Studies on Litter Size Effect of Seven Microsatellite Markers in Xinong Saanen Dairy Goat

ABSTRACT: Seven microsatellite Markers OarAE101, BM1329, OarHH55, BM143, BMS2508, OarAE129 and OarFCB11 closely associated to the high reproduction trait in sheep were analysed for polymorphisms in Xinong Saanen dairy goat. The results indicated that there were high genetic polymorphisms at five microsatellite loci. The number of effective alleles (Ne) varied from 4.2913 to 10.5423, polymorphism information content (PIC) varied from 0.7373 to 0.8974 in Xinong Saanen dairy goat. The analysis of the effect of the six microsatellite loci on the litter size of Xinong Saanen dairy goat indicated: these microsatellite loci had positive effect on the litter size including the allele 109 bp at OarAE101, 165 bp and 140 bp at OarHH55, 124 bp at BM143, 205bp at OarAE129, the genotype 219 bp/185 bp at BM1329, 209 bp/188 bp at OarFCB11. Key Words: Microsatellite markers, Xinong saanen dairy Goat, Genetic polymorphism, Litter size

INTRODUCTION Microsatellites, also known as simple sequence repeats, are long stretches of a short (16 bp), tandemly repeated DNA unit, such as the motif CAA repeats 20 times. Microsatellites are common throughout eukaryotic genomes and their length are often highly polymorphic, making them powerful markers for use in genetic mapping (Weber, 1990; Dietrich et al., 1994; Dib et al., 1996; Roder et al., 1998), population genetics (Jarne and Lagoda, 1996; Di Rienzo et al., 1998; Thuillet et al., 2002), and determination of kinship (Queller et al., 1993). Dairy goat farming is significant to the economics of the western China with characteristics of under-

development and poverty. According to the comparative genomics, 5 microsatellite loci OarAE101, BM1329, OarHH55, BM143, BMS2508 (Lord et al., 1996; Vaiman et al., 1996; Ihara et al., 2004) that are linked to the fecundity gene FecB in the sheep, also in goat and cattle chromosome 6, microsatellite locus OarAE129 at goat chromosome 7(Penty et al., 1993; Vaiman et al., 1996) and OarFCB11 at goat chromosome 2 (Vaiman et al., 1996) which are closely associated with the high reproduction trait in sheep were selected to obtain useful molecular markers for Xinong Saanen dairy goats selection and breeding through markers-assisted selection (MAS). MATERIALS AND METHODS DNA samples Genomic DNA samples were obtained from 196 Xinong Saanen dairy goat adult ewes that have at least twice consecutive litter size birth records. DNA samples were extracted from blood according to the kit of DNA extracted from blood. Information of primer sequences and 7 microsatellite loci The information of primer sequences and the amplified loci are included in Table 1. PCR conditions The 12L PCR amplification system contains 50 ng genomic DNA, 10pM each primer, 1.2L dNTPs (0.25mM each), MgCl2 (4.0mM or 3.0mM), and 0.5U Taq DNA polymerase (MBI). The cycling procedure is as follows: 4 min at 95, 35 cycles at 94 for 30 s, annealing at 54-65 corresponding to 7 different primer pairs for 1min, 72 for 1.5 min, with a final extension at 72 for 10 min. Polymorphisms of 7 microsatellite loci were detected by 12% PAGE (82821.0mm) using constant voltage (180V) for 2-2.5 h. Silver staining was used to detect DNA fragment (Yun-Tao Ji et al 2007). Statistical analysis The average heterozygosity (He), the effective numbers of alleles (Ne) and the polymorphism information

content (PIC) of 7 microsatellite loci in Xinong Saanen dairy goats were analyzed by the Cluster Analysis software(Poultry Institute of the Chinese Academy of Agricultural Science). The relationships and differences between 7 microsatellite loci and litter size in Xinong Saanen dairy goats were analyzed using GLM (general linear model) method, which was performed by SPSS software(version 11.5). Liner model: Yij=+Mi+eij, which Yij is the litter size trait measured on each of the ijth animal, is the overall population mean, Mi is the fixed effects associated with ith genotype and eij is the random error. RESULTS The figures are results of electrophoresis at 7 microsatellite loci. We can see that 6 microsatellite loci have polymorphisms in Xinong Saanen dairy goat from figure 1 to 7 except for the BMS2508 microsatellite locus. The allele frequencies of 6 polymorphisms microsatellite loci In Xinong Saanen dairy goat 8 alleles of OarAE101 microsatellite locus were found with fragment size from 109bp to 137bp, the maximum frequency is 0.25 of 114bp; 7 alleles of OarAE129 microsatellite locus were found with fragment size from 155bp to 205bp, the maximum frequency is 0.3878 of 205bp; 10 alleles of BM1329 and OarHH55 microsatellite loci were found, with fragment size from 182bp to 234bp and 125bp to 170bp at BM1329 and OarHH55 microsatellite locus respectively, the maximum frequency is 0.1480 of 225bp and 190bp at BM1329 microsatellite locus, and 0.1837 of 165bp at OarHH55 microsatellite locus; 11 alleles of BM143 microsatellite locus were found with fragment size from 105bp to 140bp, the maximum frequency is 0.2041 of 132bp and 115bp; 12 alleles were found at OarFCB11 microsatellite locus, which is the most one, with fragment size from 156bp to 215bp, and the maximum frequency is 0.1582 of 185bp (Table 2). So we could see that the degree of variation at OarFCB11 microsatellite locus is maximum and at OarAE129 microsatellite locus is minimum. These 6 microsatellite loci can be used for genetic diversity assessment of Xinong Saanen dairy goat with significant polymorphisms. Genetic information of the 6 polymorphic microsatellite loci
3

The average heterozygosity (He), number of effective alleles (Ne), polymorphism information content (PIC) are measured to reflect the genetic variation within groups. The PIC, Ne and He of 6 polymorphic microsatellite loci in Xinong Saanen dairy goats is OarFCB11>BM1329>OarHH55>BM143>OarAE101>OarAE129, which show that the PIC, Ne and He have a positive correlation in Xinong Saanen dairy goats with the same order. The litter size effect of the 6 polymorphic microsatellite loci in Xinong Saanen dairy goat The linear model analysis results show that the 6 polymorphic microsatellite loci have significantly different effects to litter size trait at 0.01 level which the allele 109 bp at OarAE101, 165 bp and 140 bp at OarHH55, 124 bp at BM143, 205bp at OarAE129, the genotype 219 bp/185 bp at BM1329, 209 bp/188 bp at OarFCB11 have positive effects to litter size (Table 4). DISCUSSION Genetic diversity analysis of the 6 polymorphic microsatellite loci in Xinong Saanen dairy goat Polymorphism information content (PIC) value is defined as the probability that a given marker genotype of an offspring of an affected parent will allow deduction of the parental genotype at marker locus. The gene locus is the highly informative if PIC>0.5, reasonably informative is 0.25<PIC<0.5 and slightly informative is PIC<0.25 (Botstein et al., 1980). According to this theory, the 6 microsatellite loci are highly informative, and this result is the same with the polymorphisms at microsatellite loci OarAE101 and BM1329 in Small Tail Han sheep (Chu et al., 2002) and also the same with the polymorphisms at microsatellite locus OarAE101 in three goat breeds(Boer goat, Taihang goat and Hebei dairy goat) (Zhang et al.2003). Heterozygosity(He) also known as genetic diversity. Heterozygosity is defined as the probability that a random individual chosen from the population is heterozygous at a locus (Shete et al., 2000). It is generally believed that it is optimal parameter for genetic variation metric of groups. In 6 polymorphic microsatellite loci

in our study, the maximum heterozygosity is 0.8974 of OarFCB11 microsatellite locus, and the minimum heterozygosity is 0.7373 of OarAE129 microsatellite locus. The effective number of allele (Ne) is the reciprocal of purity; it shows the interaction between the allele. The more uniform the alleles distributed in the group, the more close the number of effective alleles to the absolute number of detected allele. In this study, the effective number of alleles (Ne) ranges from 4.2913(OarAE129) to 10.5423(OarFCB11) at 6 polymorphysic microsatellite loci (OarAE101, BM1329, OarHH55, BM143, OarAE129, OarFCB11). Litter size effect of the 6 polymorphic microsatellite loci in Xinong Saanen dairy goat In Australian Booroola Merino sheep, the hyperprolificacy is because of the action of a single autosomal gene (FecB) that influences the number of ovulations per estrous cycle in the ewe (Davis et al., 1982; Piper et al., 1985). By genetic analysis of 31 informative half-sib families from heterozygous sires, the results show that the FecB locus is situated in the region of ovine chromosome 6 corresponding to the human chromosome 4q22 23(Mulsant et al., 2001). The microsatellite loci BM1329, OarAEl0l and a third microsatellite marker (unpublished) which maps between BM1329 and OarAEl0l, were used to detect the inheritance of the chromosome region around the FecB locus. Genotypes could be determined only when there was a known relationship between the chromosome region, as defined by marker alleles, and FecB. The proximal half sheep chromosome 6 genetic linkage map that show the order of microsatellite markers and FecB is: McM53, OarJLlA, CENPE, BM1329, FecB, OarAEl01, OarHH55, BM143, OarJMP36 (Lord et al., 1996; Lord et al., 1998). These microsatellite loci have been used as candidate molecular markers for sheep litter size trait. In 5 microsatellite loci (OarAE101, BM1329, BM143, OarHH55 and OarHH35) for the litter size of Small Tailed Han sheep, the OarAE101 is the best one, BM1329 is better than BM143 and OarHH35, no any other significant markers were discovered at OarHH55 (Lei et al 2003). At the OarHH35 locus, the allele of 135 and 125 bp for litter size in Xiangdong black goat had significant positive effects. At BMS2508 locus, the allele of
5

145 and 93 bp had significant positive effects on the litter size of Xiangdong black goat, and had significant negative effects to the litter size of Xiangdong black goat at the allele of 122 bp. At OarAE101 locus, the allele 107, 109, 111, 119 and 125 bp had positive effects for the litter size in Xiangdong black goat. At BM143 locus, there were positive effects among the allele 104, 106, 110 bp for the litter size of Xiangdong black goat (Ouyang et al 2006). The statistical results revealed different significance between litter size trait and all genotypes of 6 polymorphic microsatellite loci (P 0.05), only at OarAE129 microsatellite locus the results have different significance at 0.01 level. Our research indicate: the allele 109 bp at OarAE101, 165 bp and 140 bp at OarHH55, 124 bp at BM143, 205 bp at OarAE129, the genotype 219 bp/185 bp at BM1329, 209 bp/188 bp at OarFCB11, have positive effect to litter size trait. REFERENCES: Botstein, D., R. L. White, M. Skolnick and R. W. Davis. 1980. Construction of a genetic-linkage map in man using restriction fragment length polymorphisms. American Journal of Human Genetics. 32(3):314-331. Chu, M. X., J. Z. Wang, A. G. Wang, N. Li and J. L. Fu. 2002. Genetic polymorphisms of five microsatellite loci in Small Tail Han sheep. Yi Chuan Xue Bao. 29(6):502-6. Davis, G. H., G. W. Montgomery, A. J. Allison, R. W. Kelly and A. R. Bray. 1982. Segregation of a major gene influencing fecundity in progeny of booroola sheep. New Zealand Journal of Agricultural Research. 25(4):525-529. Di Rienzo, A., P. Donnelly, C. Toomajian, B. Sisk, A. Hill, M. L. Petzl-Erler, G. K. Haines and D. H. Barch. 1998. Heterogeneity of microsatellite mutations within and between loci, and implications for human demographic histories. Genetics. 148(3):1269-1284. Dib, C., S. Faure, C. Fizames, D. Samson, N. Drouot, A. Vignal, P. Millasseau, S. Marc, J. Hazan, E. Seboun, M. Lathrop, G. Gyapay, J. Morissette and J. Weissenbach. 1996. A comprehensive genetic map of the

human genome based on 5,264 microsatellites. Nature. 380(6570):152-4. Dietrich, W. F., J. C. Miller, R. G. Steen, M. Merchant, D. Damron, R. Nahf, A. Gross, D. C. Joyce, M. Wessel, R. D. Dredge and et al. 1994. A genetic map of the mouse with 4,006 simple sequence length polymorphisms. Nat Genet. 7(2 Spec No):220-45. Lei X Q, Chen H, Xu T S, et al. 2003. Microsatellite markers on fecundity trait of Small Tailed Han Sheep (J). Acta Veterinariaet Zootechnica Sinica, 3(6), 530~535(in Chinese with English abstract) Ihara, N., A. Takasuga, K. Mizoshita, H. Takeda, M. Sugimoto, Y. Mizoguchi, T. Hirano, T. Itoh, T. Watanabe, K. M. Reed, W. M. Snelling, S. M. Kappes, C. W. Beattie, G. L. Bennett and Y. Sugimoto. 2004. A comprehensive genetic map of the cattle genome based on 3802 microsatellites. Genome Research. 14(10A):1987-1998. Jarne, P. and P. J. L. Lagoda. 1996. Microsatellites, from molecules to populations and back. Trends in Ecology & Evolution. 11(10):424-429. Lord, E. A., G. H. Davis, K. G. Dodds, H. M. Henry, J. M. Lumsden and G. W. Montgomery. 1998. Identification of Booroola carriers using microsatellite markers (Reprinted). Wool Technology and Sheep Breeding. 46(3):245-249. Lord, E. A., J. M. Lumsden, K. G. Dodds, H. M. Henry, A. M. Crawford, H. A. Ansari, P. D. Pearce, D. W. Maher, R. T. Stone, S. M. Kappes, C. W. Beattie and G. W. Montgomery. 1996. The linkage map of sheep Chromosome 6 compared with orthologous regions in other species. Mamm Genome. 7(5):373-6. Mulsant, P., F. Lecerf, S. Fabre, L. Schibler, P. Monget, I. Lanneluc, C. Pisselet, J. Riquet, D. Monniaux, I. Callebaut, E. Cribiu, J. Thimonier, J. Teyssier, L. Bodin, Y. Cognie, N. Chitour and J. M. Elsen. 2001. Mutation in bone morphogenetic protein receptor-IB is associated with increased ovulation rate in Booroola Merino ewes. Proceedings of the National Academy of Sciences of the United States of America. 98(9):5104-5109.

Ou Yang Xu-xiang, Shi Qi-shun, Deng Zao-fu, et al. 2006. Studies of microsatellite markers Oa rAE101 and BM143 in 4 Goat Breeds [J]. Acta Veterinariaet Zootechnica Sinica, 37 (7): 640645(in Chinese with English abstract) Penty, J. M., H. M. Henry, A. J. Ede and A. M. Crawford. 1993. Ovine microsatellites at the OarAE16, OarAE54, OarAE57, OarAE119 and OarAE129 loci. Anim Genet. 24(3):219. Piper, L. R., B. M. Bindon and G. H. Davis. 1985. The single gene inheritance of the high litter size of the Booroola Merino. Genetics of reproduction in sheep. 115-125. Queller, D. C., J. E. Strassmann and C. R. Hughes. 1993. Microsatellites and kinship. Trends in Ecology & Evolution. 8(8):285-&. Roder, M. S., V. Korzun, K. Wendehake, J. Plaschke, M. H. Tixier, P. Leroy and M. W. Ganal. 1998. A microsatellite map of wheat. Genetics. 149(4):2007-23. Shete, S., H. Tiwari and R. C. Elston. 2000. On estimating the heterozygosity and polymorphism information content value. Theor Popul Biol. 57(3):265-71. Thuillet, A. C., D. Bru, J. David, P. Roumet, S. Santoni, P. Sourdille and T. Bataillon. 2002. Direct estimation of mutation rate for 10 microsatellite loci in durum wheat, Triticum turgidum (L.) Thell. ssp durum desf. Molecular Biology and Evolution. 19(1):122-5. Vaiman, D., L. Schibler, F. Bourgeois, A. Oustry, Y. Amigues and E. P. Cribiu. 1996. A genetic linkage map of the male goat genome. Genetics. 144(1):279-305. Weber, J. L. 1990. Informativeness of human (dC-dA)n.(dG-dT)n polymorphisms. Genomics. 7(4):524-30. Yun-Tao Ji, Chang-Qing Qu, Bin-Yun Cao. 2007. Optimized method of DNA silver staining in polyacylamide gels electrophoresis [J]. Electrophoresis, 28, 1173-1175. Zhang Y J, Zhao Y Z, Liu Y Q, et al. 2003. Studies on genetic polymorphism using microsatellite markers OarAE101 and MCM38 in three goat breeds (J). Grass-feeding Livestock, 2(6): 24-26(in Chinese with

English abstract)

Figure legends Fig.1 Partial results of electrophoresis at OarAE101 microsatellite locus112: Different Xinong Saanen dairy goat; M: pBR322DNA/MspMarker,fragments size are 160,147,123,110,90bp up to down.

Fig.2 Partial results of electrophoresis at BM1329 microsatellite locus114: Different Xinong Saanen dairy goat; M: pBR322DNA/MspMarker, fragments size are 242,238,217,201,190,180bp up to down.

Fig.3 Partial results of electrophoresis at OarHH55 microsatellite locus114: Different Xinong Saanen dairy goat; M: pBR322DNA/MspMarker, fragments size are 190,180,160,147,123,110bp up to down.

Fig.4 Partial results of electrophoresis at BM143 microsatellite locus114: Different Xinong Saanen dairy goat; M: pBR322DNA/MspMarker, fragments size are 160,147,123,110bp up to down.

10

Fig.5 Partial results of electrophoresis at BMS2508 microsatellite locus114: Different Xinong Saanen dairy goat; M: pBR322DNA/MspMarker, fragments size are 160,147,123,110bp up to down.

Fig.6 Partial results of electrophoresis at OarAE129 microsatellite locus112: Different Xinong Saanen dairy goat; M: pBR322DNA/MspMarker, fragments size are 238,217,201,190,180, 160,147,123bp up to down.

Fig.7 Partial results of electrophoresis at OarFCB11 microsatellite locus114: Different Xinong Saanen dairy goat; M: pBR322DNA/MspMarker, fragments size are 242,238,217,201,190,180,160,147bp up to down.

11

Table 1. Data of six microsatellite loci Locus OarAE101 BMS1329 OarHH55 BM143 BMS2508 OarAE129 OarFCB11 Primer Sequence(53) F:TTCTTATAGATGCACTCAAGCTAGG R:TAAGAAATATATTTGAAAAAAGTGTATCTCCC F:TTGTTTAGGCAAGTCCAAAGTC R:AACAACGCAGCTTCATCC F:GTTATTCCATATTCTTTCCTCCATCATAAGC R:CCACACAGACAACTAAAACCCAGC F:ACCTGGGAAGCCTCCATATC R:CTGCAGGCAGATTCTTTATCG F:TTTCTGGGTTTACAAAATGCTC R:TTTCTTAGGGGAGTGTTGATTC F: AATCCAGTGTGTGAAAGACTAATCCAG R: GTAGATCAAGATATAGAATATTTTTCAACACC F: GGCCTGAACTCACAAGTTGATATATCTATCAC R: GCAAGCAGGTTCTTTACCACTAGTAGCACC Resource Sheep Sheep Sheep Sheep Sheep Sheep Sheep Annealing Temperature 63 62 64 63 54 64 65

12

Table 2. The allele frequencies and fragment size of 6 microsatellite loci Locus OarAE101 alleles 137 bp 135 bp 132 bp 129 bp 127 bp 116 bp 114 bp 109 bp BM1329 234 bp 225 bp 223 bp 219 bp 215 bp 197 bp 190 bp 187 bp 185 bp 182 bp BM143 140 bp 137 bp 135 bp 132 bp 129 bp 124 bp 120 bp 119 bp 115 bp 110 bp 105 bp Frequency 0.1276 0.1633 0.0867 0.0459 0.0765 0.1276 0.2500 0.1224 0.0459 0.1480 0.1173 0.0918 0.0969 0.0459 0.1480 0.1173 0.0918 0.0969 0.0408 0.1071 0.0816 0.2041 0.0612 0.0612 0.1071 0.0459 0.2041 0.1276 0.0204 OarFCB11 OarHH55 170 bp 165 bp 160 bp 155 bp 150 bp 145 bp 140 bp 135 bp 130 bp 125 bp 215 bp 209 bp 207 bp 205 bp 199 bp 197 bp 190 bp 188 bp 185 bp 180 bp 160 bp 156 bp 0.1224 0.1837 0.0918 0.1020 0.0510 0.1173 0.1633 0.1020 0.0357 0.0306 0.0816 0.0663 0.0918 0.0867 0.0612 0.0816 0.0459 0.0663 0.1582 0.0867 0.0459 0.1276 Locus OarAE129 alleles 205 bp 200 bp 180 bp 178 bp 170 bp 165 bp 155 bp Frequency 0.3878 0.0765 0.0357 0.1276 0.1939 0.1429 0.0357

13

Table 3. The average heterozygosity (He), effective numbers of alleles (Ne) and polymorphism information content (PIC) of 6 microsatellite locus in Xinong Saanen dairy goat OarAE101 PIC Ne He 0.8301 6.7513 0.8478 BM1329 0.8781 8.9925 0.8888 OarHH55 0.8642 8.1149 0.8768 BM143 0.8481 7.2932 0.8629 OarAE129 0.7373 4.2913 0.7669 OarFCB11 0.8974 10.5423 0.9052

14

Table 4. Least squares meansstandard deviation of 6 microsatellites genotypes for litter size effect in Xinong Saanen dairy goat Locus OarAE10 Genotypes/b Least squares meanssd Locus Genotypes/b Least squares meanssd

p p 137/116(50) 1.60720.3119a BM1329 234/197(18) 2.04440.3548a a 135/114(64) 1.67500.3327 225/190(58) 1.64070.3388b ab 1 132/114(34) 1.73290.3623 223/187(46) 1.71960.3591ab b 129/109(18) 2.03000.3684 219/185(36) 1.62000.3150b 127/109(30) 1.75000.2707ab 215/182(38) 1.74050.2561ab OarHH55 170/150(20) 1.70200.3564ab BM143 140/124(6) 1.72330.2542ab ab 170/145(28) 1.61290.2376 140/119(10) 1.73400.2526ab ab 165/145(18) 1.76440.2983 137/120(42) 1.69290.3394a a 165/140(42) 1.83900.3527 135/115(32) 1.65630.3302a 165/125(12) 1.50000.3536b 129/115(48) 1.65000.3069a ab 160/140(22) 1.61820.3345 129/110(32) 1.66190.3943a ab 160/130(14) 1.70430.3219 124/110(18) 2.04780.3524b ab 155/135(40) 1.74650.3906 119/105(8) 1.81250.2394ab OarAE12 205/178(12) 2.32500.6556Aa OarFCB1 215/197(32) 1.64380.3327a 205/170(12) 1.84670.5.60ABab 209/188(26) 1.99460.3695b ABab 9 205/165(50) 1.87880.2165 1 207/184(36) 1.68890.3711ab ABb 200/178(38) 1.66790.1923 204/180(34) 1.60880.3174a Bb 200/170(64) 1.54690.1668 199/157(24) 1.69670.2678ab 200/165(14) 1.57000.3360Bb 190/160(18) 1.72220.2471ab Bb 180/155(6) 1.41670.2230 184/157(26) 1.64770.3301a Note: The numbers in the brackets are the individuals that belong to the respective genotypes; and different significances are shown with capital and lower case letters at 0.01 and 0.05 levels respectively.

15