You are on page 1of 70

Reunio de Avaliao de Projetos RCT-PETROBRAS

Rio de Janeiro 13 de dezembro de 2011

Projeto
Modificao Gentica de Fungos Filamentosos para Incremento da Expresso de Enzimas Celulolticas
Coordenador: Prof. Fernando Araripe Torres Perodo: 12/2005 a 03/2007

Equipe Executora UnB UFRJ - UFAM

Equipe UnB
Prof. Fernando Araripe Torres Profa Ldia Maria Pepe de Moraes Janice Lisboa De Marco Bruno Benoliel Camila Marinho Silva Saulo Siqueira

Equipe UFRJ - UFAM


Prof. Nei Pereira (UFRJ) Prof. Spartaco Astolfi Filho (UFAM)

Introduo

Resduos Lignocelulsicos

386 x 106 t bagao de cana/ano 38% do contedo energtico no aproveitado Poderia dobrar a produo de etanol no Brasil

Rota Petrobras
Resduos Res Lignocelulsicos Lignocelul
CELULOSE Hidrlise Hidr qumica qu CELULOSE SOLVEL SOL Hidrlise Hidr enzimtica enzim HEMICELULOSE LIGNINA

GLICOSE
Fermentao Fermenta

XILOSE

ETANOL

RESDUO RES SLIDO

Enzimas: sinergismo

Justificativas
Preo das enzimas um gargalo Produo nacional Fungos filamentosos: timos produtores Biodiversidade brasileira Melhoramento gentico necessrio Faltam ferramentas moleculares

10

Objetivo geral
Desenvolvimento de linhagens de fungos filamentosos hiperprodutoras de enzimas celulolticas

11

Objetivos especficos
Screening de fungos produtores de celulases Construo de vetor de expresso para fungos filamentosos Constru Clonagem no vetor construdo dos genes de Humicola grisea para as constru enzimas endoglucanase (egl2), celobiohidrolase 1.2 (cbh1.2) e glicosidase (bgl4) Transformao de uma linhagem selecionada de fungo filamentoso Transforma com os vetores de expresso Anlise dos transformantes quanto produo de celulases An produ

12

Metodologia

13

Screening de fungos celulolticos (UFRJ/UFAM)

Caracterizao enizmtica (UFRJ/UFAM) Seleo de um isolado (UFRJ/UFAM/UnB) Desenvolvimento de vetores de transformao (UnB) Transformao gentica (UnB) Anlise dos transformantes (UnB)

14

Resultados

15

Fungos Celulolticos (UFRJ)


Trichoderma reesei RUT C30 Humicola grisea var.thermoidea Aspergillus niger ATCC 16404 Penicillium funiculosum ATCC 11797 Trichoderma harzianum IOC-3844 Trichoderma harzianum IOC-4038

16

Atividades Enzimticas
Atividade (UI/L) Linhagem
T. reesei RUT C30 H. grisea var thermoidea A. niger ATCC 16404 P. funiculosum ATCC 11797 T. harzianum IOC-3844 IOCT. harzianum IOC-4038 IOCPapel de filtro 17,8 6,1 45,7 0,9 36,2 4,6 CMC (EG) 103,0 9,3 317,0 1,0 386,2 16,9 2263,3 104,8 6358,1 219,8 558,5 31,8 Celobiose (BG) 84,2 4,4 73,9 1,5 1627,3 10,8 1835,5 110,7 752,3 36,0 744,7 18,0 Avicel (CHB) 35,6 1,4 153,3 9,7 88,4 3,0

353,8 29,4

727,0 28,0

494,3 22,0 100,0 4,1

512,0 28,5 134,7 8,4

Atividades em papel de filtro, CMC e celobiose: melhores valores obtidos durante os experimentos; Atividades em avicel: Valores obtidos nos extratos finais. Experimentos em frascos de 1L contendo celulignina semi-deslignificada em meio Mandels. Fermentao aps etapa de pr-inculo.

17

Seleo
Linhagem FPases
T. reesei H. grisea A. niger ATCC 16404 T. harzianum IOC-4038 IOCT. harzianum IOC-3844 IOCP. funiculosum 0,28 1,33 0,58 1,01 14,00 7,98

Atividade especfica espec (UI/mg protena) (UI/mg prote EG


1,64 14,91 5,70 6,42 67,14 43,14

BG
1,34 3,60 52,91 7,46 5,30 19,06

18

Fungos Celulolticos (UFAM)


Microrganismo Aspergillus niger Aspergillus ochraceus Aspergillus flavus Aspergillus sp Aspergillus ustus Penicillium funiculosum Penicillium versicolor Penicillium furcatum Penicillium stecki Origem Fermentado de cana-de-acar da Usina Jayoro S/A cana- de- car Vinhoto de cana-de-acar da Usina Jayoro S/A cana- de- car CEFET Fermentado de cana-de-acar da Usina Jayoro S/A cana- de- car Bagao de cana-de-acar da Usina Jayoro S/A Baga cana- de- car UFRJ Vinhoto de cana-de-acar da Usina Jayoro S/A cana- de- car Fermentado de cana-de-acar da Usina Jayoro S/A cana- de- car Vinhoto de cana-de-acar da Usina Jayoro S/A cana- de- car

19

Atividades Enzimticas
Microrganismo Atividade CMCase (U/mL) Atividade -glucosidase (U/mL) Atividade FPase (U/mL)

A. niger A. ochraceus A. flavus Aspergillus sp A. ustus A. funiculosum P. versicolor P. furcatum P. stecki

0,124 0,0035 0,1491 0,0127 0,1160 0,0009 0,0889 0,0049 0,1799 0,0060 0,1559 0,0091 0,1316 0,0157 0,1149 0,091 Nd

0,8216 0,0111 0,1112 0,0086 1,2406 0,0184 0,3206 0,012 1,309 0,030 0,937 0,0102 0,3683 0,0036 0,1636 0,0 Nd

0,0595 0,0266 0,0718 0,0017 0,0626 0,0004 0,0248 0,0021 0,0733 0,0097 0,0922 0,0025 0,1380 0,0089 0,07184 0,0017 Nd

20

Construo de vetor de expresso para fungos filamentosos

21

Construo dos Vetores de Expresso para Fungos Filamentosos


Objetivo: construo de vetores de expresso para fungos filamentosos que possam ser utilizados para a expresso heterloga de genes de celulases

22

Elementos principais
Sequncias para seleo e replicao em bactria (Ori e marca de seleo) Marca de seleo para fungos filamentosos Regio promotora de fungos filamentosos Stio para clonagem dos genes Regio terminadora da transcrio (TT)

23

Vetor desejado

24

Clonagem de Elementos Regulatrios


Promotores gpdA (Aspergillus nidulans) cbh1.1 (Humicola grisea) cbh1.2 (Humicola grisea) Regio Terminadora da Transcrio (TT) TT do gene trpC (Aspergillus nidulans)

25

1) Adio do Polilinker e Regio Terminadora da Transcrio (TT)


FF1-UP 5-AATTCTGCAGGATCCGATATCGC FF1-DOWN 5-GGCCGCGATATCGGATCCTGCAG

EcoRI PstI

BamHI

EcoRV

NotI

5-AATTCTGCAGGATCCGATATCGC GACGTCCTAGGCTATAGCGCCGG-5

26

voltar

27

1) Marcador 1Kb Plus DNA Ladder (Invitrogen); 2) pPE1/BamHI; 3) pPE1/SmaI; 4) pPE1/XbaI; 5) pPE1 intacto

28

Regio Terminadora da Transcrio (TT)


Ter-1 5-TCCGCGGACTTAACGTTACTGAAATCATCAAAC (SacII) Ter-2 5-AGAGCTCAGAAAGAAGGATTACCTCTAAAC (SacI)

29

Polilinker

30

pPE2 foi digerido com SacII e SacI para confirmar a presena da regio TT

Anlise de restrio do vetor pPE2. 1) Marcador 1Kb Plus DNA Ladder (Invitrogen); 2) pPE2 digerido com SacII e SacI; 3) pPE2 intacto.

31

2) Clonagem do promotor gpdA

- gpdA de A. nidulans, promotor forte e constitutivo - usar vetor pAN7-1 como template

Gpd-1 5-CAAGCTTTGTACAGTGACCGGTGACTC (HindIII) Gpd-4 5-CGAATTCGGTGATGTCTGCTCAAGCG (EcoRI)

32

33

Anlise de restrio do vetor pPE3. 1) pPE3 intacto; 2) pPE3/EcoRI + HindIII; 3) Marcador 1Kb Plus DNA Ladder (Invitrogen).

34

3) Clonagem do cassete hph

35

Polilinker

36

Anlise de restrio do pPE5

37

4) Clonagem dos promotores cbh1.1 e cbh1.2


promotor do gene cbh 1.1 CBH1.1-F (24 mer) CBH1.1mer) 5-CAAGCTTCGTTACACTCGGCGGAC (HindIII) AAGCTTCGTTACACTCGGCGGAC (HindIII) CBH1.1-R (29 mer) CBH1.1mer) 5-GGAATTCTTTGAAGGAGGGTGACTGATGT (EcoRI) GAATTCTTTGAAGGAGGGTGACTGATGT (EcoRI) promotor do gene cbh 1.2 CBH1.2-F (26 mer) CBH1.2mer) 5-CAAGCTTCCGGTAAGCGCATACGGGA (HindIII) AAGCTTCCGGTAAGCGCATACGGGA (HindIII) CBH1.2-R (28 mer) CBH1.2mer) 5-GGAATTCTTGAAAGACTGCTGCTGAGAT (EcoRI) GAATTCTTGAAAGACTGCTGCTGAGAT EcoRI)

38

1) EcoRI/HindIII 2) Promotor chh1.1 3) Promotor cbh1.2

39

40

5) Clonagem dos genes de celulases nos vetores de expresso


Objetivo: Clonar os genes egl2, bgl4, cbh1.2 no vetor pPE5

41

Genes a serem clonados


-glicosidase (bgl4) endoglicanase 2 (egl2) celobiohidrolase 1.2 (cbh1.2) celobiohidrolase 1.1 (cbh1.1) Todos os genes so de Humicola grisea e foram amplificados por PCR a partir dos cDNA j clonados

42

EGL2 EGL-F 5-GGAATTCACCATGAAGCACAGTGTCCTTGC (EcoRI) EGL-R 5-GGCGGCCGCCTATGGCACGTATTTCTTGAGAAGGGA (NotI) BGL4 Bgl4-F 5-GGAATTCATCATGTCTCTTCCTCCGGA (EcoRI) Bgl4-R 5-GGATCCTTACTCCTTGCGAATCAAGCTATC (BamHI) CBH1.2 1.2cdF2 5-GGAATTCAAGATGCAGATCCAAGAGC (EcoRI) 1.2cdR2 5-GGCGGCCGCTTAGACGTTGACGGTCCC (NotI)

43

Clonagem do gene da celobiohidrolase 1.2

Humicola grisea

1.2cdF2 5-GGAATTCAAGATGCAGATCCAAGAGC (EcoRI) 1.2cdR2 5-GGCGGCCGCTTAGACGTTGACGGTCCC (NotI) Amplificado: cDNA; Vent polimerase (alta fidelidade) 1 2

1,4 kb

Amplificao do gene cbh1.2. 1) Marcador BstEII 2) PCR com os primers 1.2cdF2/1.2cdR2.

44

Clonagem dos genes egl2 e bgl4 de

Humicola grisea

Sequncia dos oligonucleotdeos iniciadores utilizados nas reaes de PCR

PRIMER
EGL-F EGLEGL-R EGLBgl4-F1 Bgl4Bgl4-R1 Bgl4Bgl4-F Bgl43 glu

SEQNCIA SEQ 5 - ggaattcaccatgaagcacagtgtccttgc 5 - ggcggccgcctatggcacgtatttcttgagaaggga 5 - ggaattcgggccgtccatctgggaca 5 - agcggccgcttactccttgcgaatcaagctatc 5 - ggaattcatcatgtctcttcctccgga 5 - ggatccttactccttgcgaatcaagctatc

Tm 50C 50 50C 50 62C 62 66C 66 58C 58 68C 68

STIO EcoRI NotI EcoRI NotI EcoRI BamHI

45

cbh1.2
1 A 2 B 1

egl2
2 C 1

bgl4
2

1,5 kb 1,9 kb 1,3 kb 1,0 kb 1,5 kb 1,0 kb

46

pP5CBH1.2 pPECBH1.2

47

Transformao de Fungos Filamentosos


Objetivo: Desenvolver protocolo de transformao de uma linhagem hospedeira de fungo filamentoso para a expresso heterloga de genes de celulases.

48

Fungos selecionados
Aspergillus awamori Aspergillus niger Penicillium funiculosum Trichoderma harzianum 3844 e 4038

49

Primeira Etapa
Teste resistncia ao antibitico higromicina B

50

A. awamori
a b
1 3

a) A. awamori, 10 dias de crescimento b,c) Teste de resistncia a higromicina 1- 0 g/mL 2- 10 g/mL 3- 50 g/mL 4- 100 g/mL 5- 200g/mL 6- 300 g/mL

51

Aspergillus niger
a
a) A. niger, 7 dias de crescimento b)Teste de resistncia a higromicina 10 g/mL 2- 10 g/mL 3- 50 g/mL 4- 100 g/mL 5- 200 g/mL 6- 300 g/mL

b
1 4 5

3 5

52

Penicillium funiculosum
a b
2 1

c
5

d
7 6 8 9

a) Penicillium funiculosum, 10 dias de crescimento b,c,d) Teste de resistncia a higromicina 1) 0 g/mL, 4) 100 g/mL 7) 500 g/mL 2) 10 g/mL, 5) 200 g/mL 8) 700 g/mL 3) 50 g/mL, 6) 300 g/mL 9) 1000 g/mL

53

Trichoderma harzianum 4038


a
1

a) 1- Trichoderma harzianum 4038, 10 dias de crescimento;


2 3

b
4

a e b) Teste de resistncia a higromicina: 1- 0 g/mL 2- 10 g/mL 3- 50 g/mL 4- 100 g/mL 5- 200 g/mL 6- 300 g/mL

54

Trichoderma harzianum 3844


a
2 1 A) 1- Trichoderma harzianum 3844, 10 dias de crescimento A e B) Teste de resistncia a higromicina 1- 0 g/mL 2- 10 g/mL 3- 50 g/mL 4- 100 g/mL 5- 200 g/mL 6- 300 g/mL 6 5

b
4

55

Segunda Etapa
Teste de transformao por biolstica

56

Biolstica

Equipamento BIOMICS Particle Acceleration System

57

Esporos de T. harzianum 3844: 3 dias de crescimento

0g/mL de higromicina

50g/mL de higromicina

100g/mL de higromicina 100

200g/mL de higromicina

58

Transformao
Cotransformao com genes egl2 e cbh1.2 Obteno de 6 transformantes: THBR-01 a 06 Anlise em meio contendo CMC e Celuflok

59

THBR-01

60

THBR-02

61

THBR-03

62

THBR-04

63

THBR-05

64

THBR-06

65

66

67

Discusso e Concluses
T. harzianum pode ser usado como plataforma
para produo de celulases 3 vetores de expresso foram construdos: pPE5, pPE6 e pPE7 Dados preliminares sugerem que houve incremento de produo de celulases no fungo transformado

68

Desdobramentos

Clonagem de genes de amilases e lipases no vetor pPE5 Melhoramento gentico de Penicillum funiculosum

69

Patente
VETOR MODULAR PARA EXPRESSO DE ENZIMAS EM FUNGOS FILAMENTOSOS, FUNGO FILAMENTOSO TRANSFORMADO COM DITO VETOR MODULAR E MTODO PARA PRODUZIR UMA PROTENA DE INTERESSE NO INTEROIR DO DITO FUNGO FILAMENTOSO

Depsito em 28/07/2008 PI 0803782-5

70