Stress-regulated grape CBFs

H. Xiao
et al.

Plant, Cell and Environment (2006) 29, 1410–1421 doi: 10.1111/j.1365-3040.2006.01524.x

Three grape CBF/DREB1 genes respond to low temperature,

drought and abscisic acid
HUOGEN XIAO*, MAHBUBA SIDDIQUA, SIOBHAN BRAYBROOK† & ANNETTE NASSUTH

Department of Molecular and Cellular Biology, University of Guelph, Guelph, Ontario, N1G 2W1, Canada

ABSTRACT regulatory sequence, C-repeat (CRT) or dehydration-

The C-repeat (CRT)-binding factor/dehydration-
responsive element (DRE) binding protein 1 (CBF/
DREB1) transcription factors control an important path-
way for increased freezing and drought tolerance in plants.
Three CBF/DREB1-like genes, CBF 1–3, were isolated
from both freezing-tolerant wild grape (Vitis riparia) and
freezing-sensitive cultivated grape (Vitis vinifera). The
deduced proteins in V. riparia are 63–70% identical to each
other and 96–98% identical to the corresponding proteins
in V. vinifera. All Vitis CBF proteins are 42–51% identical
to AtCBF1 and contain CBF-specific amino acid motifs,
supporting their identification as CBF proteins. Grape CBF
sequences are unique in that they contain 20–29 additional
amino acids and three serine stretches. Agro-infiltration
experiments revealed that VrCBF1b localizes to the
nucleus. VrCBF1a, VrCBF1b and VvCBF1 activated a
green fluorescent protein (GFP) or glucuronidase (GUS)
reporter gene behind CRT-containing promoters. Expres-
sion of the endogenous CBF genes was low at ambient
temperature and enhanced upon low temperature (4 ∞C)
treatment, first for CBF1, followed by CBF2, and about 2 d
later by CBF3. No obvious significant difference was
observed between V. riparia and V. vinifera genes. The
expression levels of all three CBF genes were higher in
young tissues than in older tissues. CBF1, 2 and 3 tran-
scripts also accumulated in response to drought and exog-
enous abscisic acid (ABA) treatment, indicating that grape
contains unique CBF genes.
Key-words: abiotic stress; cold; cold acclimation; freezing
and drought tolerance; Vitis.
INTRODUCTION
Plants acclimate to environmental stresses, such as low
temperature and drought, through biochemical and physi-
ological processes that result from the induced expression
or repression of a battery of target genes. One particular
Correspondence: Annette Nassuth. Fax: +1 519 7671656; e-mail:
anassuth@uoguelph.ca
Present addresses: *Department of Food Science, University of
Guelph, Guelph, Ontario, Canada; †Section of Plant Biology, Uni-
versity of California, Davis, CA, USA.
responsive element (DRE), was found in the promoter of
target Arabidopsis thaliana genes whose expression contrib-
utes to both low temperature and drought tolerance (Stock-
inger, Gilmour & Thomashow 1997; Gilmour et al. 1998; Liu
et al. 1998). This can be explained by the fact that tolerance
to both stresses requires stability of cell components during
dehydration. Two families of transcription factors binding
to CRT/DRE have been identified in A. thaliana (Stock-
inger et al. 1997; Gilmour et al. 1998; Liu et al. 1998). The
first, called CRT-binding factor/DRE binding protein 1
(CBF/DREB1), is encoded by genes whose expression is
rapidly induced in response to low, non-freezing tempera-
tures, but not by dehydration (Gilmour et al. 1998; Medina
et al. 1999). The second family of transcription factors,
called DRE binding protein 2 (DREB2), and one member
of the first family, CBF4/DREB1D, are encoded by genes
that are induced by drought, but not by low temperature
stress (Liu et al. 1998; Haake et al. 2002).
Although microarray and other analyses revealed that a
number of regulatory pathways likely play a role in toler-
ance to low temperature and drought stress (Fowler & Tho-
mashow 2002; Seki et al. 2002), the CBF/DREB1 pathway
alone appears sufficient to increase stress tolerance. Con-
stitutive expression of the CBF/DREB1 genes in transgenic
A. thaliana plants induces expression from CRT/DRE-
containing genes and results in an increase in freezing and
drought tolerance without a prior stimulus (Jaglo-Ottosen
et al. 1998; Liu et al. 1998; Kasuga et al. 1999; Gilmour et al.
2000; Haake et al. 2002). The potential utility of CBF/
DREB1 genes to improve stress tolerance prompted a
search for similar genes in many other plants. CBF/
DREB1-encoding genes have now been identified in higher
plants such as Brassica napus, tomato, wheat, rye, tobacco,
cotton, capsicum, cherry, rice and barley (Jaglo et al. 2001;
Choi, Rodriquez & Close 2002; Gao et al. 2002; Owens et al.
2002; Dubouzet et al. 2003; Xue 2003; Skinner et al. 2005).
The encoded proteins were found to have several amino
acid motifs in common. Putative functions have, so far,
been proposed for only two: nuclear localization for the
nuclear localization signal (NLS) motif and DNA binding
for the AP2 domain. However, the motifs can be used to
identify and classify members of this family of transcription
factors (Jaglo et al. 2001; Owens et al. 2002; Al-daoud 2004;
Skinner et al. 2005). For simplicity, we will refer to CBF/
DREB1 as CBF in the rest of this manuscript.

© 2006 The Authors

1410 Journal compilation © 2006 Blackwell Publishing Ltd

Vitis vinifera, the grape species that forms the basis of
most major wine industries, is native to Asia Minor and is
typically injured at temperatures below −20 °C (Winkler
1970). Freezing damage in winter and early spring results
in severe losses in vineyards in the cool climate regions
around the world. Different species of grape exhibit a
broad range of cold hardiness, but little is known about
freezing tolerance in Vitis at the molecular level. Here, we
identify three CBF genes and their expression in grape in
response to low temperature, drought and abscisic acid
(ABA). Both V. vinifera and its hardy relative, Vitis riparia,
were included to identify possible differences, which might
suggest potential strategies to produce cultivated grapes
with higher stress tolerance.
MATERIALS AND METHODS
Plant materials and treatments
Vitis riparia from Thunder Bay, Ontario, Canada and
V. vinifera cv. Chardonnay were obtained from Chateau des
Charmes Wineries in Niagara Peninsula, Ontario, Canada.
Cuttings were rooted and maintained in the glasshouse or,
where indicated, in controlled-environment growth cham-
bers programmed for, starting at 0600 h, 16 h light at an
intensity of 80–100 µm−2 s−1 and 22 °C followed by 8 h dark
at 20 °C. Two-month-old plants cultured from the buds of
V. riparia and V. vinifera were also used for some experi-
ments. Tobacco (Nicotiana tabacum cv. Petite Havana
or Nicotiana benthamiana) was grown in controlled-
environment growth chambers under the same conditions.
Cold treatment was started by transferring the plants
between 0900 and 1000 h to a growth chamber set at 4 °C
and with constant light. Dehydration was induced by plac-
ing detached leaves on a dry filter paper. The final fresh
weight (FW) of these leaves was 91.3% of the starting
values after 15 min, 79.3% after 1 h and 22.9% after 24 h
of desiccation. For ABA treatments, detached leaves were
first soaked into 100 µM ABA in 0.02% v/v polyoxyethyl-
ene-sorbitan monolayrate (Tween-20) and then immedi-
ately placed on a filter paper soaked in ABA solution. As
controls, detached leaves were placed on a filter paper
soaked in water or Tween solution and kept humid. Treat-
ments continued for various periods, as indicated in the text
and in the figures. Collected samples, consisting of two to
four young (first and second) or mature (fifth and sixth)
leaves, young (green) or mature (brown) buds, apical tips
and/or young stems (green stems starting just below the
apical tip until the fourth leaf position), were immediately
frozen in liquid N2 and stored at −80 °C until their use.
DNA extraction and digestion
DNA from V. riparia Thunderbay, V. vinifera cv. Chardon-
nay and A. thaliana was extracted essentially according to
the procedure described by Sambrook & Russell (2001).
Aliquots of genomic DNA (10 µg) were digested overnight
at 37 °C with the indicated restriction enzyme (Fermentas,
© 2006 The Authors
Journal compilation © 2006 Blackwell Publishing Ltd, Plant, Cell and Environment, 29, 1410–1421
Stress-regulated grape CBFs 1411
Burlington, ON, Canada), in the presence of 1% polyvi-
nylpyrrolidone 40 (PVP40) to increase the DNA digestion
(Nassuth, unpublished results).
Isolation of CBF-like genes from grape
Partial putative CBF orthologs in V. riparia were amplified
by PCR [using conditions described for reverse transcrip-
tion (RT)–PCR, but without RT step and for 35 cycles].
Primers CBFd1-H (5′-TTYMRDGAGACDMGDC
ACCC-3′) and CBFd4-C (5′-ARRAGMADNCCYTC
NGCCAT-3′), designed based on the sequences encoding
the conserved CBF-specific domains PKK/RPAGRxKFx-
ETRHP and NMAEGMLLPP in A. thaliana CBF1, 2 and
3 (Gilmour et al. 1998; Medina et al. 1999) and Brassica
CBF (Jaglo et al. 2001), were used. The resulting PCR prod-
ucts were cloned in pGEM-T easy vector (Promega, Mad-
ison, WI, USA) and sequenced using dye terminator cycle
sequencing on an ABI PRISM model 377 (Guelph Molec-
ular Supercentre, University of Guelph, Ontario, Canada).
Flanking sequences were amplified from V. riparia
genomic DNA by nested inverse PCR (iPCR) according to
a protocol modified by Sambrook & Russell (2001) with
two primer pairs, F1 and R1, and F2 and R2, specific for
each obtained sequence (VrCBF1-F1: 5′-CCAGGATATG
GCTAGGCACC-3′; VrCBF1-R1: 5′-CCGCACGCCTCT
GTATATTG-3′; VrCBF1-F2: 5′-CTCAATTTCTCCGAC
TCGGC-3′; VrCBF1-R2: 5′-GGTGTCGTGTCTCCCG
GAA-3′; VrCBF2-F1: 5′-AACTTCTTCTGTCGTAG
ACA-3′; VrCBF2-R1: 5′-TTATCCATTACGAAAGGT
GT-3′; VrCBF2-F2: 5′-ATCGGTGGATAGTAAGAGC
G-3′; VrCBF2-R2: 5′-AGATGACGATGATGGAGGTT-
3′; VrCBF3-F1: 5′-ATGCAGTGAAGACTCGCCTC-3′;
VrCBF3-R1: 5′-GCTACAGGCAGTGACATGTG-3′;
VrCBF3-F2: 5′-CTCTCCACATGGTTCGAGC-3′; VrCBF3-
R2: 5′-TAAGAAGAGGATGAAGACGG-3′). V. riparia
genomic DNA was digested with either EcoRI, HindIII,
XbaI and NcoI. The digested DNAs were purified using
QIAEX II Kit (Qiagen, Valencia, CA, USA), and 300 ng
was self-ligated overnight at 15 °C in a total volume of
100 µL with 0.04 U µL−1 T4 DNA ligase (Roche Diagnostics
Canada, Laval, QC, Canada). Five microlitres of each liga-
tion mixture was added directly to a 50 µL PCR reaction
containing F1 and R1 primers. The PCR reaction conditions
included a 3 min extension step. One microlitre of the first-
round PCR mixture was added to a second-round PCR
with the nested primers F2 and R2. Amplification was suc-
cessful for HindIII- and XbaI-digested DNA with Vitis
CBF1-specific primers (to give Vitis CBF1a and Vitis
CBF1b sequence, respectively), for NcoI-digested DNA
with Vitis CBF2-specific primers, and for XbaI-digested
DNA with Vitis CBF3-specific primers. Amplified products
were cloned into pGEM-T easy vector and sequenced.
Primers designed against the obtained sequences were
used to amplify the complete coding regions of the three
V. riparia CBFs and their homologs in V. vinifera. These
primers were VrCBF1-H-10 (5′-CTCTCTCTCCATGGAC
TCGG-3′), VrCBF1-C930 (5′-TTAATTCTTCCTAATA
1412 H. Xiao et al.
TAAGTATATATATTTATG-3′), VrCBF2-H-39 (5′-TCTC
GTCTCCAACTCTTACT-3′), VrCBF2-C897 (5′-ACCT
GAAGTCCATCCAAGTT-3′), VrCBF3-H-63 (5′-CTCT
CAATCTCTTTCTACTTGC-3′) and VrCBF3-C802 (5′-
AATGTGAACACTAGGCAGTG-3′). At least four clones
were sequenced for each Vitis CBF. The coding regions of
the CBF grape genes described in this report have been
deposited in the GenBank database under AY390370
(VrCBF1a), AY390371 (VrCBF1b), AY390373 (VrCBF2),
AY390374 (VrCBF3), AY390372 (VvCBF1), AY390376
(VvCBF2) and AY390375 (VvCBF3).
Southern blot analysis
Vitis riparia Thunderbay and V. vinifera cv. Chardonnay
DNAs were digested with restriction enzymes whose rec-
ognition sites were absent in the determined Vitis CBF
sequences. The digested DNA was separated by agarose gel
electrophoresis, denatured and transferred to a positively
charged nylon membrane (Roche) and bound using the
Stratalinker 2400 UV cross linker (Stratagene, La Jolla, CA,
USA). Digoxigenin-11-2′-deoxyuridine-5′-triphosphate
(dUTP) (Roche)-labelled probes were prepared by PCR on
the different grape CBF plasmid DNAs to produce frag-
ments corresponding to either the complete CBF1 coding
region (primers VrCBF1-H-10; VrCBF1-C753: 5′-TTAAT
CATCATTCCACAAAGACAAGTCA-3′) or, for specific
primers, the C-terminal region starting after AP2 of CBF1a,
of CBF2 or of CBF3 (primers VrCBF1-H556: 5′-TG
GATACTAAGAGGTCAGAG-3′ and VrCBF1-C930;
VrCBF2-F1 and VrCBF2-C897; VrCBF3-F1 and VrCBF3-
C802). The procedures described in the digoxigenin (DIG)
system user’s Guide for Filter Hybridization (Boehringer
Mannhein/Roche) were followed for pre-hybridization,
hybridization and development of the membrane. High
sodium dodecyl sulphate (SDS) buffer [7% SDS, 50%
deionized formamide, 5× standard saline citrate (SSC), 4%
blocking reagent (Roche), 50 mM sodium phosphate
(pH 7.0) and 0.1% N-laurolysarcosine] was used for both
pre-hybridization for at least 1 h at 42 °C, and for hybrid-
ization overnight at 42 °C after the addition of 25 ng mL−1
heat-denatured DIG-labelled DNA probe.
Preparation of fusion protein construct for
localization study
Two fusion protein constructs were prepared for the
nuclear localization experiment. For the Vitis CBF–green
fluorescent protein (GFP) fusion, the coding sequence for
V. riparia CBF1b was amplified by PCR from CBF1b clones
using primers BamHI + VrCBF1-H1 (5′-GGCGGATC
CAAGGAGATATAACAATGGACTCGGACCACGAA
GAG-3′) and EcoRI + VrCBF1-C750 (5′-GGAATTCAT
CATCATTCCACAAAGACAAGTCA-3′). Similarly, the
coding sequence for modified green-fluorescent protein
(mGFP5) (J. Haselhof, University of Cambridge, Cam-
bridge, UK) was amplified without endoplasmic reticulum
(ER)-targeting signal and ER- retention signal (KDEL), by
Journal compilation © 2006 Blackwell Publishing Ltd, Plant, Cell and Environment, 29, 1410–1421
PCR from the small, cloning plasmid p35S–mgfp5 (Lee
et al. 2001) using primers EcoRI + mgfp5-H3 (5′-GGAAT
TCAGTAAAGGAGAAGAACTTTTC-3′) and SacI +
mgfp5-C737 (5′-GGCGAGCTCTTATTTGTATAGTTCA
TCCATGCC-3′). The BamHI–EcoRI-digested VrCBF1b
and EcoRI–SacI-digested mgfp5 fragments were simulta-
neously ligated into BamHI–SacI-digested intermediate
plasmid, and the resulting construct was sequenced to con-
firm that the construct encodes a 492 amino acid long CBF–
GFP fusion protein. The VrCBF1b–mGFP5 fusion frag-
ment was then subcloned into BamHI–SacI-digested
pBI121 (Clontech, Mountain View, CA, USA) behind the
cauliflower mosaic virus 35S (CaMV35S) promoter to
produce pBIN35S::VrCBF1b–mGFP5. Similarly, part of
the β-glucuronidase (GUS) coding sequence was amplified
by PCR using primers BamH1 + gus-H1 (5′-GGCGG
ATCCAAGGAGATATAACAATGTTACGTCCTGTAG
AAAC-3′) and EcoRI + gus-C786 (5′-GGAATTCGACG
CACAGTTCATAGAGAT-3′), digested and ligated with
the mgfp5 fragment to produce a sequence encoding a
GUS∆–GFP fusion protein similar in size (494 aa) to the
VrCBF1b–mGFP5 protein. The resulting control plasmid
was named pBIN35S::GUS∆–GFP. The vectors were intro-
duced into Agrobacterium tumefaciens strain EHA105.
Preparation of transactivation constructs
All constructs for transactivation experiments were first
prepared in the smaller cloning plasmid p35S–mgfp5 or
pGEM-T, to facilitate cloning and selection. Clones were
confirmed by sequencing, and then introduced into pBI121
(Clontech). Both p35S–mgfp5 and pBI121 contain the same
sequence from CaMV35S promoter to nopaline synthase
(NOS) terminator (located on a HindIII–SacI fragment).
Initial reporter plasmids contained mGFP5–ER, an ER-
targeted, modified GFP. This reporter was chosen because
ER localization apparently allows greater accumulation
and better fluorescence detection of the GFP (Grebenok
et al. 1997; Haseloff et al. 1997; Haseloff & Siemering 1998).
mGFP5–ER, derived from p35S–mgfp5, was subcloned
into pBI121 to produce pBIN35S::mGFP5–ER as a positive
control. Three types of reporter plasmids were used: one
with the A. thaliana RD29A promoter sequence, one with
four CRT elements in front of the −46 minimal 35S
promoter sequence and, as a negative control, one with the
−46 minimal 35S promoter sequence only. The RD29A pro-
moter sequence was amplified by PCR from A. thaliana
genomic DNA with primers HindIII + RD29Apro-H-944
(5′-CCCAAGCTTGAGCCATAGATGCAATTC-3′) and
BamHI + RD29Apro-H-22 (5′-CGGGATCCAATAGAA
GTAATCAAACC-3′). The minimal 35S promoter
sequence with or without 4CRT was amplified from vector
DNA with primers HindIII + 4CRT 35S-H-46 (5′-CCGA
AGCTTACCGACATTACCGACATTACCGACATTAC
CGACATTACGCAAGACCCTTCCTCTA-3′) or HindIII
+ 35S-H-46 (5′-CCGAAGCTTCGCAAGACCCTTCCT
CTA-3′) and BamHI/XbaI + 35S-C (5′-CGGGGATCCTC
TAGAGTC-3′). The HindIII–BamHI fragments containing
© 2006 The Authors

the promoters were used to replace the 35S promoter
and produce, respectively, pBINRD29A::mGFP5–ER,
pBIN4CRTmin35S::mGFP5-ER and pBINmin35S::
mGFP5-ER. For later experiments, where indicated,
mGFP5-ER was replaced with GUSPlus (CAMBIA, Can-
berra, Australia) because GUSPlus contains an intron, thus
allowing the detection of plant-specific glucuronidase
expression only. The GUSPlus gene was amplified from
pCAMBIA 1305.1 (GenBank AF364045; CAMBIA) with
primers BamHI + GUSPlus-H1: 5′-GGCGGATCCAAG
GAGATATAACAATGGTAGATCTGAGGGTAAATT
TC-3′ and SacI + GUSPlus-C-2057: 5′-GGCGAGCTCA
ATTCACACGTGATGGTGATG-3′, and subcloned to
produce pBINmin35S::GUSPlus or pBIN4CRTmin35S::
GUSPlus. All constructs were introduced into A. tumefa-
ciens strain EHA105. To prepare the effector plasmid, the
coding sequence of A. thaliana CBF1 was amplified by PCR
from A. thaliana genomic DNA using primers AtCBF1-H1
(5′-CGGGATCCTTATCCAGTTTCTTGAAA-3′) and
AtCBF1–C766 (5′-CCATTCTAAAAAAGGAACTA-3′)
and cloned into BamHI–SacI-digested plasmid to replace
mGFP5–ER and produce pBIN35S::AtCBF1. Similarly,
V. riparia CBF1a and CBF1b, and V. vinifera CBF1 were
amplified from their plasmids with primers BamHI +
VrCBF1-H1 and SacI + VrCBF1-C753 (5′-GGCGAGCT
CTTAATCATCATTCCACAAAGACAAGTCA-3′) and
subcloned to produce pBIN35S::VrCBF1a, pBIN35S::
VrCBF1b and pBIN35S::VvCBF1. All final constructs were
confirmed by restriction digestion and introduced into
A. tumefaciens strain EHA105 by the freeze–thaw method
(Hofgen & Willmitzer 1988).
Agro-infiltration of tobacco leaves
Agrobacterium containing individual constructs was cul-
tured overnight at 28 °C and 300 r.p.m. in Luria Bertani
medium containing 50 µg mL−1 of kanamycin and
10 µg mL−1 of rifampicin. One millilitre of the culture was
transferred to 50 mL fresh medium containing 10 mM 2-
morpholinoethanesulfonic acid (MES) (pH 5.6) and 40 µM
acetosyringone, and again cultured overnight until the
OD600 was 1. The bacteria were pelleted at 2860 g in a
Hermle Z320K centrifuge (Hermle, Gosheim, Germany)
for 10 min and resuspended in 10 mM MgCl2 to give a final
volume of 100 mL for nuclear localization experiments or
50 mL for transactivation experiments (i.e. equivalent to an
OD of 0.5 or 1). Acetosyringone (150 µM) was added and
the bacterial suspensions were kept at room temperature
for at least 3 h without shaking.
Expanded tobacco (N. tabacum cv. Petite Havana or
N. benthamiana) leaves were infiltrated with a suspension
of Agrobacterium using a 1 mL needleless syringe. For
transactivation experiments, equal volumes of A. tumefa-
ciens containing the reporter construct pRD29A::mGFP5–
ER, and of A. tumefaciens containing an effector
construct, such as 35S::AtCBF1, were mixed before infil-
tration (i.e. equivalent to a final OD of 0.5 for each
A. tumefaciens strain). Controls with only one construct-
© 2006 The Authors
Journal compilation © 2006 Blackwell Publishing Ltd, Plant, Cell and Environment, 29, 1410–1421
Stress-regulated grape CBFs 1413
containing Agrobacterium were mixed with an equal vol-
ume of untransformed Agrobacterium. The infiltrated
leaves were collected after 2–3 d for visualization of GFP
fluorescence in epidermal peels (mounted in water) by
epifluorescence microscopy (with a Carl Zeiss/Jenalumar
SH250 UV illumination microscope, Jena, Germany) or
confocal microscopy (with a Leica TCS SP2, Heidelberg,
Germany), for GUS activity assay or, where indicated,
for RNA isolation. The fluorometric analysis of GUS
activity was carried out essentially as described by
Jefferson 1987).
Semi-quantitative RT–PCR
Total RNA was extracted from harvested leaves using the
Plant RNeasy Mini Kit (Qiagen) according to Nassuth et al.
(2000). Approximately 100 mg of plant tissue was ground
in 2 mL of extraction lysis buffer, and RNA isolated from
half of the extract was collected in 100 µL ribonuclease
(RNase) free H2O. Total RNA (25 µL) was treated with
2 µL (4 U) of RNase-free deoxyribonuclease (DNase)
(Ambion, Austin, TX, USA) in 1× DNase buffer [20 mM
tris(hydroxymethyl)aminomethane (Tris)–HCl (pH 8.0)
and 10 mM MgCl2] for approximately 1 h at 37 °C followed
by incubation at room temperature for 2 min with 6 µL of
DNase inactivation reagent (Ambion). The inactivation
reagent was pelleted by centrifugation and aliquots of the
RNA-containing supernatant were stored at −80 °C.
One-tube RT–PCR (Nassuth et al. 2000) was used to
semi-quantify specific mRNAs. Each RT–PCR mixture
(final volume 25 µL) contained 10 mM Tris–HCl (pH 8.8),
100 mM KCl, 1.5 mM MgCl2, 200 µM deoxynucleotide triph-
osphates (dNTPs) (Mg balanced), 5 mM dithiothreitol
(DTT), 2% (w/v) sucrose, 0.1 mM cresol red (Sigma, St.
Louis, MO, USA), 0.2 U avian myeloblastosis virus reverse
transcriptase (AMV RT) (Roche), 4 U Thermus aquaticus
(Taq) polymerase (Fermentas), 2.5 µL of DNase-treated
total RNA and 0.5 µM of each primer. The primers used
were specific for Vitis CBF1 (VrCBF1-H464: 5′-AGTTG
CAGACTCGAAGAAGG-3′ and VrCBF1-C778: 5′-AA
TCTAAGCGCACCTATGTC-3′), Vitis CBF2 (VrCBF2-F1
and VrCBF2-C897), Vitis CBF3 (VrCBF3-F1 and VrCBF3-
C802), GFP (mGFP5–H11: 5′-GAGAAGAACTTTTCA
CTGGA-3′ and mGFP5-C711: 5′-GTATAGTTCATCCA
TGCCAT-3′ or mGFP5ER H34: 5′-TCACTTCTCCTAT
CATTATCCTC-3′ and mGFP5ER C371: 5′-TCGTCCT
TGAAGAAGATGGT-3′) or GUSPlus (GUSPlus-H-11 g:
5′-GGAGATATAACAATGGTAGATCTGAGG-3′ and
GUSPlus-C599: 5′-GCGATTCATGCCATCACG-3′). The
amplification was carried out in a thermocycler (PTC-100;
MJ Research, Waltham, Germany) using one incubation at
42 °C for 45 min (RT) followed by 28–35 cycles at 94 °C for
30 s, 54 °C for 45 s and 72 °C for 1 min, with a final incuba-
tion at 72 °C for 5 min. The number of cycles (28–35) was
chosen such that maximum amplification was not yet
reached, as determined by gel electrophoresis. Identical
reactions without RNA or reverse transcriptase were
included for each set of RT–PCR as negative controls.
1414 H. Xiao et al.
Control reactions with primers specific for Vitis malate
dehydrogenase (VvMDH-H968: 5′-GCATCTGTGGTT
CTTGCAGG-3′ and VvMDH-C1163: 5′-CCCTTTGAG
TCCACAAGCCAA-3′), tobacco malate dehydrogenase
(NtMDH-H4: 5′-CCTGGTGTTGCCGCTGAT-3′ and
NtMDH-C352: 5′-TTGCCCTAACAACATCAAGTGT-3′)
or tobacco ribulose 1·5-bisphosphate carboxylase/oxygen-
ase (Rubisco)-L (RbcL-H681: 5′-TGGACTTGATTTTAC
CAAAGATGATG-3′ and RbcL-C1231: 5′-TGTCCTAAA
GTTCCTCCACC-3′) were also included to show that
equal amounts of RNA were used in each set of reactions.
RESULTS
CBF genes are present in V. riparia and V. vinifera
To identify and isolate CBF-like sequences from grape, we
designed the degenerate primers CBFd1-H and CBFd4-C,
based on conserved regions in A. thaliana and Brassica
CBF proteins (Gilmour et al. 1998; Medina et al. 1999; Jaglo
et al. 2001), and used these primers for PCR on V. riparia
DNA. Two DNA fragments of about 500 and 400 bp were
amplified, cloned and sequenced (data not shown). Three
different sequences with high homology to A. thaliana CBF
were identified in the 500 bp fragment-derived clones.
Flanking sequences for each were amplified by nested
iPCR reactions.
Sequence type 1-specific primers amplified fragments of
2.7 and 2.2 kb on, respectively, HindIII- and XbaI- digested
and self-ligated V. riparia genomic DNA. To confirm the
obtained sequences, we designed primers outside the iden-
tified open reading frame and used those in PCR on undi-
gested V. riparia DNA. Fourteen clones from four
independent PCR reactions for the open reading frame
were sequenced and it turned out that nine were identical
to the HindIII fragment sequence, whereas the other five
were identical to the XbaI fragment sequence. The two
derived sequences were named, respectively, VrCBF1a and
Journal compilation © 2006 Blackwell Publishing Ltd, Plant, Cell and Environment, 29, 1410–1421
Figure 1. Amino acid sequence
alignment of CBF proteins from Vitis and
Arabidopsis thaliana. The CBF sequences
and their GenBank accession numbers
are VrCBF1a (AY390370), VrCBF2
(AY390373) and VrCBF3 (AY390374)
from Vitis riparia; VvCBF1 (AY390372),
VvCBF2 (AY390376) and VvCBF3
(AY390375) from Vitis vinifera; and
AtCBF1 (U77378) from A. thaliana. The
dashes indicate gaps introduced for better
alignment. Identical amino acids are
shaded black, conserved substitutions are
shaded grey. The total number of amino
acids for each protein is indicated at the
end of each sequence. The AP2/EREBP
domain; putative nuclear localization
signal (NLS); and A, P, DSAWRL and
LWSY motifs are indicated by solid lines.
Serine repeats are indicated by arrows.
VrCBF1b. Both contained an open reading frame for a
protein of 251 amino acids with a predicted molecular mass
of 27.6 kDa. VrCBF1a and VrCBF1b differ only at residues
20 and 108, with an asparagine and proline in VrCBF1a,
and a serine and serine in VrCBF1b. One CBF1 sequence,
VvCBF1, was also amplified from V. vinifera genomic
DNA. The encoded protein was of similar size and 98%
identical to VrCBF1a (Fig. 1). The grape CBF1 proteins are
rich in serine (14–14.7%), alanine (9.2%), leucine (8.4%),
arginine (6.8%) and aspartic acid (6.8%). The isoelectric
point (pI) of VrCBF1a/1b and VvCBF1 are 8.01 and 8.9,
respectively.
Sequence type 2-specific primers amplified a 1.1 kb frag-
ment on NcoI-digested and self-ligated genomic DNA. The
subsequently amplified coding sequences of CBF2 from
V. riparia and V. vinifera (Fig. 1) showed that VrCBF2 and
VvCBF2 are 250 and 253 amino acids long with a predicted
molecular mass of 27.6 and 27.7 kDa, respectively. VrCBF2
and VvCBF2 are 96% identical to each other and, respec-
tively, 70 and 68% identical to VrCBF1. They are rich in
serine (14.8/17%), alanine (9.6/10.3%), arginine (7.1/7.6%),
proline (7.2/5.9%) and aspartic acid (6.4/6.3%), and have a
pI of 9.89/9.71.
Sequence type 3-specific primers amplified a 1.9 kb frag-
ment on XbaI-digested and self-ligated genomic DNA. The
subsequently amplified coding sequences of CBF3 from
V. riparia and V. vinifera (Fig. 1) showed that VrCBF3 and
VvCBF3 contained an open reading frame for proteins of
239 amino acids with a predicted molecular mass of 25.9
and 26 kDa, respectively. VrCBF3 and VvCBF3 are 96%
identical to each other and 68/69 and 62/63% identical to
VrCBF1 and VrCBF2. They are rich in serine (17.2/17.2%),
alanine (10/10.5%), arginine (7.5/7.1%), leucine (6.7/6.7%)
and glutamic acid (6.7/6.7%), and have a pI of 6.24/6.12.
The grape CBF1, 2 and 3 proteins are very similar to
A. thaliana CBF1 with an identity of 51, 46 and 42/44%,
with as major differences an extra region of 20–29 amino
acids within the C-terminal acidic domain and the presence
© 2006 The Authors

of three serine repeats, one at the N-terminal region and
the other two in the activation domain (Fig. 1). All Vitis
CBF proteins contain an AP2 DNA-binding domain and
characteristic CBF protein motifs (Jaglo et al. 2001; Owens
et al. 2002; Al-daoud 2004) (Fig. 1). These include a puta-
tive NLS sequence, which is identical (HKRK-
AGRKKFRETRH) in Vitis CBF1 and 3, but has a slightly
different sequence (HKRKTGR/KKKFRKTRH) in Vitis
CBF2. However, the Vitis CBFs lack the proline (P) found
at position one in the NLS of all other reported CBF pro-
teins. A second sequence in Vitis CBF1 and 2 is identical to
another consensus sequence in eudicot CBF proteins,
DSAWRL, but slightly different in Vitis CBF3. In addition,
an A motif with the Vitis CBF-specific sequence G/EDI/
VQV/FAAL/IxAA/TK/MAF and a P motif with the Vitis
CBF-specific sequence MAEGLLLT/APP, but only part of
the C-terminal LWSY domain, are present. Taken together,
these results indicate that the isolated grape sequences are
AtCBF orthologs, but have unique features.
The Vitis CBF gene family contains at least
four members
To determine how many similar CBF genes are present in
grape, we hybridized the digested V. riparia and V. vinifera
genomic DNA with three specific probes containing
sequences corresponding to the region downstream of the
AP2 domain of VrCBF1a, VrCBF2, and VrCBF3, and a
non-specific probe containing the full-length VrCBF1a cod-
ing region. The Vitis CBF1-specific probe detected two
bands in the EcoRI, HindIII and XbaI digest (Fig. 2b). The
sizes of the fastest migrating HindIII and XbaI bands cor-
responded to the sizes expected for, respectively, CBF1a
and CBF1b, based on the iPCR amplification of a 2.7 kb
HindIII fragment and a 2.2 kb XbaI fragment with Vitis
CBF1-specific primers. The Vitis CBF2-specific probe
detected two bands each in EcoRI and HindIII, and one
band in XbaI digests (Fig. 2c). One band was detected in
all restriction digests with the Vitis CBF3-specific probe
(Fig. 2d). The bands detected by the full-length VrCBF1a
(a) (b) (c)
kb
© 2006 The Authors
Journal compilation © 2006 Blackwell Publishing Ltd, Plant, Cell and Environment, 29, 1410–1421
Stress-regulated grape CBFs 1415
probe included those detected by the Vitis CBF1- and Vitis
CBF2-specific probes, however, not those detected by the
Vitis CBF3-specific probe. This might be explained by two
dissimilar regions in the sequence of Vitis CBF3 compared
to the other two Vitis CBF genes (Fig. 1). The full-length
VrCBF1a probe also detected an additional band in the
EcoRI, HindIII and XbaI digests (indicated by arrowheads
in Fig. 2a). The Southern blot analysis with V. vinifera
genomic DNA showed the same pattern as V. riparia
(Fig. 2a–d). These results indicate that there are at least
four CBF genes in both V. riparia and V. vinifera: CBF1,
CBF2, CBF3 and one unknown gene with high similarity
to the CBF1 and CBF2 genes. Two different alleles appear
to be present for CBF1, and possibly also for the other
genes.
Vitis CBF1 localizes to the nucleus
Transcription factors have to localize to the nucleus to acti-
vate genomic gene expression. The identified Vitis CBFs
have a putative NLS sequence that is slightly different from
that of all other reported CBF proteins, with a histidine
instead of the bending proline at position 1 (Fig. 1). We
therefore analysed, by agro-infiltration, the localization of
a VrCBF1b–GFP fusion protein construct under the con-
trol of a CaMV35S promoter. The epidermal tissue of
tobacco leaves was examined under the epifluorescence
microscope and confocal microscope 2 d after agro-
infiltration. The 35S::VrCBF1b–GFP construct induced
fluorescence in nuclei only (Fig. 3a), whereas the
35S::GUS∆–GFP control showed GFP fluorescence
throughout the whole cell (Fig. 3b). This result indicates
that VrCBF1b can target to nuclei.
VrCBF1a, VrCBF1b and VvCBF1 transactivate
expression of a CRT/DRE-containing gene
If the grape CBF proteins function as transcription factors,
then we would expect them to activate genes with a CRT/
DRE element in their promoter. We examined this for Vitis
(d) Figure 2. Southern blot of Vitis riparia
and Vitis vinifera DNA. The total genomic
DNA (10 µg) was digested with restriction
enzymes EcoRI (E), HindIII (H)
and XbaI (X). The same membrane
was hybridized consecutively with
digoxygenin-labelled DNA probe
corresponding to (a) the entire coding
region of VrCBF1a (full-length probe), (b)
the 3′-untranslated region of VrCBF1a
(specific probe), (c) the 3′-untranslated
region of VrCBF2 (specific probe) and (d)
the 3′-untranslated region of VrCBF3
(specific probe). The arrow indicates the
extra band detected by VrCBF1 full-
length probe, but not by the three specific
probes. The results are representative of
two independent experiments.
1416 H. Xiao et al.
(a) (b)
(c) (d)
Figure 3. Grape CBF protein localizes to the nucleus. Tobacco
leaves were infiltrated with Agrobacterium containing plasmid with
35S::VrCBF1–mGFP5 or 35S::GUS–mGFP5 (control) and
examined 2 d later. Confocal and corresponding differential
interference contrast (DIC) images of tobacco epidermal cells
showing nuclear localization of VrCBF1– green fluorescent protein
(GFP) fusion protein (molecular mass ∼52 kDa) [ (a) and (c)] and
cytoplasm localization of β-glucuronidase (GUS)–GFP fusion
protein (molecular mass ∼53 kDa) [ (b) and (d)]. Nuclei are
marked by arrows. The results are representative of two
independent experiments.
CBF1 proteins by co-infiltration of tobacco leaves with two
agrobacteria (Yang, Li & Qi 2000), one containing an effec-
tor plasmid with a CBF-encoding region driven by consti-
tutive CaMV35S promoter and the other containing a
reporter plasmid with a mGFP5–ER encoding region under
the control of the cold-inducible RD29A promoter which
includes four CRT/DRE cis-elements (Yamaguchi-
Shinozaki & Shinozaki 1993) (Fig. 4). Activation of expres-
sion from the RD29A promoter could therefore be
detected as GFP fluorescence by epifluorescence micros-
copy and as GFP transcripts by RT–PCR. All cells in
each field with on average 74 cells fluoresced with the
35S::mGFP5–ER positive control construct (7) (Fig. 4).
Only one or two cells per field fluoresced with the
RD29A::mGFP5–ER construct in the absence of CBF, sug-
gesting that essentially no expression occurred [(5) and (6)]
(Fig. 4). However, co-infiltration with the 35S::AtCBF con-
trol (1) (Fig. 4) resulted in an average of 20 fluorescent cells,
and co-infiltration with the 35S::VrCBF1a (2) (Fig. 4),
35(S)::VrCBF1b (3) (Fig. 4) or 35S::VvCBF1 (4) (Fig. 4)
gave on average 58, 52 or 18 cells with GFP fluorescence.
The amount of GFP transcripts, as determined by RT–PCR,
followed a similar pattern (Fig. 4b). This experiment was
repeated two times with similar results.
To confirm that the observed activation is caused by an
interaction with CRT (as expected for a true CBF = CRT-
binding factor), we also examined VrCBF1 transactivation
of GFP or GUSPlus reporter behind four copies of CRT
elements plus a minimal 35S promoter. The analysis of
Journal compilation © 2006 Blackwell Publishing Ltd, Plant, Cell and Environment, 29, 1410–1421
RNA expression required the use of the intron-containing
GUSPlus as reporter because this allowed the detection of
spliced transcripts (i.e. plant-expressed RNA) and thereby
avoid detection of some bacterial RNA that was expressed
with the 35S minimal promoter constructs. GFP or GUS-
Plus expression analysis, as fluorescence or GUS activity
and the presence of spliced GUS RNA transcripts, showed
that VrCBF1 specifically interacts with CRT elements to
cause an activation (Fig. 5).
Taken together, these results indicate that Vitis CBF1 can
activate the expression of a gene with CRT/DRE sequence
as cis-element, presumably by binding to it. In addition,
these results confirm that the Agrobacterium-mediated
transient assay (Yang et al. 2000) is a simple and rapid
method to analyse the in vivo interaction between tran-
scription factors and cis-acting elements.
CBF1, CBF2 and CBF3 transcripts differentially
accumulate in response to low temperature
To investigate the cold induction of grape CBFs, grape
plants were transferred to low temperature (4 °C) and
leaves were collected after various periods of time. Semi-
quantitative RT–PCR with specific primers was used to
analyse Vitis CBF expression. The identity of the amplified
fragments was confirmed by sequencing representative
(a) (b) (c)
Figure 4. Transactivation of C-repeat (CRT)/dehydration-
responsive element (DRE)-containing promoter by VrCBF1,
VvCBF1 and AtCBF1. (a) Combinations of reporter and effector
plasmids used in the co-infiltration assays. The reporter GFP gene
is driven by the RD29A promoter containing CRT/DRE elements,
the effector plant CBF gene is driven by the cauliflower mosaic
virus 35S (CaMV35S) promoter. (b) Semi-quantitative reverse
transcription (RT)–PCR detection of GFP, CBF and ribulose 1·5-
bisphosphate carboxylase/oxygenase (Rubisco)-L (control)
expression in tobacco leaves infiltrated with the reporter and
effector plasmid combinations presented in (a). (c) Number of
fluorescent cells observed by epifluorescent microscopy in
epidermal tissue from tobacco leaves infiltrated with the reporter
and effector plasmid combinations presented in (a). Data are mean
and SD of 20 fields, each containing on average 74 cells, from at
least two different infiltrated leaves. The results are representative
of two independent experiments.
© 2006 The Authors
 Stress-regulated grape CBFs 1417

(a) (b) (c)

GUS activity (nm mg–1 min–1)

GUSPlus
AtCBF1
VrCBF1
MDH
Effector Reporter

(1) Non–agroinfiltrated plants

(2) min 35S:: GUSPlus

(3) 4CRTmin 35S:: GUSPlus

(4) 35S:: AtCBF1 + min 35S:: GUSPlus

(5) 35S:: AtCBF1 + 4CRTmin 35S:: GUSPlus

(6) 35S:: VrCBF1 + min 35S:: GUSPlus

(7) 35S:: VrCBF1 + 4CRTmin 35S: :GUSPlus

Figure 5. Transactivation of promoters with C-repeat (CRT) elements only. (a) Combinations of reporter and effector plasmids used in
the co-infiltration assays. The GUSPlus reporter gene is driven by a promoter with or without four CRT elements in front of a minimal
(−46) 35S promoter sequence, the effector plant CBF gene is driven by the constitutively expressing cauliflower mosaic virus 35S (CaMV35S)
promoter. (b) Semi-quantitative reverse transcription (RT)–PCR detection of GUSPlus, CBF and MDH (control) expression in tobacco
leaves infiltrated with the reporter and effector plasmid combinations presented in (a). (c) β-glucuronidase (GUS) activity (mean and SD)
determined for tobacco leaves infiltrated with the reporter and activator combinations presented in (a). Similar expression results were
obtained with green fluorescent protein (GFP) as reporter.

samples. Note that the Vitis CBF1-specific primers will
detect transcripts from both CBF1a and CBF1b.
Mature leaves of 2-month-old V. vinifera cv. Chardonnay
plants under unstressed control conditions expressed
VvCBF1, VvCBF2 and VvCBF3 (Fig. 6a, lane 1). The tran-
script levels were low for VvCBF2 and VvCBF3, but higher
for VvCBF1, although to a varying extent in different
experiments (compare Fig. 6a & d). Upon exposure to low
temperature, the expression of VvCBF1 was detected for a
short period, also if the initial pretreatment levels were very
low, but decreased 1–2 h after the start of the treatment
(Fig. 6a). Cold treatment enhanced the amount of VvCBF2
and VvCBF3 transcripts. The VvCBF2 transcript levels
were highest during the 2–12 h period of treatment, then
decreased but remained detectable to at least 7 d after
transfer to 4 °C (Fig. 6a). The expression of VvCBF3 was
barely detected during the first 24 h of exposure to 4 °C,
whereas a significant increase was observed after 1–2 d, and
this increase continued for at least a further 3 d. The expres-
sion profile of CBF1, CBF2 and CBF3 in response to cold
in leaves from 2-month-old V. riparia Thunderbay leaves
appeared to be very similar to that observed in V. vinifera
cv. Chardonnay (Fig. 6a & b). Less-to-no transcripts were
detected in leaves from plants that were not transferred to
cold (Fig. 6c, control). In a similar experiment with mature
leaves from 2-year-old V. vinifera cv. Chardonnay and
V. riparia Thunderbay plants, only very low levels of CBF1
and CBF2 transcript were detected at any time point,
although some expression of CBF3 was detected after 2 d
of exposure to 4 °C (data not shown). A comparison of
CBF expression between different tissues of the same 2-
year-old V. vinifera cv. Chardonnay plant showed that
young leaves contained higher amounts of CBF1, CBF2
and CBF3 transcripts than mature leaves after cold induc-
tion (Fig. 6d). Low temperature enhanced all three tran-
scripts in young leaves, apical tips, young buds and young
stems (Fig. 6e), except for CBF1 in leaves. Taken together,
these results suggest that the younger the grape tissue, the
higher the CBF1–3 expression level, and that CBF1, CBF2
and CBF3 expression is highest, respectively, immediately,
after a few hours, or after a few days of starting a cold
treatment.
Grape CBF transcripts accumulate in response
to drought stress and ABA treatment
Because young leaves expressed higher levels of CBF tran-
scripts than mature leaves upon exposure to low tempera-
ture, we used detached young leaves from V. vinifera cv.
Chardonnay plants for our next set of experiments. The
leaves were placed on a filter paper with or without water
to investigate the effect of drought stress, or on a filter
paper with Tween solution without (control) or with 100 µM
ABA to investigate the effect of exposure to ABA. Drying
induced VvCBF1, VvCBF2 and VvCBF3 within 15 min to
relatively high levels, but transcript levels declined later
(Fig. 7a). VvCBF1 and VvCBF2, but not VvCBF3, were
similarly induced by ABA (Fig. 7b). No transcripts were
induced in water (not shown) and Tween controls (Fig. 7c).
DISCUSSION
The results presented in this paper suggest the presence of
at least five CBF-like genes in grape. Three of these genes
were isolated from both V. riparia and V. vinifera and
named, respectively, VrCBF1, VrCBF2, VrCBF3 and
VvCBF1, VvCBF2, VvCBF3. We found two variants of
VrCBF1 sequence, encoding proteins differing in only two
amino acid residues. Because these two sequences were
cloned in four independent experiments, we assume that
they are not the result of PCR amplification or sequencing
errors, but reflect the presence of two alleles in the grape

© 2006 The Authors

Journal compilation © 2006 Blackwell Publishing Ltd, Plant, Cell and Environment, 29, 1410–1421
1418 H. Xiao et al.

(a) genome, although we cannot exclude the possibility that

they represent two recently duplicated genes. Most likely,
the two bands detected by the Vitis CBF1-specific probe on
Southern blots correspond to the two sequences. The detec-
tion of two bands also by the Vitis CBF2-specific probe
suggests that a similar situation might exist for this gene. A
putative fourth gene was detected with the Vitis CBF1 full-
length probe, but not any of the Vitis CBF gene-specific
(b) probes. This fourth Vitis CBF-like gene still has to be iso-
lated, but its detection under stringent hybridization condi-
tions suggests that it is similar to Vitis CBF1 and CBF2. A
fifth CBF gene in grape, with a shorter coding sequence, is
represented by the 400 bp fragment that was amplified by
the degenerate CBF-specific primers. The isolation and
analysis of this gene and its expression are in progress and
will be reported in a separate paper. The presence of a CBF
(c)
gene family in plants appears common. Five to six CBF/
DREB1 genes have been reported for the eudicots
A. thaliana and Brassica, at least 14 or more for rice and
barley (Gilmour et al. 1998; Medina et al. 1999; Choi et al.
2002; Gao et al. 2002; Dubouzet et al. 2003; Xue 2003; Skin-
ner et al. 2005). The fact that the CBF gene fragments were

(a)
(d)

(b)
(e)

(c)
Figure 6. Changes in Vitis CBF transcript levels in response to
low temperature. Vitis vinifera cv. Chardonnay and Vitis riparia
Thunderbay plants grown at 22 °C were subjected to low
temperature (4 °C) treatment. Samples were taken at the indicated
times, with zero time samples taken prior to treatment. The levels
of CBF1, CBF2, CBF3 and MDH (control) transcripts were
determined by semi-quantitative reverse transcription (RT)–PCR
analysis. (a) Leaves from 2-month-old V. vinifera cv. Chardonnay.
(b) Leaves from 2-month-old V. riparia Thunderbay. (c) Leaves
from 2-month-old V. vinifera cv. Chardonnay and V. riparia Figure 7. Changes in Vitis CBF transcript levels in response to
Thunderbay kept at 22 °C (control treatment). (d) Apical tips, dehydration and abscisic acid (ABA). Detached young leaves of
young leaves and mature leaves from 2-year-old V. vinifera cv. Vitis vinifera cv. Chardonnay plants were subjected to (a) drought,
Chardonnay. (e) Apical tips, young leaves, young buds and young (b) ABA, (c) water plus Tween (water control) treatments, and the
stems from 2-year-old V. vinifera cv. Chardonnay. The results are levels of CBF1, CBF2, CBF3 and MDH (control) transcripts were
representative of at least two independent experiments. determined by semi-quantitative reverse transcription (RT)–PCR
analysis. All zero time samples are of control plant tissues prior to
treatments. The results are representative of two independent
experiments.

© 2006 The Authors

Journal compilation © 2006 Blackwell Publishing Ltd, Plant, Cell and Environment, 29, 1410–1421

successfully isolated from grape by PCR with the degener-
ate primers CBFd1-H and CBFd4-C suggests that these two
primers should be very useful in isolating additional CBF
genes from other eudicots.
To determine if the three Vitis CBF genes presented in
this paper encode true CBFs, we analysed whether they are
similar to eudicot CBFs with respect to: (1) CBF-specific
amino acid domains; (2) induction of transcription from
genes with CRT elements in their promoter; and (3) tran-
script accumulation in response to abiotic stress. The three
Vitis CBF proteins, like all proteins belonging to the CBF
gene family, have an AP2 domain and several other char-
acteristic amino acid motifs (Jaglo et al. 2001; Al-daoud
2004). The sequence motifs are mostly as expected for eud-
icot CBF proteins (Al-daoud 2004), however, there are
some notable differences. The first position of the putative
nuclear localization sequence is a histidine, to give a stretch
of four basic amino acids, instead of the proline present in
all other eudicot CBFs reported so far. Our targeting and
transactivation experiments suggest that the grape CBFs
still function despite this change. Like the Prunus
PaDREB1A and PaDREB1B, the Vitis CBFs lack a com-
plete LWSY motif at the C-terminus. No function has yet
been ascribed to this motif, so it is unknown what the con-
sequence is of it missing. The Vitis CBFs do contain three
serine repeats, one at the N-terminus, similar to several
CBF proteins from Solanaceae (Jaglo et al. 2001), Rosaceae
(Owens et al. 2002) and Poaceace (Choi et al. 2002;
Dubouzet et al. 2003), and two in the activation domain,
which seem to be unique (Fig. 1). These repeats might play
a role in the activation of transcription by these proteins
(Riechmann & Meyerowitz 1998). The grape CBF1 and
CBF2, but not CBF3, proteins are basic. Basic CBF pro-
teins are relatively unique for eudicot CBF proteins, only
the Fragaria FaCBF1 and Prunus PaDREB1B were
reported to be basic (see Al-daoud 2004). Finally, the three
CBF proteins from both V. riparia and V. vinifera are larger
than most of the other CBF proteins, 239–253 amino acid
long, because of an extra region of 24–29 amino acids in
their acidic domains.
CBF proteins from A. thaliana bind to CRT/DRE ele-
ments to induce the expression of their target genes (Jaglo-
Ottosen et al. 1998; Kasuga et al. 1999; Gilmour et al. 2000;
Haake et al. 2002). We therefore investigated if a grape
CBF can activate the expression of a gene with CRT ele-
ments in its promoter. Agro-infiltration experiments in
tobacco leaves showed that Vitis CBF1 can activate
reporter gene expression from promoters containing CRT
elements as part of the RD29A promoter or in addition to
a minimal 35S promoter (4CRT35S). This activation
occurred at room temperature, showing that no cold-
induced modification of the Vitis CBF is necessary. Recent
preliminary freezing tests with transgenic A. thaliana lines
show that over-expression of VrCBF1 results in increasing
freezing tolerance compared to wild-type A. thaliana plants
(data not shown). We conclude that the VrCBF1 and
VvCBF1 reported here are most likely functional copies of
the grape CBF gene family.
© 2006 The Authors
Journal compilation © 2006 Blackwell Publishing Ltd, Plant, Cell and Environment, 29, 1410–1421
Stress-regulated grape CBFs 1419
The three Vitis CBF genes were expected to respond to
cold, like most CBF genes in other plants. Our results
showed that CBF1, CBF2 and CBF3 transcripts were
detectable in different tissues (apical tips, leaves, buds and
stems) when exposed to low temperature, with higher levels
in young tissues compared to mature tissues. It is possible
that this reflects an adaptation to cold conditions in early
spring when the buds burst and new leaves begin to
develop. The three Vitis CBF transcripts accumulated in
different time periods after exposure to low temperature:
first CBF1 (minutes), then CBF2 (hours) and finally, after
2 d, CBF3 (days). Novillo et al. (2004) recently reported
that the transcript levels of the A. thaliana CBF genes
reflect the negative regulation of AtCBF1 and AtCBF3
expression by AtCBF2. Whether a similar situation exists
for the grape CBF genes remains to be answered. Tran-
scription of the three Vitis CBF genes was also induced by
drought and ABA. Most CBF genes, including AtCBF1-3,
are induced by cold but not drought (Gilmour et al. 1998;
Shinwari et al. 1998; Medina et al. 1999), and only one gene,
AtCBF4, is induced by drought but not cold (Haake et al.
2002). Conflicting reports have appeared regarding the
responsiveness of AtCBF1-4 genes to ABA (Haake et al.
2002; Sakuma et al. 2002; Knight et al. 2004). Knight et al.
(2004) argue that this is because the age and conditions of
plants influence the response. ABA levels are thought to
increase only transiently in response to low temperatures
instead of cumulatively under drought conditions (Tho-
mashow 1999). However, the transient relatively low levels
of ABA might be sufficient to enhance the response to
subsequent, stronger stresses. Indeed, Knight, Brandt &
Knight (1998) showed in an earlier report that plant cells
could have a memory of earlier stress encounters. The
plants that gave an ABA response were smaller and there-
fore possibly more easily stressed and more sensitive to
ABA (Knight et al. 2004). It is possible that a similar situ-
ation exists for the young grape tissues we used. This could
explain the varying amounts of grape CBF1 transcripts we
detected under control conditions. The recently reported
response of at least one barley CBF gene to ABA confirms
that not all CBF genes are ABA insensitive (Skinner et al.
2005).
The results presented in this paper show that grape plants
contain a CBF pathway, presumably to deal with abiotic
stress. We did not present evidence to support the hypoth-
esis that the CBF genes reported in this paper are respon-
sible for the difference in freezing tolerance between
V. riparia and V. vinifera. The Vitis CBF genes are induced
in the same tissues, by the same cues and at the same time.
However, an equal amount of transcripts does not neces-
sarily mean equal stress tolerance. For example, CBF tran-
script levels were not correlated with a leaf order-
dependent enhancement of freezing tolerance in cold-
acclimated A. thaliana (Takagi et al. 2003). It is also possi-
ble that the CBF expression of V. riparia and V. vinifera
differs in a post-transcriptional step, for example, in their
binding preference for CRT elements with different flank-
ing sequences as shown for rice and barley CBF proteins
1420 H. Xiao et al.
(Dubouzet et al. 2003; Xue 2003; Skinner et al. 2005). The
observed higher induction by VrCBF1 compared to
VvCBF1 in the transactivation assay (Fig. 4) might be
caused by such a difference and deserves further study.
Another possibility is that the situation in grape is similar
to that shown for tomato (Zhang et al. 2004) in that the
freezing-sensitive cultivar, V. vinifera, might have a smaller
CBF regulon than the freezing-tolerant cultivar, V. riparia.
ACKNOWLEDGMENTS
The research was supported by Chateau des Charmes Win-
eries, St. Catherine, Ontario, Canada and the Food Science
Biotechnology Centre at the University of Guelph. We
thank Sandra Stewart for technical assistance with prelim-
inary experiments, Raymond Lee for critical reading of the
manuscript and Judith Strommer for the supply of the clon-
ing plasmid p35S–mGFP5ER.
REFERENCES
Al-daoud F. (2004) Evolution of the CBF/DREB1 gene family into
different types. MSc thesis, University of Guelph, Ontario,
Canada.
Choi D.-W., Rodriguez E.D. & Close T.J. (2002) Barley Cbf3 gene
identification, expression pattern, and map location. Plant Phys-
iology 129, 1781–1787.
Dubouzet J.G., Sakuma Y., Ito Y., Kasuga M., Dubouzet E.G.,
Miura S., Seki M., Shinozaki K. & Yamaguchi-Shinozaki K.
(2003) OsDREB genes in rice, Oryza sativa L., encode transcrip-
tion activators that function in drought-, high salt-, and cold-
responsive gene expression. Plant Journal 33, 751–763.
Fowler S. & Thomashow M.F. (2002) Arabidopsis transcriptome
profiling indicates that multiple regulatory pathways are acti-
vated during cold acclimation in addition to the CBF cold
response pathway. Plant Cell 14, 1675–1690.
Gao M.-J., Allard G., Byass L., Flanagan A.M. & Singh J. (2002)
Regulation and characterization of four CBF transcription fac-
tors from Brassica napus. Plant Molecular Biology 49, 459–471.
Gilmour S.J., Zarka D.G., Stockinger E.J., Salazar M.P., Hough-
ton J.M. & Thomashow M.F. (1998) Low temperature regula-
tion of the Arabidopsis CBF family of AP2 transcriptional
activators as an early step in cold-induced COR gene expression.
Plant Journal 16, 433–442.
Gilmour S.J., Sebolt A.M., Salazar M.P., Everard J.D. & Tho-
mashow M.F. (2000) Overexpression of the Arabidopsis CBF3
transcriptional activator mimics multiple biochemical changes
associated with cold acclimation. Plant Physiology 124, 1854–
1865.
Grebenok R.J., Peirson E., Lambert G.M., Gong F.-G., Afonso
C.L., Halderman-Cahill R., Carrington J.C. & Galbraith D.W.
(1997) Green-fluorescent protein fusions for efficient character-
ization of nuclear targeting. Plant Journal 11, 573–586.
Haake V., Cook D., Riechmann J.L., Pineda O., Thomashow M.F.
& Zhang J.Z. (2002) Transcription factor CBF4 is a regulator of
drought adaptation in Arabidopsis. Plant Physiology 130, 639–
648.
Haseloff J. & Siemering K.R. (1998) The uses of green fluorescent
protein in plants. In Green Fluorescent Protein: Properties,
Applications, and Protocols (eds M. Chalfie & S. Kain), pp. 191–
220. Wiley-Liss, New York, USA.
Haseloff J., Siemering K.R., Prasher D.C. & Hodge S. (1997)
Removal of a cryptic intron and subcellular localization of green
Journal compilation © 2006 Blackwell Publishing Ltd, Plant, Cell and Environment, 29, 1410–1421
fluorescent protein are required to mark transgenic Arabidopsis
plants brightly. Proceedings of the National Academy of Sciences
of the USA 94, 2122–2127.
Hofgen R. & Willmitzer L. (1988) Storage of competent cells for
Agrobacterium transformation. Nucleic Acids Research 16, 9877.
Jaglo K.R., Kleff S., Amundsen K.L., Zhang X., Haake V., Zhang
J.Z., Deits T. & Thomashow M.F. (2001) Components of the
Arabidopsis C-repeat/dehydration-responsive element binding
factor cold-response pathway are conserved in Brassica napus
and other plant species. Plant Physiology 127, 910–917.
Jaglo-Ottosen K.R., Gilmour S.J., Zarka D.G., Schabenberger O.
& Thomashow M.F. (1998) Arabidopsis CBF1 overexpression
induces COR genes and enhances freezing tolerance. Science
280, 104–106.
Jefferson R.A. (1987) Assaying chimeric genes in plants: the GUS
gene fusion system. Plant Molecular Biology Reporter 5, 387–
405.
Kasuga M., Liu Q., Miura S., Yamaguchi-Shinozaki K. & Shi-
nozaki K. (1999) Improving plant drought, salt, and freezing
tolerance by gene transfer of a single stress-inducible transcrip-
tion factor. Nature Biotechnology 17, 287–291.
Knight H., Brandt S. & Knight M.R. (1998) A history of stress
alters drought calcium signalling pathways in Arabidopsis. Plant
Journal 16, 681–687.
Knight H., Zarka D.G., Okamoto H., Thomashow M.F. & Knight
M.R. (2004) Abscisic acid induces CBF genes transcription and
subsequent induction of cold-regulated genes via the CRT pro-
moter element. Plant Physiology 135, 1710–1717.
Lee R.W.H., Strommer J., Hodgins D., Shewen P.E., Niu Y. & Lo
R.Y.C. (2001) Towards development of an edible vaccine
against bovine pneumonic pasterellosis using transgenic white
clover expressing a Mannheimia haemolytica A1 leukotoxin 50
fusion protein. Infection and Immunity 69, 5786–5793.
Liu Q., Kasuga M., Sakuma Y., Abe H., Miura S., Yamaguchi-
Shinozaki K. & Shinozaki K. (1998) Two transcription factors,
DREB1 and DREB2, with an EREBP/AP2 DNA binding
domain separate two cellular signal transduction pathways in
drought- and low-temperature-responsive gene expression,
respectively, in Arabidopsis. Plant Cell 10, 1391–1406.
Medina J., Bargues M., Terol J., Perez-Alonso M. & Salinas J.
(1999) The Arabidopsis CBF gene family is composed of three
genes encoding AP2 domain-containing proteins whose expres-
sion is regulated by low temperature but not by abscisic acid or
dehydration. Plant Physiology 119, 463–469.
Nassuth A., Pollari E., Helmeczy K., Stewart S. & Kofalvi S. (2000)
Improved RNA extraction and one-tube RT–PCR assay for the
simultaneous detection of control plant RNA plus several viruses
in plant extracts. Journal of Virological Methods 90, 37–49.
Novillo F., Alonso J.M., Ecker J.R. & Salinas J. (2004) CBF2/
DREB1C is a negative regulator of CBF1/DREB1B and CBF3/
DREB1A expression and plays a central role in stress tolerance
in Arabidopsis. Proceedings of the National Academy of Sciences
of the USA 101, 3985–3990.
Owens C.L., Thomashow M.F., Hancock J.F. & Iezzoni A.F.
(2002) CBF1 orthologs in sour cherry and strawberry and het-
erologous expression of CBF1 in strawberry. Journal of the
American Society of Horticultural Sciences 127, 489–494.
Riechmann J.L. & Meyerowitz E.M. (1998) The AP2/EREBP fam-
ily of plant transcription factors. Journal of Biological Chemistry
379, 633–646.
Sakuma Y., Liu Q., Dubouzet J.G., Abe H., Shinozaki K. &
Yamaguchi-Shinozaki K. (2002) DNA-binding specificity of the
ERF/AP2 domain of Arabidopsis DREBs, transcription factors
involved in dehydration- and cold-inducible gene expression.
Biochemical and Biophysical Research Communications 290,
998–1009.
© 2006 The Authors

Sambrook J. & Russell D.N. (2001) Molecular Cloning: A Labo-
ratory Manual, 3rd edn. Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, New York, USA.
Seki M., Narusaka M., Ishida J., et al. (2002) Monitoring the
expression profiles of 7000 Arabidopsis genes under drought,
cold and high-salinity stresses using a full-length cDNA microar-
ray. Plant Journal 31, 279–292.
Shinwari Z.K., Nakashima K., Miura S., Kasuga M., Seki M.,
Yamaguchi-Shinozaki K. & Shinozaki K. (1998) An Arabidopsis
gene family encoding DRE/CRT binding proteins involved in
low-temperature–responsive gene expression. Biochemical and
Biophysical Research Communications 250, 161–170.
Skinner J.S., von Zitzewitz J., Szucs P., Marquez-Cedillo L., Fili-
chkin T., Amundsen K., Stockinger E.J., Thomasow M.F., Chen
T.N.N. & Hayes P.M. (2005) Structural, functional, and phylo-
genetic characterization of a large CBF gene family in barley.
Plant Molecular Biology 59, 533–551.
Stockinger E.J., Gilmour S.J. & Thomashow M.F. (1997) Arabi-
dopsis thaliana CBF1 encodes an AP2 domain-containing
transcriptional activator that binds to the C-repeat/DRE, a
cis-acting DNA regulatory element that stimulates transcrip-
tion in response to low temperature and water deficit. Pro-
ceedings of the National Academy of Sciences of the USA 94,
1035–1040.
Takagi T., Nakamura M., Hayashi H., Inatsugi R., Yano R. &
Nishida I. (2003) The leaf-order-dependent enhancement of
freezing tolerance in cold-acclimated Arabidopsis rosettes is not
© 2006 The Authors
Journal compilation © 2006 Blackwell Publishing Ltd, Plant, Cell and Environment, 29, 1410–1421
Stress-regulated grape CBFs 1421
correlated with the transcript levels of the cold-inducible tran-
scription factors of CBF/DREB1. Plant Cell Physiology 44, 922–
931.
Thomashow M.F. (1999) Plant cold acclimation: freezing tolerance
genes and regulatory mechanisms. Annual Review of Plant
Physiology and Plant Molecular Biology 50, 571–599.
Winkler A.J. (1970) General Viticulture. University of California,
San Diego, CA, USA.
Xue G.-P. (2003) The DNA-binding activity of an AP2 tran-
scriptional activator HvCBF2 involved in regulation of low-
temperature responsive genes in barley is modulated by temper-
ature. Plant Journal 33, 373–383.
Yamaguchi-Shinozaki K. & Shinozaki K. (1993) Characterization
of the expression of a desiccation-responsive rd29 gene of Ara-
bidopsis thaliana and analysis of its promoter in transgenic
plants. Molecular and General Genetics 263, 331–340.
Yang Y., Li R. & Qi M. (2000) In vivo analysis of plant promoters
and transcription factors by agroinfiltration of tobacco leaves.
Plant Journal 22, 543–551.
Zhang X., Fowler S.G., Cheng H., Lou Y., Rhee S.Y., Stockinger
E.J. & Thomasow M.F. (2004) Freezing-sensitive tomato has a
functional CBF cold-response pathway, but a CBF regulon that
differs from that of freezing-tolerant Arabidopsis. Plant Journal
39, 905–919.
Received 4 January 2006; accepted for publication 15 February
2006