S.D.

PUBLIC SCHOOL, BU – BLOCK PITAMPURA

SUBJECT: MATHEMATICS
CLASS: XII

LINEAR PROGRAMMING PROBLEMS

1. If a young man rides his motorcycle at 25km/hour, he had to spend
Rs.2 per km on petrol. If he rides at a faster speed of 40km/hour, the

W
petrol cost increase at Rs.5 per km. He has Rs.100 to spend on petrol
and wishes to find what is the maximum distance he can travel in
one hour. Express this as an LPP and solve it graphically. (Ans.

HH
Maximum distance is 30km, 50/3 km at 25 km/hr and 40/3 km at 40
km/hr.)
2. An aeroplane can carry a maximum of 200 passengers. A profit of
Rs.400 is made on each first class ticket and a profit of Rs.300 is

IC XII
made on each second class ticket. The airline reserves at least 20
seats for first class. However at least, four times as many passengers
prefer to travel by second class than by first class. Determine how
many tickets of each type must be sold to maximize profit for the
AT SS
airline. Form an LPP and solve it graphically. ( 40 first class, 160
S
economy class)
3. A company uses 3 machines to manufacture and sell two types of
EM LA

shirts – half sleeves and full sleeves. Machines M1, M2 and M3 take 1
3
hour, 2hours and 1 hours to make a half sleeve shirt and 2 hours, 1
5
TH S C

3
hour and 1 hours to make a full sleeve shirt. The profit on each
5
half sleeve shirt is Re. 1.00 and on a full sleeve shirt is Rs. 1.50. No
machine can work for more than 40 hours per week. How many
shirts of each type should be made to maximize the company’s
MA .P.

profit? Solve the problem graphically. ( 10 half sleeves, 15 full

sleeves, Maximum profit = Rs. 32.50)
4. A toy manufacturer produces two types of dolls; a basic version doll
D

A and a deluxe version doll B. Each doll of type B takes twice as

S.

long to produce as one doll of type A. The company have time to

make a maximum of 2000 dolls of type A per day, the supply of
plastic is sufficient to produce 1500 dolls per day and each type
requires equal amount of it. The deluxe version, i.e. type B requires
a fancy dress of which there are only 600 per day available. If the
company makes a profit of Rs 3 and Rs 5 per doll, respectively, on
 doll A and B; how many of each should be produced per day in
order to maximize profit? Solve it by graphical method. (Ans:1000
dolls of type A and 500 dolls of type B should be produced to
maximize the profit and the maximum profit is Rs5500)
5. Kellogg is a new cereal formed of a mixture of bran and rice that
contains at least 88 grams of protein and at least 36 milligrams of
iron. Knowing that bran contains 80 grams of protein and 40
milligrams of iron per kilogram, and that rice contains 100 grams of

W
protein and 30 milligrams of iron per kilogram, find the minimum
cost of producing this new cereal if bran costs Rs. 5 per kg and rice
costs Rs 4 per kg. ( Ans: Rs. 4.6)

HH
IC XII
AT SS
S
EM LA
TH S C
MA .P.
D
S.
 ASSIGNMENT
CH-MATRICES
 x − y 2x + z   − 1 5 
Q1. If  2 x − = , find x,y,z,w.
 y 3z + w  0 13
(ANS: x = 1, y = 2, z = 3, w = 4 )
Q2. Find the value of x, y ,a, and b if
 2x − 3y a − b 3  1 − 2 3 
 1 =
 x + 4 y 3a + 4b   1 6 29 

W
(ANS: x = 2, y = 1, a = 3, b = 5 )
Q3. For what values of x and y are the following matrices

HH
equal?
 2x + 1 2y   x + 3 y 2 + 2
A=  , B =  
 0 y 2 − 5 y   0 −6 

IC XII
 x + 3 z + 4 2 y − 7  0 6 3 y − 2
   2x − 3 2c − 2  .Obtain
Q4. If  4 x + 6 a − 1 0  =  the values of
 b − 3 3b z + 2c   2b + 4 − 21 0 
a, b, c, x, y, and z.
AT SS
(ANS: a = − 2, b = − 7, c = − 1, x = − 3, y = − 5, z = 2 )
S
Q5. Give an example of
(i) a row matrix which is also a column matrix,
EM LA

(ii) a diagonal matrix which is not scalar,

(iii) a triangular matrix
TH S C

Q6. Construct a 2 × 3 matrix whose elements aij are given by

( i + j) ( i − j) ( i − 2 j)
2 2 2
2i − 3 j
(i) aij = (ii) aij = (iii) aij = (iv)
2 2 2 2
− 3i + j
(v)
MA .P.

aij =
2
Q7. Construct a 4 × 3 matrix whose elements aij are given by
i− j i
D

(i) aij = (ii) aij = i (iii) a ij = 2i +

i+ j j
 0 −1
S.

− 1  3 5 7 
 3 2  1 1 1  2 3
1   6 
2 
0 − 1 5 14
 3 5  2 2  3
(ANS:  1 1 , ,  15 )
0  3 3 3
9 7 
 2 5    2
3 4 4 4  
1 1   12 10 28 
 5 3 7   3
  x z  1 − 1  3 5
Q8. Find x, y, z ,t if 2  + 3  = 3 
 y t 0 2   4 6
(ANS: x = 3, z = 9, y = 6 and t = 6 )
 x2   x   − 2
Q9. Solve the matrix equation  y 2  − 3  2 y  =  9  .
     
(ANS: x = 1, 2 and y = 3 ± 3 2 .)
 6 − 6 0
Q10. Find matrices X and Y, if 2 X − Y =  − 4 2 1 and

W
 
 3 2 5 
X + 2Y =   .
 − 2 1 − 7

HH
 3 −2 1  0 2 2 
(ANS: X =  − 2 1 − 1 , Y =  0 0 − 3 )
   
Q11. Prove that the product of matrices
 cos 2 θ cos θ sin θ   cos 2 φ
cos φ sin φ 

IC XII
  and  cos φ sin φ  is the null matrix when
 cos θ sin θ sin 2 θ   sin 2 φ 
π
θ and φ differ by an odd multiple of .
2
AT SS
 1 − 1 a 1 
Q12. If A =  2 − 1 , B =  b − 1 and ( A + B ) = A2 + B 2 , find a and b.
2


S
  
(ANS: a = 1, b = 4 )
EM LA

 0 1
 − 1 0  , find x and y such that ( xI + yA ) = A .
2
Q13. If A =
 
 1 1   1 1   i i   i i 
TH S C

(ANS:  2 , 2  or  − 2 , − 2  or  2 , − 2  or  − 2 , 2  )
       
 2 − 1  5 2  2 5
Q14. Let A =  3 4  , B =  7 4  , C =  3 8 . Find a matrix D such
     
MA .P.

that CD − AB = 0 .
 − 191 − 110 
(ANS:  77 44  )
 
D

Q15. Find the value of ‘x’ such that:

 1 3 2  1 
S.

[ 1 x 1]  2 5 1   2 = 0 .
 15 3 2   x 
  2 − 1  − 1 − 8 − 10 
 1 0 A=  1 −2 −5
Q16. If    , find A.
 − 3 4   9 22 15 
 1 − 2 − 5
(ANS:  3 4 0  )
 
 2 0 1
Q17. Let f ( x ) = x − 5 x + 6 .Find
2
f ( A) if A =  2 1 3 .
 1 − 1 0 

W
 1 −1 −3
 
(ANS:  − 1 − 1 − 10 )

HH
 − 5 4 4 
 2 3
Q18. Let A =  − 1 2 and f ( x ) = x − 4 x + 7 .Show that f ( A) =
2
O .Use
 

IC XII
this result to find A5 .
 − 118 − 93 
(ANS: A
5
=   )
 31 − 118
Q19. Prove the following by the principle of mathematical
AT SS
induction: S
 3 − 4  1 + 2n − 4n 
If A = =  n
 1 − 1 , then A 1 − 2n 
for every positive integer n.
   n
EM LA

 cos α sin α 
Q20. If A =  − sin α cos α  , then prove that
 
TH S C

 cos nα sin nα 
(ii) ( Aα ) =  − sin nα cos nα  , for every positive
n
(i) Aα . Aβ = Aα + β
 
integer n.
Q21. If ‘a’ is a non-zero real or complex number. Use the
MA .P.

principle of mathematical induction to prove that

 a 1  an na n − 1 
If A=   , then A = 
n
 for every positive integer n.
 0 a  0 an 
D

Q22. Under what condition is the matrix equation

A2 − B 2 = ( A − B ) ( A + B ) is true?
S.

Q23. If AB = A and BA = B , then show that A2 = A , B 2 = B.

 1 2 2 
Q24.If A =  2 1 − 2  is a matrix satisfying AAT = 9 I3 , then find the
 a 2 b 
values of ‘a’ and ‘b’.
(ANS: a = − 2 and b = − 1 )
 0 2y z 
 
Q25. Find the values of x, y, z if the matrix A =  x y − z  satisfy the
 x − y z 

W
equation AT A = I3 .
1 1 1

HH
(ANS: x = ± ,y = ± ,z = ± )
2 6 3

IC XII
AT SS
S
EM LA
TH S C
MA .P.
D
S.
 ASSIGNMENT
CH-DETERMINANTS

1 −2 3 
 
Q1. For what value of ‘x’ the matrix A =  1 2 1  is singular?
 x 2 − 3
(ANS: x = − 1 )
Q2. Determine the values of x for which the matrix

W
x+ 1 −3 4 

A=  −5 x+ 2
1
2  is singular. (ANS: x = 0, 3 ±
2
( )
205 )

HH
 4 1 x − 6 
Q3. If [ ⋅ ] notes the greatest integer less than or equal to the real number
under consideration, and − 1 ≤ x < 0, 0 ≤ y < 1, 1 ≤ z < 2 , then find the value
of the determinant

IC XII
[ x] + 1 [ y ] [ z]
[ x] [ y ] + 1 [ z ]
[ x] [ y] [ z] + 1
AT SS
(ANS: 1)
 1 3S
Q4. If A =   , find the determinant of the matrix A − 2 A . (ANS: 25)
2

 2 1
EM LA

Q5. Find the minors and cofactors of elements of the matrix

 1 3 − 2
A =  4 − 5 6 
TH S C

 3 5 2 
M 11 = − 40, M 12 = − 10, M 13 = 35
(ANS: M 21 = 16, M 22 = 8, M 23 = − 4 )
M 31 = 8, M 32 = 14, M 33 = − 17
MA .P.

x sin θ cos θ
Q6. Prove that the determinant − sin θ −x 1 is independent of θ .
cos θ
D

1 x
3 y 3 2
Q7. Let = . Find possible values of x and y if x, y are natural
S.

x 1 4 1
numbers.
(ANS: ( 1, 2 ) ; ( 2, 4 ) ; ( 4, 2 ) ; ( 8,1) )
 cos15o sin15o
Q8. Evaluate .
sin 75o cos 75o

Q9. Without expanding evaluate the following determinants.

41 1 5 1 a b+ c b− c c− a a− b
(i) 79 7 9 (ii) 1 b c + a (iii) c − a a − b b − c
29 5 3 1 c a+ b a− b b− c c− a
1 bc a ( b + c ) x+ y y+ z z+ x b2 c2 bc b + c

W
(iv) 1 ca b ( c + a ) (v) z x y (vi) c 2 a 2 ca c + a
1 ab c ( a + b ) 1 1 1 a 2 b2 ab a + b

HH
(a + a− x ) (a − a− x )
x 2 x 2
1
sin α cos α sin ( α + δ )
sin ( β + δ ) (viii) ( a ) (a − a− y )
2 2
(vii) sin β cos β y
+ a− y y
1
sin γ cos γ sin ( γ + δ )
(a ) (a − a− z )
2 2

IC XII
z
+ a− z z
1

265 240 219 1 a a 2 − bc

(ix) 240 225 198 (x) 1 b b − ac = 0
2
AT SS
219 198 181 1 c c 2 − ab
Q10. Prove the following:
S
1 a a2
EM LA

(i) 1 b b = ( a − b ) ( b − c ) ( c − a )
2

1 c c2
1 a a3
TH S C

(ii) 1 b b = ( a − b ) ( b − c ) ( c − a ) ( a + b + c )
3

1 c c3
x y z
MA .P.

(iii) x
2
y2 z 2 = xyz ( x − y ) ( y − z ) ( z − x )
x3 y3 z3
α β γ
D

(iv) α
2
β2 γ 2 = (α − β )(β −γ ) (γ −α ) (α + β +γ )
β +γ γ +α α + β
S.

a b c 1 1 1
(v) a b c = a
2 2 2 2
b2 c 2 = ( a − b ) ( b − c ) ( c − a ) ( ab + bc + ca )
bc ca ab a 3 b3 c3
 − a2 ab ac
(vi) ba − b2 bc = 4a 2 .b 2 .c 2
ac bc − c2

( b + c)
2
a2 a2
( c + a) = 2abc ( a + b + c )
2 3
(vii) b2 b2
( a + b)
2
c2 c2
b2 + c 2 ab ac

W
(viii) ba c + a2
2
bc = 4a 2 b 2 c 2
ca cb a 2 + b2

HH
x+ y x x
(ix) 5 x + 4 y 4 x 2 x = x
3

10 x + 8 y 8 x 3 x

IC XII
a b ax + by
(x) b c bx + cy = ( b 2 − ac ) ( ax 2 + 2bxy + cy 2 )
ax + by bx + cy 0
a b− c c+ b
AT SS
(xi) a + c b c − a = ( a + b + c ) ( a + b + c )
2 2 2

a− b b+ a c
S
−a+ b −a+ c
EM LA

3a
(xii) − b + a 3b − b + c = 3 ( a + b + c ) ( ab + bc + ca )
−c+ a −c+ b 3c
TH S C

a + b + 2c a b
= 2( a + b + c)
3
(xiii) c b + c + 2a b
c a c + a + 2b
a− b− c 2a 2a
MA .P.

= ( a + b + c)
3
(xiv) 2b b− c− a 2b
2c 2c c− a− b
D

a+ b+ c −c −b
(xv) −c a+ b+ c −a = 2 ( a + b) ( b + c) ( c + a)
S.

−b −a a+ b+ c
a b c
(xvi) a − b b − c c − a = a + b + c − 3abc
3 3 3

b+ c c+ a a+ b
 1 a 2 + bc a 3
(xvii) 1 b + ca b = − ( a − b ) ( b − c ) ( c − a ) ( a + b + c )
2 3 2 2 2

1 c 2 + ab c 3
a2 − ( b − c )
2
a2 bc
(xviii) b b − ( c − a ) ca = ( a − b ) ( b − c ) ( c − a ) ( a + b + c ) ( a 2 + b 2 + c 2 )
2 2 2

c2 − ( a − b )
2
c2 ab

( b + c)
2
a2 bc

W
(xix) ( c + a ) ca = ( a − b ) ( b − c ) ( c − a ) ( a + b + c ) ( a 2 + b 2 + c 2 )
2
b2
( a + b)

HH
2
c2 ab

− a ( b2 + c 2 − a 2 ) 2b3 2c 3
− b ( c2 + a 2 − b2 ) = abc ( a 2 + b 2 + c 2 )
3
(xx) 2a 3 2c 3
− c ( a 2 + b2 − c2 )

IC XII
2a 3 2b3
( a + 1) ( a + 2 ) a+ 2 1
(xxi) ( a + 2 ) ( a + 3) a+ 3 1 = −2
( a + 3) ( a + 4 )
AT SS
a+ 4 1
a 2 2ab b 2
S
a 2 2ab = ( a 3 + b3 )
2 2
(xxii) b
EM LA

2ab b 2 a2
a b− c c− b
(xxiii) a − c b c − a = ( a + b − c ) ( b + c − a ) ( c + a − b )
TH S C

a− b b− a c
a2 + b2
c c
c
MA .P.

b2 + c2
(xxiv) a a = 4abc
a
c2 + a2
b b
D

b
Q11. If a,b,c are in A.P. then show that
S.

x+ 1 x+ 2 x+ a x− 3 x− 4 x− α
(i) x + 2 x + 3 x + b = 0 (ii) x − 2 x − 3 x − β = 0
x+ 3 x+ 4 x+ c x− 1 x− 2 x− γ
Q12. Solve the following:
a+ x a− x a− x x − 2 2 x − 3 3x − 4
(i) a − x a + x a − x = 0 (ii) x − 4 2 x − 9 3x − 16 = 0
a− x a− x a+ x x − 8 2 x − 27 3 x − 64
15 − 2 x 11 − 3x 7 − x 1 x x2
(iii) 11 17 14 = 0 (iv) 1 a a = 0, a ≠ b
2

10 16 13 1 b b2
x+ 1

W
3 5
(v) 2 x + 2 5 = 0
2 3 x+ 4

HH
Q13. If a, b, c are all positive and are pth, qth,rth terms of a G.P., then
show that:
log a p 1
∆ = log b q 1= 0

IC XII
log c r 1
Q14. If a, b, c are positive and unequal, show that the value of the
a b c
AT SS
determinant b c a is always negative.
S
c a b
Q15. Show that the points ( a, b + c ) , ( b, c + a ) and ( c, a + b ) are collinear.
EM LA

Q16. If the points ( a, 0 ) , ( 0, b ) and ( 1,1) are collinear, prove that a + b = ab .

 cos α − sin α 0
 0  , find adjA and verify that
TH S C

Q18. If A =  sin α cos α

 0 0 1 
A ( adjA ) = ( adjA) A = A I 3
 1 3 3
MA .P.

 
Q19. Find the inverse of A =  1 4 3 and verify that A− 1 A = I 3 .
 1 3 4 
 cos 2 x − sin 2 x 
D

 1 tan x  T −1
Q20. If A =   , show that A A =  .
 − tan x 1   sin 2 x cos 2 x 
S.

 3 2  6 7
, verify that ( AB ) = B − 1 A− 1 .
−1
Q21. If A =   and B =  
 7 5  8 9
  2 − 3
Q22. Show that A =  satisfies the equation x 2 − 6 x + 17 = 0 . Hence
3 4 
 1  4 3 
−1
find A− 1 .  ANS : A = 
 17  − 3 2  
 3 1
Q23. For the matrix A =   , find x and y so that A2 + xI = yA . Hence,
 7 5
  5 −1  
 −  8 8 
find A− 1 .  ANS : x = 8 and y=8 ,A = 
1

W
 −7 3  
  8 8
 1 2 2

HH
 
Q24. Show that the matrix A =  2 1 2  satisfies the equation
 2 2 1 
−3 2 2 
− 1  
A2 − 4 A − 5 I 3 = O and hence find A− 1 . (ANS: A =  2 − 3 2  )
1

IC XII
5
 2 2 − 3
Q25. Find the matrix A satisfying the matrix equation
 2 1   − 3 2   1 0
 3 2  A  5 − 3 =  0 1 
AT SS
S      
  1 1 
 ANS : A =  1 0 
  
EM LA

a b 
Q26. Find the inverse of the matrix A =  1 + bc  and show that

c
 a 
TH S C

aA = ( a + bc + 1) I − aA.
−1 2

 4 5
, then show that A − 3I = 2 ( I + 3 A )
−1
Q27. If A =  
 2 1
MA .P.

5 0 4  1 3 3
2 3 2  , B =  1 4 3  . Compute ( AB ) .
 −1 −1
Q28. Given A = 
 1 2 1   1 3 4 
D

  − 2 19 − 27  
  
− 25  
S.

 ANS :  − 2 18 .
  − 3 29 − 42  

  cos α − sin α 0  cos β 0 sin β 
Q29. Let F ( α ) =  sin α cos α 0  and G ( β ) =  0
 1 0  then show
 0 0 1   − sin β 0 cos β 
that
−1 −1
(i)  F ( α )  = F ( − α ) (ii)  G ( β )  = G ( − β )
−1
(iii)  F ( α ) G ( β )  = G ( − β ) F ( − α )
Q30. Show that:

W
−1
 1 − tan θ 2   1 tan θ 2   cos θ − sin θ 
 tan θ 2   = 
 1   − tan θ 2 1   sin θ cos θ 

HH
Q31. The sum of three numbers is 6. If we multiply the third number by
2 and add the first number to the result, we get 7. By adding second and
third numbers to three times the first number we get 12. Use matrix
method to find the numbers. (ANS: 3, 1, 2)

IC XII
Q32. If f ( x ) = ax + bx + c is a quadratic function such that f ( 1) = 8 ,
2

f ( 2 ) = 11 and f ( − 3) = 6 , find f ( x ) by using matrices. Also find f ( 0 ) .

Q33. Solve the following systems of equations by using matrices:
AT SS
2 3 10 4 6 5 6 9 20
(i) x + y + z = 4, x − y + z = 1 and x + y − z = 2 (ANS: 2, 3, 5)
S
(ii) 3x + y + z = 2, 2 x − 4 y + 3z = − 1, 4 x + y − 3z = − 11 (ANS: -1, 2, 3)
EM LA

(iii) x − 4 y − z = 11, 2 x − 5 y + 2 z = 39, − 3x + 2 y + z = 1 (ANS:-1, -5, 8)

(iv) 6 x + y − 3z = 5, x + 3 y − 2 z = 5, 2 x + y = 4 z = 8 (ANS: 1,2,1)
(v) x + y = 5, y + z = 3, x + z = 4 ( ANS : x = 3, y = 2, z = 1)
TH S C

(vi) 2 y − 3z = 0, x + 3 y = − 4,3x + 4 y = 3( ANS : x = 5, y = − 3, z = − 2)

2 3 10 4 6 5 6 9 20
(vii) x + y + z = 4, x − y + z = 1, x + y − z = 2 ( ANS : x = 2, y = 3, z = 5)
(viii) 5 x − 7 y + z = 11, 6 x − 8 y − z = 15, 3x + 2 y − 6 z = 7 ( ANS : x = 1, y = − 1, z = − 1)
MA .P.

1 −1 1 
 
Q34. If A =  2 1 − 3 , find A− 1 and hence solve the system of linear
 1 1 1 
D

equations x + 2 y + z = 4, − x + y + z = 0, x − 3 y + z = 2 .
( ANS : x = 9 5, y = 2 5, z = 7 5 )
S.

−4 4 4  1 −1 1 
   1 − 2 − 2
Q35. Determine the product  − 7 1 3    and use it to solve
 5 − 3 − 1  2 1 3 
the system of equations:
 x − y + z = 4 ,x − 2 y − 2 z = 9, 2 x + y + 3z = 1
(ANS: x = 3, y = − 2 and z = − 1 )
Q36. An amount of Rs 5000 is put into three investments at the rate of
interest of 6%, 7% and 8% per annum respectively. The total annual
income is Rs358. If the combined income from the first two investments
is Rs70more than the income from the third, find the amount of each
investment by matrix method. (ANS: 1000,2200,1800).

W
HH
IC XII
AT SS
S
EM LA
TH S C
MA .P.
D
S.
 S.D. Public School, BU-Block, Pitampura

Holiday Home work for class-XII (Accountancy)

Issue of Shares, Issue and Redemption of Debentures: Note: Do All these Ques in Separate
Holidays HW Register for submission on Ist July 2011
1. 1.Shiva Ltd issued 1,00,000 equity shares of Rs 10 each at a premium of Rs 5 per share.
The whole amount was payable on application and allotment. The issue was fully
subscribed. Pass Journal Entries.
2. Rajiv Ltd. issued 60,000 shares of Rs 10 each at a premium of Rs 2 per share payable
Rs 3 on application, Rs 5 on allotment(inc Premium) and balance on first and final call.
Application were received for 82,000 shares. The Directors resolved to allot as follows:
A Applicants of 30,000 shares 20,000 shares
B Applicants of 50,000 shares 40,000 shares
C Applicants of 2,000shares Nil
Ramesh who had applied for 900 shares in category A and Suresh who was allotted 600
shares in category B failed to pay the allotment money. Pass Journal entries till allotment.
3. P ltd purchased assets worth Rs 1,80,000 from S ltd. The payment was made by issuing
Equity shares of Rs 100 each at premium of Rs 20 per share. Pass Journal entries.
4 Rohit Ltd Purchased assets from Raman Ltd. worth Rs 4,00,000 at 10% trade discount. A
sum of Rs 90,000 was paid by cheque and balance by issue of Equity shares of Rs 10
each at discount of 10%. Pass Journal entries.
5 Distinguish between Reserve capital and Capital Reserve.
6 Explain the conditions of Sec 78 of Cos‟Act 1956.
7 Explain the conditions of Sec 79 of Cos‟Act 1956
8 400 equity shares of Rs 100 each issued at a discount of 10% were forfeited for the non
payment of final call of Rs 20 per share. The forfeited shares were reissued for Rs
40,000 fully paid up. Pass journal entries .
9 X Ltd forfeited 100 shares of Rs 10 each (Rs 6 called up) issued at a discount of 10% on
which he has paid Rs 2 per share. Out of these 80 shares reissued to Mr Ajay at Rs 8
paid up for Rs 6 per share. Pass Journal entries regarding forfeiture and reissue of
shares.
10 50 shares of Rs 10 each issued at premium of Rs 5 each were forfeited for non payment
of allotment money of Rs 9 per share inc. premium. The first and final call of Rs 3 per
share was not made. The forfeited shares were reissued@ Rs 12 per share fully paid up.
11 Pass Journal entries at the time of issue and redemption of debentures in following cases:
(a)6% Rs 50,000 debentures issued at premium of 10 %, redeemable at 5% premium .(b)
4% 100000 debentures of Rs 100 each issued at par, redeemable at 10% premium
12 Pratima Ltd took a loan of Rs 5,00,000 from Vijaya Bank against collateral security by
issuing 8000 6%debentures of Rs 100 each. Pass Journal Entry.
13 Explain the Meaning of Collateral security and its treatment.
14 What is Authorised Capital, Issued Capital, Called up capital and Paid up Capital.
15 What is meant by ESOP and pass a Journal entry by giving example.
16 JK Ltd issued Rs 10,00,000, 6% debentures at a premium of 4% redeemable at a
premium of 5% after 4 years. These debentures were issued on Jan 1 2007.Pass
Journal entries at the time of issue and redemption.
17 G Ltd purchased 5000 own 8% debentures of Rs 1000 each at Rs 985 per debenture. It
also Purchased 600 debentures of the same series @Rs 988.Pass Journal entries in the
books of the company.
18 Asian Paints Ltd redeemed Rs 50,00,000 8% debentures at a premium of 10% out of the
Profits on 31-3-2011. Pass Journal entries for the redemption of debentures.
19 A company issued for public subscription 50,000 shares of Rs 20 each at a premium of
Rs 4 per share, payable as under
Application Rs 4 per share
Allotment Rs 10 per share ( inc Premium)
First and final call Rs 10 per share
 S.D. Public School, BU-Block, Pitampura

Applications were received for 75,000 equity shares. The shares were allotted Pro-rata to
applicants of 60,000 shares. The remaining applications were rejected.Money overpaid was
utilized towards allotment.
Mr Manav to whom 2000 shares allotted failed to pay allotment and his shares were
forfeited.
Mr Prakash who was allotted 2500 shares failed to pay first and final call and his shares were
also forfeited.
4000 shares all inclusive of Mr Manav were reissued at Rs 18 per share fully paid up.
Pass Journal Entries and show your Working clearly.
20. Do Revision of Scanner Ques of Company Accounts of TEXT Book.
21 PROJECT WORK as per directions given. Prepare Project Accountancy file neatly.
 S.D. Public School, BU-Block, Pitampura

Holiday Home work for class-XII (Business Studies)

Q1 “ Activities involved in managing an enterprise are common to all Organisations, whether
economic , social or political.” Which characterstics of Management is highlighted in the
statement ?

Q2 Despite all developments in technology , “ getting work done through people‟ is still a major
task for the manager. Which dimension of Management is referred here?

Q3 How principles and values are formed?

Q4 What is the role of principles of Management for Managers?

Q5 Name the Principle of Management which resembles Military Organisation.

Q6” An Employee will retire at the age of 62 years” . What type of plan is it?

Q7X Electronics decides to sell television sets through exchange of old television sets. What type
of Plan is it?

Q8” Management has been defined as a process of getting things done with the aim of achieving
goals effectively and efficiently” Explain briefly the three important terms used in the definition of
Management- Process, effectiveness and efficiency.

Q9 What do you mean by “ Levels of Management” ? Draw a diagram showing the level of
Management.

Q10 Why does the principle of Unity of Command does not hold good in the case of Functional
Foremanship?

Q11Strategy is a comprehensive Plan which includes three Dimensions. Enumerate them.

Q12 “ Planning is not a guarantee of success of a Business”. Comment.

Q13” While formulating a strategy, the business environment needs to be taken into
consideration.” Do you agree ? Give an example.

Q14 Why does F.W. Taylor advocate separation of Planning and execution Function?

Q15 “ A good Manager Is born and not made” . Do you Agree? Give reasons.

Q16 “ What distinguishes a successful Manager from a less Successful one is the ability to put
these principles into practice” Comment.

Q17 B Ltd wants to modify its existing product, Computers in the market due to its decreasing
Sales.What decisions should each level of Management take to give effect to this decision?

Q18 To Manage is to forecast and to plan, to Organise , to Command , to Coordinate and to

Control” . Explain Briefly the functions of Management in the light of this statement.

Q19 Is Management an exact Science? Explain.

 S.D. Public School, BU-Block, Pitampura

Q20 Explain any four techniques which facilitate application of the Principles of Scientific
Management.

Q21Taylor”s techniques of Management are universally applicable. Do you agree. Give any four
reasons in support of your answer.

Q22 X Ltd was engaged on the business of Manufacturing auto Components. Lately its business
was expanding due to increased demand for Cars. The Competition was also increasing .In order
to keep its market share intact the company directed its workforce to work overtime. But this
resulted in many problems.
Due to increased pressure of work the efficiency of workers declined. Sometimes the
subordinates had to work for more than one superior. The workers were becoming indiscipined.
The spirit of teamwork, which had characterized the company, previously had begun to wane.
Identify the principles of Management given by Fayol are violated. Explain and suggest how
the situation can be rectified.

Q23 In each of the following cases tell which principles of Management as given by Fayol is being
violated and how
a) When each division of the company does not have a separate plan of action.
b) When a sales Manager is not given the right to discount the Buyer necessary to conclude
a large scale contract, which will be profitable for the Company.
c) When a Subordinate habitually contacts higher Authorities in the Company by passing his
immediate subordinate.
d) When a subordinate receives order from two superiors.
e) When the tools are not found at right place in the Company.

Q24 Identify to which managerial function – Planning, Organising, Directing, Staffing and
Controlling the following activities belong, give reasons
a) Ordering a Manager to implement an Advertising campaign designed by the Marketing
Department of a Company
b) Motivating, Communicating and supervising the Employees.
c) Deciding the objectives, policies and Procedures to be followed in the Company.
d) Finding out deficiencies in implementation of Plans with the results achieved.

Q25 Identify which level of Management would take the following decisions. Give reasons
a) Introducing a new product line.
b)Give performance report to Top level Management.
c)Implement the policies of the Management at the Shop Floor Level.
d)Deciding the Capital Structure of the Company.
e)Recruitment of Casual Labourers.
 S.D. Public School, BU-Block, Pitampura

Holiday Home work for class-XII (Economics)

1) Identify which of the following are the subject matter of Microeconomics or
Macroeconomics:-
a) National income
b) Supply by a firm
c) Cotton textile
d) Government Budget
e) Price determination of a commodity
f) Employment.

2) a) What is opportunity cost?

b) Suppose a student has four hrs. in which he can either study or play tennis, what is
the opportunity cost of studying?
c) An Individual has Rs. 164 with this he can eat in restaurant or buy his favorite book.
He buys his favorite book for Rs. 164. What is the opportunity cost of buying
thebook?
3) Calculate MOC. comment on the shape of the curve.

Food 2 2 2 2 1 1 1
consum 8 5 3 0 7 4 0
ption 0 0 3 5 5 0 0

Cloth 0 1 2 3 4 5 6
consum
ption

4) Why do problem related to allocation of resources in economy arise? Explain.

5) Give Px=Rs. 5 and Py=Rs. 10, find consumer‟s equilibrium form the following Mux
and MUy value
Mux 100 80 60 50

MUy 160 150 120 110

6) a) why PPC is concave to origin?

b) Why is an Indifference curve convex to the origin?
7) Determine here the following changes (or shift) will affect market demand curve for a
product.
a) There are train and bus services between New Delhi and Jaipur. Suppose that the
train fare between the two cities come down. How will this affect the demand curve for
bus travel between the two cities?
b) In order to encourage tourism to Goa, the Government of India suggest Indian Airlines
to reduce air fare to Goa from the four major cities, Chennai, Kolkata, Mumbai and New
Delhi. If the Indian Airlines reduces the air fare to Goa, how will this affect the market
demand curve for air travel to Goa?
 S.D. Public School, BU-Block, Pitampura

c) A new steel plant comes up in Jharkhand many people who were previously
unemployment in the area are now employment. How will this affect the demand curve
for colour TV and Black &white TV in the region?
8) Draw a downward sloping straight line demand curve touching both the axis. Mark Ed at
different points on this demand curve.
9) Demand of a product is elastic Its price falls. What will be its effect on total expenditure
on the product? Give a Numerical example.
10) The price of the goods(food items& non- food items) are increasing day by day. What
may be the possible reasons responsible for it. Suppose you are the Finance Minister of
India which type of policy you would frame to control it?
 S.D. Public School, BU-Block, Pitampura

Holiday Home work for class-XII (Biology)

1. Learn chapters1-5 for I unit test

2. Complete your assigned projects.

3. Do following assignments from chapter 1 to 5 in your

assignment register.

Assignment no.1 chap. 2

1. Describe the structure of a typical embryo sac found in flowering plants? Why is it
generally referred to as monosporic?
2. Describe the structure of a mature angiospermic pollen grain. Mention one difference
between the pollen of dicot and monocot plant?
3. Name the three parts of pistil and mention one function of each o them.
4. Differentiate between albuminous and non-albuminous seeds, with an example for each.
5. What are parthenocarpic fruits? Give an example. Mention one characteristic feature of
such fruits.
6. Differentiate between true fruits and false fruits, with an example of each.
7. (i) Draw a neat labelled diagram of the longitudinal section of an anatropous ovule.
(ii) Which cell of the ovule gets transformed into megaspore mother cell ?
8. (i) Draw a neat labelled diagram of the vertical section of maize grain.
(ii) Why can we not use the term seed for the maize grain.
9. What develops into a microspore mother cell in a flower ? Trace the development of
this cell into a pollen grain, which is ready for germination . Draw a labelled figure of a
mature pollen grain.
10. Trace the development of a megaspore mother cell of a flower into a mature ovule .Give
a labelled diagram of the final stage.
11. Trace the events that would take place in a flower from the time the pollen grain of the
same species falls on the stigma upto the completion of fertilization.
12. Draw a well labellrd diagram of the L.S. of embryo of grasses. How does it differ from
that of bean?

Assignment no. 2 ch. 3 Human Reproduction

1. Where are human testes located ?

2. Name the hormone secreted by Leydig cells.
3. What is ejaculatory duct ?
4. At what stage is meiosis I suspended in a primary oocyte ?
5. Name the part of blastocyst that forms the embryo proper.
6. Define foetal ejection reflex.
7. Describe the formation and function of corpus luteum.
8. Differentiate between vasa efferentia and vas deferens.
9. What is seminal plasma ? What are its components ?
 S.D. Public School, BU-Block, Pitampura

10. A sperm has just fertilized a human egg in the fallopian tube. Trace the events that
the fertilized egg will undergo upto the implementations of the blastocyst in the
uterus.
11. Represent schematically the process of spermatogenesis indicating the number of
chromosomes in the cell at various stages.
12. What is meant by each of the following:
(i) Chrionic villi
(ii) Placenta
(iii) Umbilical chord.
13. What happens to the blastocyst immediately after implantation?
14. Draw a diagram of female reproductive system and label any ten parts in it.
15. Describe oogenesis in a human female. What promotes the completion of second
meiotic division in oogenesis ?
16. Explain the role of the following hormones / proteins with reference to hormonal
control of human male reproductive system .
(i) GnRH
(ii) LH
(iii) FSH
(iv) Inhibin
(v) Testosterone
17. Describe the structure of a human sperm as seen under electron microscope.

Assignment no.3 ch. 4 Reproductive health

1. Why is it necessary to check the population growth?

2. Mention the principle of natural methods of birth control.
3. Removal of gonads cannot be considered as contraceptive options .Why ?
4. What is saheli? Where has it been developed?
5. Mention any four characteristics that an ideal contraceptive should have.
6. What is vasectomy and tubectomy?
7. Name the age group where STD‟s are reported to be very high. Mention three
practices to avoid it.
8. Expand ICSI. What is it?

Assignment no.4
Ch-Principles of inheritance and variation

1.Define the following terms:

(i) Inheritance (iii) Alleles (v) Homozygous condition
(ii) Variation (iv) Genes (vi) Heterozygous condition

2. Write a short note on Mendel‟s contribution in genetics.

3. What is dominant and recessive factor?

4. State the law of dominance with the help of an example.

5. What are chromosomal disorders?

6. How is polyploid cell obtained?

7. What is aneuploidy?

8. Explain the following chromosomal disorders giving an account of abnormality found in

individuals: -
 S.D. Public School, BU-Block, Pitampura

(i) Down‟s syndrome

(ii) Klinefelter‟s syndrome
(iii) Turner‟s syndrome

9. What is hemophilia?

10. What are the sources of variation?

11. What are point mutations and frameshift mutations?

12. What are mutagens? Give examples.

13. Give an example of female heterogeneity.

14. What is henking‟s X-body?

15. Give the mechanism of sex determination in grasshopper.

16. What is the contribution of Alfred strutevant?

17.Explain the mechanism of sex determination in case of Drosophila.

18.While carrying out certain crosses Morgan found that proportion of parental gene
combinations was much higher than non-parental types. What could be the possible cause of
this observation? What is this phenomenon called as?

19. State and explain the chromosomal theory of inheritance.

20. Explain the principal of independent assortment with the help of dihybrid cross.

21. Explain the following with the help of examples:

(i) Co dominance
(ii) Multiple alleles
(iii) Incomplete dominance

Problems in genetics

22. In cattle hornless (H) is dominant over horned (h), and black (B) is dominant over red (b).
Consider that these two pairs of genes assort independently (i) what proportion of spring from the
cross BbHh X bbhh in would be black hornless.
(iii) From the cross Bbhh X Bbhh, how many will be black and horned, red and horned, red
and hornless

23. In guinea pigs assume that rough coat (S) is dominant over smooth coat (s) and the black
(W) is dominant over white (w). Can the mating between two rough, black guinea pigs produce
offspring which are rough white and smooth black?

24. How many different gametes could result from the following genotypes? In each case what
will be their genotypes?
(i)Aa (ii)AABB (iii)AaBb
(iv)DD Ee Cc (v)FF II Jj

25. In a cross between tall pea plant with yellow seeds (DdYy) and tall a plant with green seeds
(Ddyy), what proportion of the offsprings could be expected to be (i)Tall green (ii)dwarf and green
 S.D. Public School, BU-Block, Pitampura

26. A couple got five sons and a daughter. The husband thinks that he produces more Y bearing
sperms. Give your views.

27. In human beings blue eye colour is recessive to brown eye colour. A brown eyed man has blue
eyed mother.
(i) What is the genotype and his mother?
(ii) What all the possible genotypes of his father?
(iii) If the man marries a blue eyed woman. What are possible genotypes of their offsprings.

28. A man with AB blood group has married a woman with O group. Show the possible genotypes
and phenotypes of the progeny.

29. A man with A type blood group has a wife with type B. They have a child with O blood. Give
the genotypes of all the three. What other blood groups can be expected in the future offspring of
this couple?

30. A black colored cock when bred with white-colored hen produced steel blue colored
offspring called andulasian (chicken) when the steel blue colored progeny were obtained.

(i) this result is genetically explained as _______________________ .

(ii) What will the expected ratio of black , steel blue and white progeny?

31. In dogs the barking trait is dominant over the silent-trait and erect ears are dominant over
drooping ears. What is the expected phenotypic ratio of the offspring when dogs heterozygous for
both the traits are crossed?

32. A man brown eyes (B) are dominant to blue (b) and dark hair ( R) dominant to red hair ( r). A
man white brown eyes and red hair , whose father was blue eyed marries a women with blue
eyes and hair but whose mother was red haired . They have four children. Give the phenotype
and genotype of parents and children.

33. In garden pee smooth seeded (S) character is dominant over wrinkled seeded (s) character
and red flower ® over white ® flowers. Determine the genotype and phenotype of the following
crosses.

(i) Ss rr X Ss RR
(ii) SsRr X Ss rr
(iii) Ss Rr X ss rr
(iv) SSRR X SS RR
(v) Ss Rr X Ss Rr

Ch-5- Principles of Inheritance and Variation

1. Give two main reasons for Mendel‟s success.

2. Why was phenotype and genotype ratio same in f2 in Antirrhinum sp. ?
3. Why was Morgan and his workers getting higher proportion of parental gene
combinations than non-parental in Drosophila Melanogaster.
4. What is the combination of Sex chromosomes in a) Hen
b) Cock
 S.D. Public School, BU-Block, Pitampura

5. “Valine substitutes glutatmic acid at the sixth position of the beta

globin chain of the haemoglobin molecule.” What chromosomal disorder is being
talked about?
6. What allelic combinations are possible for blood group A.
7. What is the importance of pedigree analysis in case of humans?
8. How many Henking‟s X Bodies can be seen in a person suffering from turner‟s
syndrome?
9. Give an example of male heterogeneity?
10. Give two points of comparison between behaviour of chromosomes and genes?

Chap.-6 Molecular basis of inheritance

1. If the distance b/w two consecutive base pairs is 0.34 nm, what will be the length of DNA if
there are 23 base pairs in it?

2. What properties of DNA makes it fit to be the genetic material.

3. Why did Harshey and chase grow bacteriophages separately in medium containing
radioactive sulphur and phosphorus.

4. Why is DNA said to be having a semi-conservative mode of replication.

5. What if there is any limitation of DNA polymerase?

6. How many amino acids would be code from the following sequence of
nucleotides ?
AUGUUUUUCUUCUUUUUUUUC

7. Why glucose and galactose cannot act as inducers for lac operon?

8. What is the basis of genetic mapping of human genome as well as fingerprinting?

9. If human being genome has 3 X 10 bp, in how many base sequences would there be
differences.

10.If two nitrogenous bases are removed from the following base sequence. What type of
mutation it is called?
AUGUGGCCGUAA

11.How does packaging of DNA takes place in a prokaryotic chromosome?

12.Differentiate b/w euchromatin and heterochromatin.

13. Explain Frederick Griffith‟s transformation experiments with streptococcus pneumonia.

14.Who proposed the bio chemical nature of „transforming principle‟ in Griffth‟s experiment.

15.Give an experiment to prove that DNA is the genetic material. Who proposed it?
 S.D. Public School, BU-Block, Pitampura

16. What properties should be there in a molecule to act as a genetic material and how does DNA
satisfies all these properties? Explain giving reasons.

17. What do you understand by the semi-conservative mode of replication?

18. Give an experimental evidence to prove that DNA has semi-conservative mode of replication.

Assignment no. 4

1. Which is the most abundant genetic material?

2. Name 2two organisms where RNA is the genetic material.

3. How many nucleotides are known to present in the following:-

(i) 174 bacteriophage
(ii) bacteriophage
(iii) E.coli
(iv) Human beings

4. Explain the structure of polynucleotides chain giving details of various types of bonds and
chemical components in it.

5. Give the structural differences b/w DNA and RNA.

6. Who proposed double helical model/double helix structure of DNA and on what basis?

7. Explain the salient features of double helix structure of DNA with the help of a diagram.

8. Who identified DNA as „neuclein‟?

9. What was Erwin Chargaff‟s principle?

10. What is the central dogma of molecular biology?

 S.D. Public School, BU-Block, Pitampura

Holiday Home work for class-XII (Physics)

Q1:-A comb run through 0ne‟s dry hair attracts small bits of paper.Why?What happens if the hair
is wet or if it is a rainy day?
Q2:-ordinary rubber is an insulator.But the special rubber tyres of aircrafts are made slightly
conducting.
Why is this necessary?
Q3:-A bird perches on a bare high power line, and nothing happens to the bird.A man standing on
the ground touches the same line and gets a fatal shock.Why?
Q4:-Vehicles carrying inflammable materials usually have metallic ropes touching the
groundduring the motion.Why?
Q5:-If the two large conducting sphere carrying charges Q1 and Q2 are brought close to each
other. Is the electrostatic force between them exactly given by coulimb‟s law?Why?
Q6:-A small test charge is released from rest at a point in electric field .Will it travel along the field
line passing through that point?Explain.
Q7:-What is the work done by the field of a nucleus in a complete circular obit of the
electron?What is the work done if orbit is elliptical?
Q8:-We know that the electric field is discontinuous across the surface of a conductor. Is the
electrostatic potential also discontinuous there?
Q9:-What is the capacity of a single conductor?
Q10:-What is the possible reason why water has a much greater dielectric constant(=80) than
mica(=6)?
Q11:-Sketch the electric field lines around a system of two equal and opposite point charges?
Q.12. The graph shows the variation of voltage „V‟ across the plates of two capacitors A and B
versus increases t6he charge Q stored on them which of the two capacitor has higher
capacitance give reason for your answer.

Q13:-Sketch the electric field lines around a system of two equal positive point charges placed at
a distance.
Q14:-Define electric field intensity .Write its S.I. unit.Write the magnitude and direction of the
electric field intensity due to an electric dipole of length 2a at the mid –point of the line joining the
two charges.
Q15:-State gauss‟s theorm Apply thas theorem to obtain the expression for the electric field ai a
point due to an infinitely long,thin, uniformly charged straight wire.
Q16:-A charge q is placed at the centre of the line joining two equal charge Q.Show that the
system of three charges will be in equilibrium if q= -Q/4.
 S.D. Public School, BU-Block, Pitampura

Q17. Two plane sheets of charge densities +σ and -σ are kept as shown in the figure. What
are the electric field intensities at points A and B?

•A
________________ +σ

•B
________________ -σ

Q18. An electric technician requires a capacitance of 2μF in a circuit across a potential

difference of 1kV. A large no. of 1μF capacitors are available to him each of which can
withstand a potential difference is not more than 400V. suggest a possible arrangement
that requires the minimum no. of capacitors.

Q19. How resistivity of a (i) a conductor and (ii) a semiconductor vary with temperature? Give
reason for each case.

Q.20. The given graph show the variation of charge Q versus the potential difference „V‟ for
capacitors C1 and C2 the two capacitor have the same plate seperation but the plate area of C2
is double than of C1. In which of the line in graph corresponding to C1 and C2 and Why.

Q.21. A parallel plate capacitor with air between the plate has a capacitance of 8pF. The
separation between the plate is now reduced by half and the space between them is now
filled with dielectric constant 5. Calculate the value of Capacitance of the capacitor in the
second case. the expression for the electric field due to a small electric dipole at a far off
point (on the same axis).

(b) Two metallic spheres of radii, r1 and r2, are far apart but are connected by a thin wire.
Their combined charge is Q. Find (i) the charge on the sphere of radius r 1 and (ii) their
common potential. 19. State the principle of potentiometer with the help of circuit
diagram, describe a method to find the internal resistance of a primary cell.

Q22. (a) Derive an expression for the electric field at a point lying on the equatorial axis of an
electric dipole. Hence writ

Q.23 A parallel plate capacitor each with plate area A and separation D is charged to a P.d. V . A
battery is used to charge it is than disconnected a dielectric slab of thickness D and dielectric
constant K is now placed between the plates what change if any will take place in.

1. Charge on the plate.

2. electric field intensity netween the plate
3. Capacitance of the capacitor.
 S.D. Public School, BU-Block, Pitampura

Justify your answer in each case.

Q.24. Distance between the plates of the parallel plate capacitor is d. A metal plate of thickness
d/2 is now placed between the plates. What will be the efeect on the capacitance.

Q.25. A very thin plate of metal is placed excectly between the two plate of the parallel plate
capacitor. What will be the effect on the capacitance of the system ?

Q.26. A parallel plate capacitor is charged by a battery, which is then disconnected. A dielectric
slab is then inserted in the space between the plates. Explain what changes, f, any, occur in the
value of
1. charge on the plates
2. capacitance
3. potential difference stored in the plates
4. electric field between the plates

Q.27. A parallel plate is charged by a battery. When the battery remains connected, a dielectric
slab is inserted in the space between the plates. Explain what changes if any , occur in the values
of
1. potential difference between the plates
2. electric field strength between the plates
3. capacitance
4. charge on the plates
5. energy stored in the capacitor ?

Q.28. Two identical capacitors C1 and C2 are connected as shown in the fig. With a battery B. A
dielectric slab is slipped between the plates of capacitance, the potential difference and stored
energy of each capacitor?

Q.29. A parallel plate capacitor with no dielectric has a capacitance of 0.5uF. The space between
the plates is then filled with equal amounts of two dielectrics of dielectrics constant 2 and 3 in the
two arrangement as shown below one by one.

Find the ratio of capacitances C1 and C11.

Q.30. In the figure shown, calculate the total flux of the electrostatic fields through the spares S1
and S2. The wire AB shown here has a linear charge Density ʎ given by ʎ=kx . Where x is
distance measured along the wire from the end A.
 S.D. Public School, BU-Block, Pitampura

Q.31. X and y are two parallel plates capacitors having the same areas of plates and same
separation between the plates. X has air between the plates and y contains a dielectric medium
Er=5.
1. Calculate the potential difference between the plates of X and Y.
2. Calculate the ratio of dielectric energy stored in X and Y?

Q.32.Three Capacitors of equal capacitance, when connected in series have a net capacitance
C1 and when connected in parallel have a net capacitance C2. What will be the ratio C1/C2?

Q.33. Calculate the equivalence capacitance of the combination between the points p and q
shown in fig. :

Q.34.Find the equivalence of the capacitance of the combination of capacitors between the points
A and B as shown in fig. Also Calculate the total charge that flow in the circuit between the point
A and B.

Q.35. Four Capacitance are connected as shown in fig. :

Calculate the equivalence capacitance between the points X and Y.

Q.36. The given figure shows a network of the five capacitors connected to a 100 V supply.
Calculate the total charge and energy stored in the network.
 S.D. Public School, BU-Block, Pitampura

Q.37.Find the total energy stored in the capacitors in the given network :

Q.38. obtain the equivalence capacitance of the network given below. For a supply of 300 V,
determine the charge and the voltage across C4.

Q.39. Two dielectric slabs of dielectric constant K1 and K2 are filled in between the two plates
each of area A, of the parallel plate capacitor as shown in the fig. . find the net capacitance of the
capacitor.

6
Q.40. A Van de Graaff type generator is capable of building up potential difference of 15 X 10 V.
The dielectric strength if the gas surrounding the electrode is
7 -1
5 X 10 Vm . What is the minimum radius of the spherical shell required ?

Q.41. Calculate the equivalent capacitance between points A and B in the following arrangement
of the capacitors.

Q.42. Calculate the capacitance C in fig. The equivalent capacitance between the points A and Q
is 30uF.

Q.43. Calculate the equivalent capacitance between points P and Q as shown in the fig.

Q.44. Find the effective capacitance between points P and Q the arrangement shown in fig. The
capacitance of each capacitor is C=4uF.
 S.D. Public School, BU-Block, Pitampura

Q.45. The fig. shows arrangement of 6-capacitors : calculate the effective capacitance between A
and B.

Q.46. Fig. Shows a network of very large number of capacitance C=2 uF. Calculate the equivalent
capacitance between points A and B.

Q.47. Three capacitors C1=3uF, C2=1uF,C3=2uF are connected to be dc source of voltage

v=100 V as shown in fig. Calculate
1. Equivalent capacitance of combination and
2. Charge collected by 2uF capacitor.

Q.48. A wire of resistivity ρ is stretched to double its length. What will be its new resistivity?

Q.49. A copper wire of resistivity ρ is stretched to reduce its diameter to half of its original value.
What will be its new resistivity?

Q50. Give reason why electrical conductance of electrolytes is less than that of metal.

Q.51. Two heated wires of the same dimension are first connected in series and then in parallel
to a source of supply. What will be the ratio heat produced in the two cases?

Q.52.The variation of potential difference V with length l in the case of two potentiometer P and Q
is as shown. Which of these two will you prefer for comparing the emfs of two primary cells?

Q.53.V-I Graph for a metallic wire at two different temperature T1 and T2 is shown in the fig.
Which of these two temperature is higher and why ?
 S.D. Public School, BU-Block, Pitampura

Q.5 4. The V-I characteristics of a resistor are observed to deviate from a straight line for higher
values of current as shown in the adjoining figure why ?

Q.55. How does the resistance of i) a conductor and ii) a semiconductor vary with temperature?
Give reason for each case.

Q.56. A cylindrical metallic wire is stretched to increase its length by 10%. Calculate the
percentage increases in its resistance.

Q.57. In the potentiometer circuit shown, the balance (null) point is at X. State with reason, where
the balance point will be shifted when
i. Resistance R increased, keeping all parameters unchanged.
ii. Resistance S is increased , keeping R constant.
iii. Cell P is replaced by another cell whose e.m.f. Is lower than that of cell Q.

Q.58.For the potentiometer circuit shown in the given figure, point X and Y represent the two
terminals of an unknown emf E‟. A student observed that when jockey is moved from the end A to
the end B of the potentiometer wire, the deflection in the galvanometer remains in the same
direction .

What may be the two possible faults in the circuit that could result in this observation?
If the galvanometer deflection at the end B is i) more, ii) Less than the end A, which of the two
faults, listed above, would be there in the circuit? Give reason of your answer in each case.

Q.59. The following circuit shows the use of potentiometer to measure the internal resistance of a
cell
i. When the key K is open, how does the balance point change, if the current from the
driver cell decreases.
 S.D. Public School, BU-Block, Pitampura

ii. When the key K is closed, how does the balance point change if R is increased keeping
current from the driver cell constant?

Q.60. two student X and Y perform an experiment on potentiometer separating using the circuit
diagram shown here. Keeping other things unchanged i) X increases the value of resistance R. ii)
Y decreases the value of resistance S in the set up. How would these changes affect the position
of the null point in each case and why?

Q.61. The circuit shown in the diagram contains a battery „B‟, a rheostat „Rh‟ and identical lamps
P and Q. What will happen to the brightness of the lamps m if the resistance through the rheostat
is increased ? Give Reasons.

Q.62. What is the change in resistance of an Eureka wire when its radius is halved and the length
is reduced to one-fourth of its original value.

Q.63. V-I graph for parallel and series combinations of two metallic resistors are shown in figure.
Which graph represents parallel combination ? Justify your answer.

Q.64. In adjoining fig. there is no deflection in galvanometer. What is the value of resistance R?

Q.65.In a Wheatstone‟s bridge experiment, a student by mistake, connect key (k) in place of
galvanometer and galvanometer (G) in place of key (k). How will be the test for the balance of the
bridge?
 S.D. Public School, BU-Block, Pitampura

Q.66.(a) In a metre bridge the balance point is found to be at 39.5cm from the end A, when the
resistance Y is 12.5 Ω. Determine the resistance of X. Why are the bridge connection between
resistors in a Wheatstone or metre bridge made of thick copper strips?
a) Determine the balance point of the bridge if X and Y are interchanged.
b) What happens if the galvanometer and cell are interchanged at the balance point of the
bridge? Would the galvanometer?

Q.67. In a potentiometer arrangement , a cell of emf 1.25 V gives a balance point at 35.0 cm
length of wire. If the cell is replaced by another cell and the balance point shifts to 63.0 cm, what
is the emf of the second cell?

Q.68. Figure shows a potentiometer with a cell of 2.0V and internal resistance of 0.40 Ω
maintaining a potential drop across the resistor wire AB. A standard cell which maintains a
constant emf of 1.02V (for very moderate current up to a few uA) gives a balance point at 67.9cm
length of wire. To ensure very less current is drawn from the standard cell, a very high resistance
of 600k Ω is series with it which is put
in shorted close to the balance point. The standard cell is then replaced by a cell of unknown emf
E and the balance point found similarly turns out to be at 82.3cm length of wire.
(a) What is the value of E?
(b) What purpose does the high resistance of 600 k Ω have?
(c) Is the balance point is affected by the high resistance?
(d) Is the balance point affected by the internal resistance of the driver cell?
(e) Would the method work in the above situation if the driver cell of the potentiometer had
an emf of 1.0V instead of 2.0V?
(f) Would the circuit work well for determining extreme small emf, say of the order of few
mV(such as the typical emf of the thermo couple)? If not how would you modify the
circuit?

Q.69. Figure shows a potentiometer circuit for comparison of two resistances. The balance point
with a standard resistances R=10.0 Ω is found to 58.3cm, while with the unknown resistance X is
68.5cm. Determine the value of X. What might you do if you failed to find a balance point with the
given cell E.
 S.D. Public School, BU-Block, Pitampura

Q.70. Using Kirchhoff‟s law, calculate the value of electric current I1,I2 and I3 in the given
network.

Q71. Use Kirchhoff‟s law to determine the value of current I1 in the electrical circuit given below.

Q.72. Two cells of emf E1 and E2 have internal resistance r1 and r2. Deduce an expression for
equivalent emf of their parallel combination.

Q.73. A cell of emf (E) and internal resistance (r) is connected across a variable external
resistance(R)
Plot graph to show variation of
(i)E with R.
(ii)Terminal p.d. of the cell(V) with R.

Q74. 12 cells, each of emf 1.5v and internal resistance 0.5 Ω, are arranged in m row each
containing cells connected in series, as shown. Calculate the values of n and m for which this
combination would send the maximum current through external resistance of 1.5 Ω

Q.75. Two cells E1 and E2 in the circuit diagram have an emf‟s of 5V and 9V and internal
resistance of 0.3 Ω and 0.2 Ω respectively. Calculate the value of current flowing through the
resistance of 3 Ω.

Q.76.Two cells of emf 1.5 V and 2V and internal resistance 1 Ω and 2 Ω respectively are
connected in parallel to pass a current in the same direction through an external resistance of 5 Ω
 S.D. Public School, BU-Block, Pitampura

i. Draw the circuit diagram.

ii. Using Kirchoff‟s laws and potential difference across 5 Ω resistor.

Q.77. A series battery of 6 lead accumulators each of emf 2.0 V and internal resistance of 0.5 Ω
is changed by a 100 V supply. What series resistance should be used in the circuit in order W
limit the current to 8 A? using the required resistor, obtain i)the power supplied by dc source and
ii) the power dissipated as heat.

Q.78. For the circuit shown here, calculate the potential difference between points B and D.

Q.79. When two known resistances R and S are connected in the left and right gaps of a metre
bridge, the balance point is found at a distance l1 from the zero end of the metre bridge wire. An
unknown resistance X is now connected in parallel to the resistance S and the balance point is
now found at a distance l2 from the zero end of the metre bridge wire. Obtain a formula for X in
terms of l1, l2 and S.

Q.80.In a parallel Wheatstone‟s bridge circuit, wire AB is 2m long. When resistance Y=2 Ω and
jockey is in position J such that AJ=1.20m, there is no current in galvanometer , find the value of
unknown resistance X. The resistance per unit length of wire AB=0.01 Ω/cm. Also calculate the
current drawn by the cell of emf 4 V and negligible internal resistance

.
Q.81.the given figure shows the experiment set up of a metre bridge. The null point is found to be
60cm away from the end A with X and Y in position as shown.
 S.D. Public School, BU-Block, Pitampura

When a resistance of 15 Ω is connected is series with „Y‟, the null point is found to shift by 10 cm
towards the end A of the wire. Find the position of null point is a resistance of 30 Ω were
connected in parallel with „Y‟.

Q.82. A voltmeter V of resistance 400 Ω is used to measure the potential difference across a 100
Ω resistor in the circuit shown here.
a) What will be the reading of the voltmeter?
b) Calculate the potential difference across 100 Ω resistor before the voltmeter is
connected.

Q.83. A potentiometer wire AB, shown in fig. is 4m long. Where should the free end of the
galvanometer be connected to AB, so that the galvanometer shows zero deflection?

Q.84. Two primary cell of emfs wire E1 and E2 (E2>E1) are connected to a potentiometer wire
AB as shown in fig. If the balancing lengths for the two combinations of the cells are 250 cm and
400cm, find the ratio of E1 and E2.

Q.85. Why is a potentiometer prefered over a voltmeter for determining the emf of a cell?
 S.D. Public School, BU-Block, Pitampura

The „balance point‟ in a given potentiometer experiment for these two combination of cells are
found to be at 351.0 cm and 70.2 cm respectively. Calculate the ratio of the emfs of the two cells.

Holiday Home work for class-XII (Psychology)

1.Watch Hollywood/Bollywood movies depicting various psychological disorders and prepare a
short report on that.
2. We all have some notions about our ideal selves i.e. and what we would like to be? Take time
to imagine that you have acheivd your ideal self. With this notion of your ideal self,express your
attitude towards these categories; a) school, b) friends, c) family d) money.write a paragraph on
each describing your ideal attitudes. Compare your ideal self with your real self on these topics.
3. Select five persons whom you most admire ,either from real life or from history.Collect
information about their contribution in their respective field and identify their characteristics in their
personality that have impressed you.
4.prepare flow chart /diagrams to explain theoties of intelligence and personality.
5.Identify a topic for preparing case study on any psychological topic.Collect information
regarding the case on following guidelines and suggested format
1. Introduction; brief introduction about topic,nature of problemits incidences,auses and possible
treatment.
2. Identification of data
 Name
 Diagnosis
 Voluntary or referral

3. Case History
 Aparagraph giving age,gender,school attended etc.
 Socio economic status and family information.
 Information about physical health and mental health,symptoms and prognosis etc.
 Any professional help taken ,giving brief history of the problem etc.
 Recording signs and symptoms.
 Concluding comments.

Holiday Home work for class-XII (Geography)

 Complete the practical‟s given to you and prepare the report file.

Holiday Home work for class-XII (Physical Education)

 S.D. Public School, BU-Block, Pitampura

1. Draw the digram of your games/ sports with Arjun Awards/ Dhronacharya Awards /
fundamental skills, technique of your games.
 S.D. Public School, BU-Block, Pitampura

Holiday Home work for class-XII (English)

1. Prepare a graphic Organiser for each chapter and poem you have done in the class.The
GO should be creative, innovative and colourful and has to be done in lit. register.
2. Attempt thefollowing ques. In writing skills register-
a. Write a report for the school magazine on Tree Plantation Week celebrated in your
school recently.
b. Write articles for the newspaper on given topics
1.Women Empowerment
2. Importance of blood donation

c.Write a letter to the Hindustan Times ,Kasturba Gandhi Marg, Delhi, regarding
unfriendly staff
of local transport bus. You are Apporva ,resident ofB-2 Chandni Chowk,Delhi-6.
 S.D. Public School, BU-Block, Pitampura

Holiday Home work for class-XII (Chemistry)

CLASS X11-A2
Holiday H.W
Chemistry

1. Make a hand written practical or research based project on any of the topic discussed in
the class.
2. 2. To learn the “complete scheme “ for acidic and basic radical along with chemical
equations.
3. To learn CH-1,2 and 3(organic chemistry) for „unit test‟ exams to held in July.

Assignment
1. What happens when chlorine is passed through boiling toluene?
2. What is thee difference between hexa chlorobenzene and benzene hexa chloride?
3. Out of Br and I which is a better nucleophile and why?
4. Why is cyclo propyl chloride less reactive than cyclopentyl chloride towards SN1 reaction?
5. Account for the following:
(a) Use of D.D.T is banned in U.S.A since 1973?
(b) Benzlyic halides show high reactivity towards SN1 reaction?
(c) Vinyl halides are invert towards SN1 and SN2 reactions?

6. Ethyl alcohol and di methyl ether are isomeric but alcohol is a liquid at room temperature
while ehter is a gas . explain?
7. 3,3-dimethyl butan-2-ol loses a molecule of water in the presence of conc. H2So4 to give
tetramethyl ethylene as the major product. Suggest a suitable mechanism?
8. How do you account for the fact that unlike phenol 2,4-dinitrophenol is soluble in aqueous
sodium carbonate solution?
9. Dehydration of alcohol to from an alkene is always carried out with conc. H 2SO4 and not
with conc.HCl or HNO3 explain.?
10. 3,3-dimethyl butan -2-ol loses a molecule of water in the presence of conc H2SO4 to give
tetramethylene as the major product suggest a suitable mechanism.
11. Account for the following:-
(1) Phenol is acidic while cyclohexanol is neutral.
(2) Phenol has a small dipole moment than methanol.
(3) Anhydrous calcium chloride is not used for drying ethyl alcohol.
12. Predict in which of the following cases the reaction with Lucas reagent will be immediate
slow or will not take place at room temp.
 S.D. Public School, BU-Block, Pitampura

13.An organic compound „A‟ having molecular formula C6H6 gives a characteristic colour with
aqueous FeCl3 solution when „A‟ is treated with CO2 and NaOH at 400k under pressure ,
compound ,B is obtained. The compound B upon acidification gives compound C which reacts
with acetyl chloride to form „D‟ . It is a popular pain killer deduce the structures of A,B,C and D?
14. A compound A with molecular formula C4H10O reacts rapidly with metallic sodium but very
slowly with lucas reagent when (A) is treated with hot conc. H2SO4. It gives a compound B C4H8
which upon hydration with aqueous H2SO4 forms a compound C with molecular formula C4H10 O.
The compound C is almost inert to metallic sodium but reacts rapidly lucas reagent . What are
compounds A,B,C explain the reaction involves?
15. Give chemical test to distinguish between
(a) Isopropyl alcohol and n-propyl alcohol
(b) Phenol and alcohol
(c) Methyl ethanoate and ethyl ethanoate.
16. complete the following reaction
cold
(1) C2H5O-C2H5 + HCl -- ------
excess
(2) C2H5O-C2H5+HI--- ----
sunlight
(3)C2H5O-C2H5+Cl2--- ---
H2SO4
(4) (CH3)2 C=CH2+C2H5OH---- ----
17. Give the name of the reagent to bring about the following transformation
1. Hexan-1-ol to hexanal
2. cyclohexanol to cyclohexanone
3. Allyl alcohol to propanol
4. But-2-ene to ethanol
18. carbonyl compounds are more planar than alcohols although electronegativity difference
between C and O atoms is less than O and H atom. Explain ?
19. Why does pure HCN fail to react with aldehydes and ketons?
20. Why it is necessary to control PH during the reaction of aldehydes and ketons with ammonia
derivatives?
21. Why does aceto phenone gives iodoform test ?
22. A compound X (C2H4 O) on oxidation gives Y (C2H4O2 ) the compound X undergoes haloform
reaction . Write the structures of X and Y? Name the product when X is treated with NaOH ?
23. An organic compound „A‟ (C4H10O) is optically active. On mild oxidation it gives a compound
„B‟(C4H8O) but upon vigorous oxidation. It gives another compound „C‟ (C 3H6O2) the compound
„C‟ along with „D‟ are also formed from „B‟ by reaction with iodine in presence of alkali. Deduce
the structure of A,B,C and D?
24. A compound [A] of molecular formula C4H9 Br yield a compound [B] of molecular formula
C4H10O. when reacted with aqueous NaOH .On oxidation [B] gives a keton [C] . The vigorous
oxidation of ketone gives ethanoic acid . Deduce the structures of A,B,C,?
25. A ketone [A] which undergoes haloform reaction gives compound [B] on reduction.[B] on
heating with sulphuric acid gives compound [C] which forms monozonide [D]. The compound [D]
on hydrolysis in the presence of Z is dust gives acetaldehyde . Identify [A],[B],[C] and [D]?
 S.D. Public School, BU-Block, Pitampura

Class XII
Subject – Computer Science C++(083)

Do the questions of BooLean Algebra,Structured Query language,Networking and Revision

Tour of C++ of Class XI (ie Q. NO 1,5,6,7) from the previous years(2000-2011) Delhi and
Outside Delhi in your register.

Class XII
Subject – Informatics Practices (065)
Do the practical of HTML workshops and examples from your book and
complete your practical file.
Do the questions of finding output (JAVA) from Together with.
 S.D. Public School, BU-Block, Pitampura

Art
Class12th:-Fabric painting on 1.T-shirt