[2] Jabashini, M., Zhang, L., Dang, F., Xu, F., Almofli, M. R.,
Ewis, A. A., Lee, J., Nakahori, Y., Baba, Y., Electrophoresis
2002, 23, 1537–1542.
[3] Landers, J. P., Anal. Chem. 2003, 75, 2919–2927.
[4] Heller, M. J., Forster, A., Tu, E., Electrophoresis 2000, 21,
157–164.
[5] Guntner, C., Tu, E., Jamshidi, N., Haigis, R. W., Onofrey, T. J.,
Edman, C. F., Sosnowski, R., Wallace, B., Heller, M. J.,
Electrophoresis 2002, 23, 1543–1550.
[6] Sosnowski, R., Tu, E., Butler, W., O’Connell, J., Heller, M. J.,
Proc. Natl. Acad. Sci. USA 1997, 94, 1119–1123.
[7] Gilles, P., Wu, D., Forster, C., Dillon, P., Chanock, S., Nat.
Biotechnol. 1999, 17, 365–370.
[8] Radtkey, R., Feng, L., Muralhidar, M., Duhon, M., Canter, D.,
DiPierro, D., Fallon, S., Tu, E., McElfresh, K., Nerenberg, M.,
Sosnowski, R., Nucleic Acids Res. 2000, 28, E17.
[9] Ewalt, K. L., Haigis, R. W., Rooney, R., Ackley, D., Krihak, M.,
Anal. Biochem. 2001, 289, 162–172.
[10] Huang, Y., Ewalt, K. L., Tirado, M., Haigis, R., Forster, A.,
Ackley, D., Heller, M. J., O’Connell, J. P., Krihak, M., Anal.
Chem. 2001, 73, 1549–1559.
 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Electrophoresis 2004, 25, 3106–3116
[11] Cheng, J., Sheldon, E. L., Wu, L., Uribe, A., Gerrue, L. O.,
Carriono, J., Heller, M. J., O’Connell, J. P., Nat. Biotechnol.
1998, 16, 541–546.
[12] Huang, Y., Joo, S., Duhon, M., Xu, X., Anal. Chem. 2002, 74,
3362–3371.
[13] Weidenhammer, E. M., Kahl, B. F., Wang, L., Wang, L.,
Duhon, M., Jackson, J. A., Matthew, S., Xu, X., Clin. Chem.
2002, 48, 1873–1882.
[14] Westin, L., Xu, X., Miller, C., Wang, L., Edman, C. F., Neren-
berg, M., Nat. Biotechnol. 2000, 18, 199–204.
[15] Westin, L., Miller, C., Vollmer, D., Canter, D., Radtkey, R.,
Nerenberg, M.O’Connell, J. P., J. Clin. Microbiol. 2001, 39,
1097–1104.
[16] Walker, G. T., Little, M. C., Nadeau, J. G., Shank, D. D., Proc.
Natl. Acad. Sci. USA 1992, 89, 392–396.
[17] Markoulators, P., Siafakas, N., Moncany, M., J. Clin. Lab.
Anal. 2002, 16, 47–51.
[18] Dalback, B., Carlson, M., Svensson, P. J., Proc. Natl. Acad.
Sci. USA 1993, 90, 1004–1010.
[19] Bertina, R. M., Koeleman, B. P., Rosendaal, F. R., Dirven, R.
J., de Ronde, H. et al., Nature 1994, 369, 64–67.
[20] Cooper, K. L. F., Goering, R. V., J. Mol. Diagn. 2003, 5, 28–
33.
[21] Erali, M., Schmid, B., Lyon, E., Wittwer, C., Clin. Chem.
2003, 49, 732–739.
[22] von Ahsen, N., Schuts, E., Armstrong, V. W., Oellerich, M.,
Clin. Chem. 1999, 45, 694–696.