PCR Amplification of Bacterial DNA For The Rapid Diagnosis of Infections

BROAD-RANGE PCR AMPLIFICATION OF BACTERIAL DNA IN VARIOUS
CLINICAL SAMPLES FOR THE RAPID DIAGNOSIS OF INFECTIONS
WOON SU LI ANGELINE
DISSERTATION SUBMITTED
IN FULFILMENT OF THE REQUIREMENTS FOR
THE DEGREE
OF
MASTER IN MEDICAL SCIENCE
DEPARTMENT OF MEDICAL MICROBIOLOGY

FACULTY OF MEDICINE
UNIVERSITY OF MALAYA
KUALA LUMPUR
2005/2006
Abstract
The objective of this study was to develop and optimise a broad-range PCR protocol
to detect and allow Gram-typing on bacterial 16S rDNA, and to provide bacterial
identification by sequence analyses without the need for culture in a routine clinical
diagnostic laboratory setting. The alkali-heat wash, boiling, phenol chloroform isoamyl-
alcohol extraction and DNAzol extraction methods were performed on cerebrospinal fluid,
synovial fluid, peritoneal fluid and blood culture bottle sample types. Boiling was found to
be most effective for cerebrospinal fluid, alkali-heat wash for blood culture bottle and
peritoneal fluid, and DNAzol for synovial fluid. The optimised duplex PCR for Pan and
Gram-positive specific PCR detected 10 pg of Staphylococcus aureus DNA while the
Gram-negative specific PCR detected 10 pg of Escherichia coli DNA. Both protocols were
able to Gram-type the 12 pure culture samples tested. The 16S rDNA sequence analyses
provided higher order identification for all 12 samples. The optimised PCR assays were
tested on 233 clinical samples and the molecular results compared with culture. Sensitivity
was found to be at 67.74%, specificity at 95.54%, positive predictive value at 70% and
negative predictive value at 95.1%. Furthermore, 91.8% of the results from the 16S rDNA
PCR assays and culture were in agreement. In conclusion, the broad-range PCR protocols
developed can be applied for use in a routine clinical diagnostic laboratory, and together
with sequencing analysis can enable bacterial identification. However, further work should
be carried out to increase the sensitivity and specificity of the molecular protocols.
ii
Acknowledgements
I would like to extend my appreciation to:
My supervisors, Professor Dr. Ngeow Yun Fong and Associate Professor Dr. Mary
Anne Tan Jin Ai of the Faculty of Medicine, University of Malaya, for their
recommendations and expert advice.
Professor Dr. Yap Sook Fan, for allowing me the run of her laboratory facilities.
Dr Tay Sun Tee and Dr Chia of the Department of Medical Microbiology, UM; and
the staff of the Microbiology Diagnostic Laboratory, UMMC, for providing some of
the materials used in this study.
The staff at the Department of Medical Microbiology, particularly Mr. Wong, Mr.
Wee and Mr. Cheng for their assistance in sorting out the gremlins in paperwork and
laboratory equipment.
The Unit Penyelidikan DiTaja for funding this project through the Skim Pasca
Siswazah and Peruntukan Penyelidikan Jangka Pendek (Vot F).
Fellow students, past and present, at the Molecular Diagnostic Research Laboratory
(MDRL), for their support, ideas, troubleshooting abilities and more importantly,
friendship. Special mention goes to Dr Tetty Aman Nasution, Leila Hilout, Caroline
Wee, Elton Sagim, and Alex Lim.
Amy, Sook Meng and John, for their encouragement and help in smoothing out the
details. GANBARE!
I dedicate this to my family and Benoit, for keeping me happy and healthy through the late
nights, starvation and general frustrations as I tried to churn out something resembling a
dissertation.
Thank you
>***+(
Woon Su Li Angeline
April 2006
iii
Table of Contents
PAGE
Title Page i
Abstract ii
Acknowledgements iii
Table of Contents iv
List of Figures xiii
List of Tables xviii
List of Symbols and Abbreviations xx
1.0 Introduction 1
1.1 The Diagnosis of Infections 2
1.1.1 The Status Quo 2
1.1.2 Rapid Diagnosis: The Benefits 3
1.1.3 The Hurdle: Drawbacks of Culture Method 4
1.1.4 A Solution: Benefits of Molecular Methods 5
1.2 Broad-range 16S rDNA Amplification and Sequencing 6
1.2.1 Polymerase Chain Reaction 6
1.2.2 Analysis of Amplification Products 9
1.2.3 Analysis of Sequencing Results 9
1.2.4 The 16S ribosomal RNA Gene (16S rDNA) 11
1.2.5 A Broad Outline of the Method 13
iv
1.3 Literature Review of 16S rDNA Amplification and Sequencing 14
1.3.1 Used in the Identification of Unknown Etiologic Agents 14
1.3.2 Important Highlights Regarding the 16S rDNA 15
Broad-range PCR
1.3.3 16S rDNA PCR as a Routine Clinical Diagnostic Service 17
1.3.4 16S rDNA PCR in Specific Clinical Conditions 18
1.4 Outline of the Method used in this Study 20
1.5 Objective of the Study 22
2.0 Methodology 23
2.1 Samples 23
2.1.1 Bacterial Stock Culture 23
2.1.2 DNA Samples 23
2.1.3 Culture-Negative Clinical Specimen 24
2.1.4 Clinical Specimens for 16S rDNA Screening 25
2.2 General Methods 25
2.2.1 Preparation of Media and Buffers 25
2.2.2 Sterilisation 25
2.2.3 Workflow and Special Considerations 26
2.3 Extraction Methodology 26
2.3.1 Cell Counting 26
v
2.3.2 Alkali Heat-Wash Extraction Method 27
2.3.3 Boiling Extraction Method 28
2.3.4 Lysis Buffer and Phenol Chloroform Isoamyl-Alcohol 28
Extraction Method
2.3.5 DNAzol Extraction Method 29
2.3.6 DNA Quantification of Extracted Samples 30
2.4 PCR Primers 30
2.4.1 Designing Primers 30
2.4.2 Manufacturing Primer Oligonucleotides 31
2.4.3 Primer Profile 31
2.5 PCR, Sequencing and Analysis 34
2.5.1 Preparation of PCR Mixtures 34
2.5.2 Gel Electrophoresis of Amplified PCR Products 35
2.5.3 Min Elute PCR Purification Kit Protocol and Sequencing 36
2.5.4 Analysing Sequencing Results 37
2.5.5 Statistical Analyses 37
2.6 Determination of PCR Sensitivity 38
2.7 Determination of PCR Specificity 39
2.8 Screening of Clinical Specimens 40
vi
3.0 Results 43
PHASE I: Optimisation of Protocols
3.1 DNA Extraction 43
3.1.1 Complexity Ranking 44
3.1.2 DNA Amplification Results of Extracted Samples 45
3.1.3 Choosing the Best Extraction Methods 54
3.1.4 Lowest Detection Limit (CFU/ml) of the Extraction Methods 55
3.2 PCR Optimisation 58
3.2.1 Optimisation of Annealing Temperature 58
3.2.2 Optimisation for the Number of PCR Cycles 61
3.2.3 Optimisation of MgCl2 and Taq Polymerase Concentrations 65
3.2.4 Optimisation of Primer Concentration 74
3.2.5 Multiplex Optimisation 82
3.3 Optimisation of PCR Mixtures and Thermal Profiles 83
3.3.1 Gram-positive Specific PCR 83
3.3.2 Pan-bacterial Specific PCR 84
3.3.3 Pan and Gram-positive Specific Duplex PCR 85
3.3.4 Gram-negative Specific PCR 86
3.4 PCR Sensitivity 87
3.5 PCR Specificity 93
vii
3.6 Sequencing and Analyses of Pure Cultures 99
3.6.1 Staphylococcus aureus 99
3.6.2 Enterococcus faecalis 99
3.6.3 Corynebacterium sp. 100
3.6.4 Neisseria gonorrhoeae 100
3.6.5 Haemophilus influenzae 101
3.6.6 Acinetobacter baumanii 101
3.6.7 Klebsiella pneumoniae 101
3.6.8 Enterobacter sp. 102
3.6.9 Escherichia coli 102
3.6.10 Proteus sp. 103
3.6.11 Stenotrophomonas maltophilia 103
3.6.12 Summary of Section 3.6 103
PHASE II: Screening of Clinical Samples
3.7 Collection of Samples 107
3.8 PCR of Clinical Samples 108
3.9 Sequencing of Clinical Samples 110
3.9.1 Clinical Samples that Produced Positive Results by 110
Culture and 16S rDNA PCR (Refer Table 3.10)
3.9.1a Sample C065 110
(Identified as Enterobacter sp. by Culture)
viii
3.9.1b Sample C089, B082, P045 and P063 111
(Identified as Klebsiella pneumoniae by Culture)
3.9.1c Samples P002, P056 and P055 111
(Identified as Escherichia coli by Culture)
3.9.1d Samples P004 and P029 112
(Identified as Enterococcus sp. by Culture)
3.9.1e Samples P007, B078 and B079 113
(Identified as Acinetobacter baumanii by Culture)
3.9.1f Samples C003 113
(Identified as Streptococcus sp. by Culture)
3.9.1g Sample P051 113
(Identified as Group G Streptococci by Culture)
3.9.1h Sample P017 114
(Identified as Staphylococcus aureus by Culture)
3.9.1i Sample P014 114
(Identified as Pseudomonas aeruginosa by Culture)
3.9.1j Sample B080 114
(Identified as Salmonella enteritidis by Culture)
3.9.1k Samples B073 and B074 115
(Identified as Coagulase-negative Staphylococci
by Culture)
3.9.1l Sample B076 115
(Identified as Gram-negative Rod by Culture)
3.9.1m Summary of Section 3.9.1 115
ix
3.9.2 Clinical Samples Found Positive by 16S rDNA PCR 122
but Negative by Culture (Refer Table 3.11)
3.9.2a Cerebrospinal Fluid Samples 122
(C016, C027, C033, C051 and C067)
3.9.2b Peritoneal Fluid Sample (P020) 123
3.9.2c Synovial Fluid Samples (S010, S017 and S033) 123
3.9.3 Clinical Samples Found Negative by 16S rDNA PCR 128
but Positive by Culture
3.10 Comparison of the 16S rDNA PCR with Culture 129
3.10.1 Overall Results 129
3.10.2 Breakdown of Results into Sample Types 130
3.10.3 Performance of the 16S rDNA PCR Assay Compared 132
to Culture
4.0 Discussion 134
4.1 Contamination Issues in Broad-range PCR 134
4.2 Extraction Methods 135
4.2.1 Complexity Ranking 135
4.2.2 DNA Amplification of Extracted Samples 136
4.2.3 Boiling Method on CSF Specimen 137
4.2.4 AH Method on BCB and PF Specimen 138
4.2.5 DNAzol and SF Specimen 138
4.2.6 Other Methods 139
x
4.3 PCR Optimisation 139
4.4 PCR Sensitivity 142
4.5 PCR Specificity 143
4.6 Sequencing 144
4.6.1 Fragment Size 144
4.6.2 Sequencing Results Analyses and Cut-off Points 145
4.6.3 Sequencing Analyses for Pure Culture Samples 146
4.6.4 The Limitations of the 16S rDNA PCR and DNA Sequence 150
Analyses for the Identification of Bacterial Isolates
4.7 PCR on Clinical Samples 151
4.8 Sequencing on Clinical Samples 152
4.8.1 Clinical Samples that Gave Positive Results by Culture and 152
16S rDNA PCR
4.8.2 Clinical Samples Found Positive by 16S rDNA PCR but 155
Negative by Culture
4.8.3 Clinical Specimen Found Negative by 16S rDNA PCR but 158
Positive by Culture
4.9 Comparison of the 16S rDNA Assay with Culture 159
4.10 Limitations of the 16S rDNA PCR and DNA Sequencing Assay 162
for Use on Clinical Specimens
xi
4.11 Significance of Findings 164
4.12 Conclusion 166
Appendices
Appendix A- Lists of Chemicals, Media, Kits and Equipment
Appendix B- Preparation of Media, Stocks and Buffers
Appendix C- Primer Location on the 16S rDNA
Appendix D- Examples of Electropherograms from the DNA
Sequencing of Pure Culture Samples
Appendix E- Table AppE
Appendix F- Examples of Electropherograms from the DNA
Sequencing of PCR-positive Clinical Samples
Appendix G- Calculation of the Number of Escherichia coli
cells detected by DNA amplification in this
study.
References
xii
List of Figures
PAGE
Figure 1.1 Cycles involved in the Polymerase Chain Reaction (PCR). 7
Figure 1.2 Secondary structure of a 16S rRNA molecule based on the 12
Escherichia coli structure of Maidak et al.(1994)
Figure 1.3 The outline of the 16S rDNA PCR and sequencing method 21
used in this study.
Figure 2.1 A diagram showing the primer annealing positions and 33
fragment sizes of the PCR products in this study.
Figure 2.2 Procedure for the determination of PCR sensitivity in this 38
study.
Figure 2.3 Procedure for the determination of PCR specificity in this 39
study.
Figure 2.4 Procedures used in the screening of the clinical specimens in 40
this study.
Figure 2.5 Diagrams of possible PCR results on agarose gel during 42
hypothetical clinical screening of specimens.
Figure 3.1 Gel electrophoresis of PCR products amplified from DNA 47
extracted using the alkali heat-wash and boiling methods.
xiii
extracted using the phenol chloroform isoamyl-alcohol and
DNAzol methods.
extracted by the phenol chloroform isoamyl-alcohol and
DNAzol methods.
Figure 3.4 Gel electrophoresis of PCR products using the duplex Pan (nf 57
and NR) and Gram-positive specific primer (f3p and NR) sets
to determine the lowest detection limit (Colony Forming
Unit/ml) for the alkali heat-wash method on peritoneal fluid.
Figure 3.5 Optimisation of the Gram-positive specific PCR using different 60
annealing temperatures.
Figure 3.6 Optimisation of DNA amplification for Gram-positive and 62
Gram-negative specific primers using 26 cycles of PCR.
Figure 3.7 Optimisation of DNA amplification for Gram-positive and 64
Gram-negative specific primers using 27 and 28 cycles of
PCR.
Figure 3.8 Optimisation of DNA amplification for Pan, Gram-positive 67
and Gram-negative specific primers using 0.6 units of Taq
polymerase and various concentrations of MgCl2.
xiv
Figure 3.9 Optimisation of DNA amplification for Pan, Gram-positive 69
and Gram-negative specific primers using 0.8 units of Taq
Figure Optimisation of DNA amplification for Pan, Gram-positive 71
3.10 and Gram-negative specific primers using 1.0 units of Taq
Figure Optimisation of DNA amplification for Pan and Gram-positive 76
3.11 specific primers using different nf and NR primer
concentrations.
3.12 specific primers using different nf and NR primer
concentrations.
3.13 specific primers using different f3p primer concentrations.
Figure Gel electrophoresis of DNA products amplified using the Pan 88
3.14 specific primers with different DNA concentrations.
3.15 and Gram-positive specific primers in a duplex PCR with
different Escherichia coli DNA concentrations.
xv
3.16 and Gram-positive specific primers in a duplex PCR with
different Staphylococcus aureus DNA concentrations.
Figure Gel electrophoresis of DNA products amplified using the 92
3.17 Gram-negative specific primers in a duplex PCR with different
Escherichia coli DNA concentrations.
3.18 and Gram-positive specific primers with template DNA from
various Gram-positive and Gram-negative organisms.
Figure Gel electrophoresis of DNA products amplified using the 97
3.19 Gram-negative specific primers with template DNA from
various Gram-positive and Gram-negative organisms.
Figure The location of the primers used in this study on a higher-order Appendix
AppC structure model for Escherichia coli 16S rRNA that was C
obtained from Gutell et al. (1994)
Figure Electropherogram from the DNA sequencing of 16S rDNA Appendix
AppD-1 obtained from the Staphylococcus aureus (PC041) pure culture D-1
sample.
AppD-2 obtained from the Escherichia coli (PC039) pure culture D-2
sample.
xvi
AppF-1 obtained from a cerebrospinal fluid sample (C003). F-1
AppF-2 obtained from a synovial fluid sample (S010). F-2
xvii
List of Tables
PAGE
Table 2.1 Details of the oligonucleotide primers used in the study. 31
Table 3.1 The Complexity Ranking of various DNA extraction methods. 44
Table 3.2 List of DNA extraction methods selected for the different 54
clinical samples.
Table 3.3 The PCR mixture and thermal profile for the Gram-positive 83
specific DNA amplification.
Table 3.4 The PCR mixture and thermal profile for the Pan-bacterial 84
Table 3.5 The PCR mixture and thermal profile for the Pan and Gram- 85
positive specific primers in a Duplex PCR.
Table 3.6 The PCR mixture and thermal profile for the Gram-negative 86
Table 3.7 The list of organisms used in this study confirmed by culture, 94
Gram-stain, and DNA amplification results.
Table 3.8 The results of BLAST and RDP-II SeqMatch analyses on 16S 104-106
rDNA sequences obtained from the DNA sequencing of pure
cultures.
xviii
Table 3.9 The number of specimens found positive or negative by culture 109
and PCR, with division into Gram-positive and Gram-negative
groups.
Table 3.10 List of clinical specimens found positive by 16S rDNA PCR and 116-121
culture, with results from BLAST and RDP-II analyses.
Table 3.11 List of clinical specimens found positive by 16S rDNA PCR 125-127
assay and negative by culture, with BLAST and RDP-II
analyses.
Table 3.12 List of clinical samples that produced negative results using 16S 128
rDNA PCR assay but showed positive culture results.
Table 3.13 Results obtained from 16S rDNA broad-range PCR and 130
sequencing compared with those obtained from cultures in the
233 clinical samples studied.
Table 3.14 Results obtained from 16S rDNA broad-range PCR and 131
sequencing compared with those obtained from culture methods.
Table 3.15 Performance of the 16S rDNA PCR assay compared to the 132
culture results of cerebrospinal fluid (CSF), peritoneal fluid (PF),
synovial fluid (SF) and blood culture bottle (BCB) samples.
Table The results of Gram-positive (GP), Gram-negative (GN), and Appendix
AppE Pan specific primers PCR on the 233 clinical samples studied. E
xix
List of Symbols and Abbreviations
16S rDNA gene coding for 16S rRNA
16S rRNA small-subunit ribosomal RNA
AH Alkali-heat wash extraction method
BCB Blood culture bottle
BLAST Basic Local Alignment Search Tools
bp base pair
°C degree Celcius
CFU Colony Forming Unit
CSF cerebrospinal fluid
DNA Deoxyribonucleic acid
dNTP Deoxyribonucleotide triphosphate
EDTA Disodium ethylenediaminetetraacetic acid
FISH Flourescent in situ hybridization
g gram
µg microgram
ng nanogram
pg picogram
fg femtogram
GN Gram-negative
GP Gram-positive
xx
ml mililitre
µl microlitre
LB Luria-Bertani
MgCl2 Magnesium chloride
M Molar
mM milimolar
µM micromolar
min minute
MW molecular weight
nm nanometre
N/A not available
NaCl sodium chloride
NaN not any number
NPV negative predictive value
OD optical density
PCIA phenol chloroform isoamyl-alcohol
PCR Polymerase Chain Reaction
PF peritoneal fluid
PPV positive predictive value
psi pounds per square inch
RDP-II Ribosomal Database Project-II
RE restriction endonucleases
xxi
RNA ribonucleic acid
rpm revolutions per minute
rRNA ribosomal RNA
s second
sddH2O sterile double distilled water
SDS sodium dodecyl sulphate
SF synovial fluid
SISA Simple Interactive Statistical Analysis
SPS sodium polyanetholesulfonate
sp. species
Ta annealing temperature
TBE Tris-borate EDTA
TE Tris-EDTA
Tm melting temperature
UM University of Malaya
UMMC University of Malaya Medical Centre
UV ultraviolet
V volt
xxii
Introduction
1.0 Introduction
It is estimated that there are 4 - 6 x 1030 prokaryotic cells, but less than 1% of all the
bacteria that exists in this world have been cultivated and characterized (Amann et al.,
1995; Torsvik and Øvreås, 2002). In their argument for phylogenetic identification and in
situ detection of microbial cells without cultivation, Amann et al. (1995) offered examples
of well-known but uncultured microorganisms, and discussed the “Great Plate Count
Anomaly”, where a majority of microscopically visualized viable cells do not form visible
colonies on plates.
Fredricks et al. (2005) investigated microbial communities associated with bacterial
vaginosis by using molecular identification without cultivation. Using broad-range 16S
rDNA PCR amplification with clone analysis, bacterium-specific PCR assay, and
fluorescence in situ hybridization (FISH) which were performed directly on vaginal fluid
from subjects with and without bacterial vaginosis, they found that women with bacterial
vaginosis had complex vaginal infections and many newly recognized species not found in
healthy subjects. An understanding of the microflora of an anatomical niche could be useful
in the identification of a “non-native” that may be the cause of disease (Relman, 1999).
In the field of medical microbiology, the usage of molecular methods has brought
about a reassessment of Koch’s Postulates to include sequence-based identification in
determining causation of diseases (Fredricks and Relman, 1996). In addition, the most
1
Introduction
recent taxonomic outline in the Bergey's Manual of Systematic Bacteriology (2nd Edition)
included the use of 16S rDNA sequence analysis to help define a classification that
reflected the phylogeny of prokaryotes (Garrity et al., 2004). And while traditional culture
methods of isolating, growing and identification by morphological structures and
biochemical tests are still the accepted "gold standard" for bacterial identification
(Houpikian and Raoult, 2002), molecular techniques have increased our understanding of
the range and activity of the microorganisms that share our world.
1.1 The Diagnosis of Infections
1.1.1 The Status Quo
Human instincts of self-preservation have led to large efforts dedicated to
identification of microbes once the clinical signs of infection develop. Practically all
available information about the composition and role of microflora has been based on
laboratory cultivated microorganisms. It was once thought that much was known about the
human body – the ecosystem most intimately related to our existence - and the methods
used to obtain that knowledge (Relman, 1999).
This however, was otherwise indicated from the results obtained from the
Unexplained Deaths project coordinated by the Centers for Disease Control (Perkins et al.,
1996). It was reported that unexplained death or critical illnesses occur in 0.5 to 2.0 persons
per 100,000 persons in the United States population every year. The use of broad-range 16s
rDNA Polymerase Chain Reaction (PCR) without the need for bacterial cultivation revealed
that known disease-causing agents were the probable or definite pathogen in some cases.
Furthermore, approaches for the selection and processing of clinical specimens for the
identification of pathogens using molecular methods have not been properly evaluated.
2
Introduction
1.1.2 Rapid Diagnosis: The Benefits
Rapid identification of bacteria in infections may lead to patient isolation and the
reduction of the patient's infectious period, thereby containing the spread of pathogenic
organisms and shortening the period of morbidity (Podzorski and Persing, 1995). Patient
mortality rates have decreased with a shortened turnover time in diagnosis (Doern et al.,
1994). Statistically fewer laboratory studies, imaging procedures, days of intubations and
days in intensive or intermediate-care area have been observed in situations utilising rapid
detection systems, thus, contributing to lower patient distress.
Rapid diagnosis of infections has been shown to be both beneficial to patient well-
being and to those bearing the costs of testing and hospitalization. Barenfanger et al. (1999)
showed that implementation of minor changes in work flow e.g. reducing diagnostic
turnover time by 5 hours, led to savings of $1,750 per patient or over $4 million per year in
a particular hospital. Lower hospitalization costs were also reported by Doern et al. (1994).
It is known that broad-spectrum antibiotic usage leads to susceptibility to
nosocomial infections and interferes with normal microflora. It has also been shown that
these infections incur increased costs in a hospital, not accounting for the loss of work hours
for the patient, the prolonged length of hospital stay, staff hours and laboratory costs (Inan
et al., 2005). Better reliance on narrow spectrum agents that have less effect on microflora
could help reduce the incidence of nosocomial infections (Gould, 1999) and help to lower
the patients’ distress and hospitalization costs. Therefore, a more specific antibiotic therapy
is desirable and can be obtained with rapid reporting of infective agents (Doern et al.,
1994).
3
Introduction
1.1.3 The Hurdle: Drawbacks of Culture Method
Standard microbiological diagnosis depends on the growth of the organism in
culture and may require 12-72 hours for detection (Klausegger et al., 1999). During direct
examination of clinical samples, identification may be limited by the number of organisms
present and the ability of laboratory staff to recognize the pathogen (Tang et al., 1997).
Culturing of microorganisms depends on the ability of the microbe to propagate on
appropriate artificial media. In addition, certain diagnostic tests are difficult to perform as
some bacteria may grow only a few colonies on agar plates (Carroll et al., 2000). As most
patients are usually treated with broad-spectrum antibiotics before identification
(Klausegger et al., 1999), culturing is made even more difficult due to the lower number of
cells present in these samples.
Another drawback of standard culture methods is the limited sample volume
available for culturing. This makes it difficult to culture all pathogens. Clinical specimens
that are obtained at lower volumes such as ocular fluid, cerebrospinal fluid and blood from
infants usually have fewer microbes present; hence, this would lower the possibility of any
detection even further (Carroll et al., 2000).
Microorganisms themselves can pose a problem in standard identification methods
as those that are non-cultivable or extremely fastidious such as Mycobacterium tuberculosis
(Podzorski and Persing, 1995) may delay diagnosis of the infection, thus affecting
treatment.
In addition, some organisms may be hazardous to laboratory personnel. When
dealing with potentially hazardous microorganisms, diagnosis often depends on serologic
detection of a humoral response or culture in expensive biosafety level II-IV facilities.
These organisms can be cultured but require specially trained personnel, special equipment
and expensive containment facilities. If proper precautions are not designed or followed, the
organisms may infect laboratory personnel and cause serious illness or even death.
4
Introduction
Logistics can also be a problem with standard culture methods. In laboratories
working with smaller sample loads, special media for culturing rarely encountered
pathogens may not be readily available or used routinely as they are not economically
feasible to be maintained as the reagents may expire before usage. Nevertheless, the
samples can be sent to referral labs, but these fragile microbes may lose their viability or
become overgrown with other organisms during transit (Tang et al., 1997).
1.1.4 A Solution: Benefits of Molecular Methods
Identification by molecular methods allow for more rapid and accurate identification
of etiologic agents in a much shorter time than traditional methods. For example, a protocol
using real-time PCR to detect and differentiate Gram-positive from Gram-negative bacteria
could yield results in less than 3 hours, inclusive of preparation time (Klaschik et al., 2002).
Such rapid identification would allow for the earlier initiation of a focused antimicrobial
regimen, and decrease the likelihood of disease progression (Doern et al., 1994).
Problems of low sample volumes from ocular fluids, cerebrospinal fluids, and swabs
can be overcome with molecular methods such as PCR. A single PCR reaction tube requires
only a small amount of sample (1-10 µl) for each test.
Molecular techniques have also been used to address issues such as the handling of
hazardous or potentially hazardous material, particularly when working on samples with
unknown etiologic agents. After the initial extraction procedure, only noninfectious
materials such as DNA or RNA are handled. These nucleic acids may be extracted with
commercially available kits and sent frozen to molecular reference facilities. This would be
helpful in situations where the organisms are rare or cannot be identified due to non-
availability of media. If molecular facilities are available, another benefit would be that
primers and probes necessary for the identification of rare organisms may be stored frozen,
5
Introduction
thereby excluding the need for maintaining media with a limited shelf-life. As molecular
techniques are made more readily available, a positive effect would be the lower cost in
clinical testing as well as a more rapid turnover rate (Tang et al., 1997).
1.2 Broad-range 16S rDNA Amplification and Sequencing
Broad-range PCR is one DNA amplification method that can easily be adapted in
routine clinical diagnostic laboratories to produce rapid and specific results. Once set up, it
is relatively simple, does not require much preparation time, and is reproducible, specific
and sensitive when appropriately designed.
The 16S ribosomal RNA gene (16S rDNA) is chosen as the target for broad-range
PCR as the gene sequences (and their gene products, the 16S rRNA) are considered the
most useful of molecular chronometers for the determination of phylogenetic relationships
(Woese, 1987). Aside from determining phylogeny, the 16S rDNA sequences are also
useful for bacterial identification in clinical settings.
1.2.1 Polymerase Chain Reaction
PCR is presently one of the most widely used methods of nucleic acid amplification.
It increases the sensitivity of detection while still retaining high specificity. The high
sequence specificity is due to using two unique and closely spaced synthetic oligonucleotide
primers that must hybridise to the target DNA under stringent conditions. Only then can
exponential amplification occur, in which each cycle theoretically doubles the amount of
target DNA in the presence of a thermostable DNA polymerase (Figure 1.1).
6
Introduction
Figure 1.1: Cycles involved in the Polymerase Chain Reaction (PCR).
7
Introduction
The steps in PCR include repeated cycles of amplifying selected nucleic acid
sequences. Each of the cycle consists of a DNA denaturation step, in which double strands
of DNA are separated; a primer annealing step, in which primers anneal to complementary
target sequences; and an extension reaction step, in which DNA polymerase extends the
sequences between the primers. The steps are repeated for 25-35 cycles. All of these steps
are performed on a programmable thermal cycle.
In the early cycles, initially synthesized strands of new DNA vary in length. As the
primers begin to use the synthesized strands of DNA as templates, the product of
amplification, which are in the form of double-stranded DNA sequences, become short
products. The length of the product is the sum of length of the two primers and the target
DNA sequence in between.
Multiplex PCRs are designed to probe a specimen for different organisms or target
sequences within a single PCR tube. This form of PCR uses a panel of primers that have
similar annealing temperatures, and each of the amplification products must be unique in
size, allowing detection and identification of specific organisms or genes (Podzorski and
Persing, 1995).
Broad-range PCR involves the use of primer pairs that target gene sequences that are
conserved among a broad group of agents. The conserved region should flank sequences
that are sufficiently variable to provide reliable phylogenetic information about an
infectious agent (Relman, 1999).
8
Introduction
1.2.2 Analysis of Amplification Products
One simple method of post-amplification analysis is the use of agarose-gel
electrophoresis followed by ethidium bromide staining. DNA could then be transferred to a
solid phase and probed either by radiolabeling or enzyme-labeling (Podzorski and Persing
(1995).
The DNA could also be purified and sequenced using an automated DNA
sequencing system which is the result of projects involving entire genome sequencing. The
sequencing reactions of automated systems are based on the Sanger-dideoxy procedure, but
uses fluorescent dye-labeled primers for easier detection (Madigan et al., 1997). The
products are separated by electrophoresis and the bands detected by fluorescence
spectroscopy. The results are analysed by computer and an electropherogram is generated,
consisting a colour-coded sequence of the four DNA bases.
1.2.3 Analysis of Sequencing Results
The Basic Local Alignment Search Tools (BLAST) programs are a set of sequence
comparison algorithms that searches sequence databases and produces an optimal local
alignment to a query (http://www.ncbi.nlm.nih.gov/education/BLASTinfo/similarity.html).
A local alignment includes only the most similar local region(s). Comparisons on BLAST
are made in a pairwise fashion and then given a score to reflect the degree of similarity
[defined as the extent (of similarity) to which nucleotide sequences can be, based on percent
sequence identity (extent in which two nucleotide sequences are invariant)]. The higher the
score, the greater the degree of similarity between a query sequence and the sequence
against which it is compared.
9
Introduction
The Ribosomal Database Project (RDP-II) however, is a more specialised database
containing aligned and annotated rRNA sequences which uses a hierarchical framework
based on new phylogenetically consistent higher-order bacterial taxonomy proposed by
Garity et al. (2004). It is updated monthly and contains 194,696 16S rRNAs as of Release
9.34 (Dec 1, 2005). Two of the tools of the RDP-II are the Classifier and SeqMatch (or
Sequence Match).
The Classifier (http://rdp.cme.msu.edu/classifier/class_help.jsp) gives initial
taxonomic placement using a Naïve Bayesian rRNA classifier whereby each query
sequence is assigned to a set of hierarchical taxa trained on known type strains of 16s rRNA
sequences. It displays the ancestor of current root taxon from the highest to the lowest rank.
A confidence estimate is generated for each assignment and only those defined by the user-
specific confidence threshold are displayed. The Classifier provides probable taxa but not
information such as similarity scores and possible matches with other genus which could
infer overlaps.
SeqMatch (http://rdp.cme.msu.edu/seqmatch/seqmatch_help.jsp) was found to be
more accurate than BLAST at finding closely related rRNA sequences (Cole et al., 2005). It
provides a similarity score which is obtained by dividing the number of unique oligomers
shared between the query and RDP sequences by the lowest number of unique oligos in
either sequence.
10
Introduction
1.2.4 The 16S ribosomal RNA Gene (16S rDNA)
The 16S rDNA is the gene coding for the small-subunit ribosomal RNA (16S rRNA;
Figure 1.2). The gene is located at the 5' terminus of an rrn operon and is followed by the
larger 23S rDNA and the small 5S rDNA. These genes are separated by spacers that may
contain genes for transfer RNA. During translation, the pre-rRNA is folded under the
influence of ribosomal proteins into tertiary and quaternary structures, and these become the
basis for the maturation process. The 5' and 3' flanking region of the rRNA genes are
digested by specific enzymes during maturation, and the resulting RNA and ribosomal
proteins are assembled to form the two ribosomal subunits which then forms one ribosome.
The two ribosomal subunits consist of the small 30S ribosomal subunit containing the 16S
rRNA and 21 proteins, and the larger 50S subunit containing the 23S rRNA, the 5S rRNA
and 32 proteins (Stackebrandt, 2001).
The 16S rRNA and its gene have some unique features that enable it to be used for
the identification of unknown bacteria. The gene itself is universally present among all
cellular life forms and the relatively small size of about 1540 nucleotides makes it an easy
target to analyse. The primary structure of the gene, which comprises an alternating
sequence of invariant regions from the conserved to the highly variable, allows for the
design of primers (in the conserved regions) to flank a variable region (Figure 1.2). Ideally,
the sequences in the variable region should allow for the identification or relatedness of
bacteria. As the function of ribosomes has not changed for about 3.8 billion years i.e. the
rate of change is constant over long periods and among diverse organisms, inferences of
evolutionary distance relatedness can be made (Relman, 1998; Stackebrandt, 2001).
11
Introduction
The database for the 16S rDNA sequences are also more extensive when compared
with other homologous molecules sequenced e.g. 23S rDNA and 5S rRNA, and genes
coding for enzymes or ribosomal proteins. As of February 8th, 2005, a total of 124,165
aligned and annotated bacterial small-subunit rRNA sequences have been deposited in the
RDP (Ribosomal Database Project II at http://rdp.cme.msu.edu/index.jsp) (Cole et al.,
2005).
Figure 1.2: Secondary structure of a 16S rRNA molecule based on the Escherichia coli
structure of Maidak et al. (1994). Highly variable regions are in red; highly conservative
stretches are in green; binding sites of primers used in the PCR of the rDNA are in blue, and
other nucleotides are in black (adapted from Stackebrandt, 2001).
12
Introduction
1.2.5 A Broad Outline of the Method
As mentioned previously, one of the unique features of the 16S rDNA gene is the
sets of conservative nucleotide stretches that are scattered over the genes. The conserved
regions can act as target sites for oligonucleotide primers that allow for PCR amplification
and sequencing. Molecular analysis can be performed on either purified nucleic acid
preparations or on crude extracts of bacterial cells.
The amplified DNA sequences are then determined using the chain termination
method. The statistical introduction of a nucleotide analogue such as dideoxynucleotide
competes with conventional nucleotides and causes base-specific termination of elongation
products. This result in populations of single-stranded DNA fragments of different lengths
sharing a common 5' end i.e. the primer.
The resulting sequences are then aligned using the sequence analysis tools, forming
columns in which homologous nucleotides derived from common positions within the
sequences are arranged. The sequences can be identified as identical or different. Pairwise
similarities or the 100% similarity between a pair of 16S rDNA sequences using different
methods would imply high relatedness or even the identity of the organisms itself. A lower
percentage of similarity would decrease the likelihood of relatedness in the organisms
compared (Stackebrandt, 2001).
13
Introduction
1.3 Literature Review of 16S rDNA Amplification and Sequencing
1.3.1 Used in the Identification of Unknown Etiologic Agents
One of the first uses of the 16S rDNA PCR in the identification of etiologic agents
in infections was in the determination of the agent of bacillary angiomatosis (Relman et al.,
1990). DNA sequences were amplified directly from tissue samples and a previously
uncharacterised rickettsia-like organism was identified. The sequenced fragment showed
that the organism was closely related to Rochalimaea quintana and it has since been named
Bartonella hensalae
Another success was achieved in the investigation of the cause of Whipple’s disease
where 16S rDNA PCR was performed on a small bowel biopsy taken from a patient with
the disease (Wilson et al., 1991). The subsequent sequencing and rRNA sequence search
showed a high similarity to sequences of bacteria of the Rhodococcus, Streptomyces and
Arthrobacter genera and a weak similarity to Mycobacteria. Later, using the same 16S
rDNA and sequencing method, sequences were obtained directly from the infected tissue of
five patients with the disease and more than 90% of the gene sequence determined. The
organism Tropheryma whipplei was then proposed as the etiologic agent of Whipple’s
disease (Relman et al., 1992).
The identification of these two organisms was considered a success as they could
not be cultured during that period in time. In the case of T. whipplei, the organism has since
then been isolated and maintained on human embryonic lung fibroblast monolayers
although it still cannot be cultivated in the absence of living eukaryotic cells (La Scola et
al., 2001). The positive identification of such etiologic agents by culture confirmed the
usefulness of the 16S rDNA broad-range PCR in the determination of unknown organisms.
14
Introduction
1.3.2 Important Highlights Regarding the 16S rDNA Broad-range PCR
Before the PCR was used to investigate the gene coding for the 16S rRNA, the
sequences were obtained from the rRNA itself. Prior knowledge of the rRNA sequences
was required and large amounts of rRNA were needed per reaction. It was difficult to
culture sufficient cells for the extraction of rRNA for processing. The PCR of 16S rDNA
with sequencing overcame the need for obtaining the rRNA. It also eliminated the need to
clone rDNA as cloning is time consuming (Wilson et al., 1990).
The first report on the contiguous sequence information of the entire amplified gene
coding for the 16S rRNA spanning 1.5 kb without the need for subcloning was presented by
Edwards et al. (1989). In this paper, the use of synthetic oligonucleotides in PCR followed
by sequencing provided an almost complete nucleotide sequence of the gene.
The 16S rDNA method has been compared with culture methods in the
identification of bacteria. Seventy-two aerobic Gram-negative bacilli that were
unidentifiable using the computer-assisted replica plating method developed by the Mayo
Clinic in Rochester, USA (but identified by conventional methods) were evaluated using a
commercial 16S rRNA gene sequencing system (MicroSeq; PE Biosystems, California,
USA), a bacterial cellular fatty acid profile system (Sherlock; MIDI, Inc., Del., USA) and a
carbon source utilization system (Microlog; Biolog, Inc., California). The percentage of
identification using the Sherlock, Microlog and MicroSeq methods were 77.8%, 87.5% and
97.2% identified to genus level, and 67.7%, 84.6%, and 89.2% identified to species level
respectively. The MicroSeq system managed to identify all 72 isolates tested to the genus
level and 65 to the species level. The commercial 16S rDNA system showed a more rapid
turnaround time and provided unambiguous bacterial identification compared with the other
two systems (Tang et al., 1998).
15
Introduction
Broad-range 16S rDNA PCR has been particularly useful in the identification of
organisms that were previously undetected using standard culture methods. Using this
technique, a fastidious organism, Bartonella quintana was identified as the etiologic agent
in a case of culture-negative infective endocarditis in Finland (Jalava et al., 1995). It had
never previously been diagnosed in Finland and would not have been suspected if not for
the 16S rDNA PCR findings. This has important implications for laboratory practices e.g.
the need for longer incubation times for selected microbial cultures to enhance detection of
fastidious and slow-growing microbes. Other cases of PCR-detected organisms involved in
culture-negative bacterial endocarditis have also been reported by Goldenberger et al.
(1997) and Wilck et al. (2001). PCR and sequence analysis of the 16S rDNA also helped
identify the first case of community-acquired bacteremia caused by Acinetobacter
radioresistens in an immunodeficient patient, where ambiguous Gram-staining and poor
biochemistry reactivity of blood culture isolates misguided early drug therapy in the patient
(Visca et al., 2001).
Broad-range 16S rDNA PCR was then used in a systematic manner in a population-
based surveillance for unexplained life-threatening infections, the Unexplained Death and
Critical Illness Project, where it was observed that known bacterial pathogens cause some
critical illnesses and deaths that failed to be explained using traditional diagnostic methods.
Among the known bacterial pathogens identified in the previously unexplained cases were
Neisseria meningitidis from cerebrospinal fluid samples, Streptococcus pneumonia from
cerebrospinal and pleural fluid, Stenotrophomonas maltophilia from bone marrow aspirates
and Staphylococcus epidermidis from blood culture material (Nikkari et al., 2002).
16
Introduction
1.3.3 16S rDNA PCR as a Routine Clinical Diagnostic Service
Drancourt et al. (2000) used the 16S rDNA PCR and sequencing method on a range
of environmental and clinical bacteria isolates that were unidentifiable by the BioMérieux
(France) identification strips and extensive phenotypic investigations. Retrospective
analysis found that phenotypic identification failure was due to inappropriate biochemical
profile (58.7%), Gram-staining (11.6%), oxydase and catalase activity (3.6%), and growth
requirements (1.5%). Out of the 177 phenotypically unidentifiable isolates, 159 (89.8%)
were identified to the genus level and 139 (78.5%) were identified to the species level using
the 16S rDNA PCR and sequencing. There were 10.2% of isolates that remained
unidentifiable as it was probably new bacterial species, but phylogenetic position could be
assigned to these organisms. The method was also found to be reproducible in and between
laboratories.
In a four year study conducted at the Turku University Central Hospital (Finland) on
536 clinical samples consisting of body fluids (cerebrospinal, synovial and pleural fluid),
biopsy specimen from tissues and pus samples from abscesses, the results from the 16S
rDNA PCR and sequencing method were compared to those obtained from bacterial culture.
The molecular methods were found to be superior to culture techniques when infections
were caused by bacteria with unusual growth requirement e.g. Bartonella quintana from
heart valves and Ureaplasma urealyticum from amniotic fluid. Also, it was statistically
verified that there was a tendency for the specimens to be culture-negative but PCR-positive
if patients were receiving antimicrobial therapy at the time the sample was taken. Compared
to culture and clinical assessment, the sensitivity of PCR and sequencing in that study was
74.2% and specificity was 98.7-99.6% (Rantakokko-Jalava et al., 2000).
17
Introduction
The broad-range 16S rDNA PCR was also used as a routine diagnostic clinical
microbiological service at a hospital in London where 382 referred paediatric specimens
were tested in a two year period. The specimens consisted of blood samples, cerebrospinal
fluid, tissues, pus, pleural fluids, peritoneal dialysis fluids, bronchoalveolar lavages, blood
culture fluids and others. PCR was the sole evidence for infection in 18.6% of the cases
(Harris and Hartley, 2003).
In a hospital-affiliated laboratory in Marseille, France, 1404 bacterial isolates (0.8%
of the total samples tested in five year period) failed to be phenotypically identified using
conventional culture methods (which included biochemical profiling). The samples were
obtained from patients with various clinical conditions. Each unidentified isolate had 1400
bp of its 16S rDNA gene sequenced. The 16S rDNA sequence analysis identified 11 new
species (those having less than 97% of sequence identity with known bacteria). Of the
samples tested using 16S rDNA PCR and sequencing, 120 were found to be rare (fewer
than 10 published cases) or unique (no published cases associated with humans). Sixteen of
these 16 isolates were previously recognised as environmental, and had never before been
reported in humans (Drancourt et al., 2004).
1.3.4 16S rDNA PCR in Specific Clinical Conditions
Broad-range 16S rDNA PCR and sequencing was used on cerebrospinal fluid
samples (Greisen et al., 1994; Kotilainen et al., 1998) in diagnosis of bacterial meningitis
and was found to be superior to conventional methods when antimicrobials were used
(Schuurman et al., 2004). It was also used on synovial fluids (Wilbrink et al., 1998) to
suggest an association between bacterial infection and inflammatory arthritides (Wilkinson
et al., 1999). The 16S rDNA PCR detected bacterial infection in total knee arthroplasty,
where the molecular method produced less false-negative results when compared with
18
Introduction
standard microbiological assay i.e. out of the 50 samples tested, bacterial infection were
detected in 32 samples using PCR, compared to only 15 samples using standard culture
methods (Mariani et al., 1996).
PCR and sequencing was used to test for presence of 16S rDNA in BACTEC 9240
automated blood culture system (Becton Dickinson Diagnostic Instrument Systems, Sparks,
Md.) to confirm true-positive and true-negative results. True-positive samples were samples
that had a positive signal on the BACTEC system, and had Gram-stained cells and growth
on chocolate agar. True-negatives samples were negative by the BACTEC system, Gram-
stain and growth on agar. Using the MicroSeq 500 PCR kit (PE Biosystems), the instrument
true-positive samples were shown to have 16S rDNA and the true-negative samples were
shown to have no 16S rDNA (Qian et. al., 2001).
Most infections are treated empirically using broad-spectrum antibiotics, and delays
in processing (24 hours to 48 hours) can result using standard culture methods. The 16S
rDNA PCR allows for the detection and differentiation of Gram-positive and Gram-
negative bacteria without the need for cultivation. Early detection enables adequate
treatment of bacterial infection. Differentiation by Gram-stain type using PCR allowed for
the exact classification of 17 microorganisms from intensive care unit cases (Klaschik et al.,
2002), 62 pathogenic species (Klausegger et al., 1999) and organisms in intraocular samples
(Carroll et al., 2000).
19
Introduction
1.4 Outline of the Method used in this Study
An outline of the research protocol used in this project is shown in Figure 1.3. DNA
was extracted via several methods i.e. alkali heat-wash (AH), boiling in buffer, DNAzol
extraction, and phenol chloroform isoamyl-alcohol extraction (PCIA). Extraction was
performed on various culture-negative clinical samples i.e. cerebrospinal fluids (CSF),
synovial fluids (SF), peritoneal fluids (PF) and blood culture bottle (BCB) fluids that were
inoculated with a known microorganism. The results of the extractions were compared and
the best method for each sample type was chosen for further use in experiments.
A primer pair targeting the area in the 16S rRNA gene sequences which is shared
only by bacteria was selected and other primer sets were constructed within sequences in
the 16S rRNA gene to further differentiate bacteria into Gram-negative and Gram-positive
type groups (Carroll et. al., 2000). Primers were designed by aligning the sequences of
various bacteria and finding consensus sequences.
The broad-range PCR protocol was optimized and tested for sensitivity using known
concentrations of extracted bacterial DNA. The protocol was also tested for specificity
using a range of bacterial DNA that was extracted from pure bacterial cultures.
The optimised broad-range PCR protocol was then used to determine the presence
and Gram-type of the bacterial DNA in clinical samples.
The amplified DNA was then sequenced using the fluorescent dye terminator
sequencing system (ABI). Sequencing results were submitted for BLAST and RDP-II to
search for similarity to other sequences for the determination of the species or genus of the
bacteria present. The results obtained by PCR and sequencing were compared to results
using culture techniques (Figure 1.3).
20
Introduction
Part I: Design and Optimization Part II: Screening
Extraction
Using 4 methods: On spiked culture-negative
samples of:
•Alkali heat-wash Extraction of DNA
•Boiling in buffer •Cerebrospinal fluids from clinical specimens
•Phenol chloroform isoamyl- •Synovial fluids of various types.
alcohol extraction •Peritoneal fluids
•DNAzol extraction •Blood culture bottle fluids
Polymerase Chain Reaction

Design of primers for: Amplification of
Optimization Determination bacterial 16S rDNA and
•Pan-bacterial
of PCR of specificity differentiation into
•Gram-positive organisms
protocol and sensitivity Gram-positive and
•Gram-negative organisms
Gram-negative groups.
Sequencing of
Sequencing of amplified DNA from
amplified DNA
organisms with known identities
BLAST and RDP-II

BLAST and RDP-II similarity similarity search on the
search on the results of the sequences to determine
sequencing of known organisms. species (or genus or
group) of the organism.
Comparison of results
Comparison of results from 16S rDNA PCR
from 16S rDNA and and sequencing with
sequencing with known those from culture to
results from culture method determine clinical
to determine the extent of sensitivity and
matches. specificity.
Figure 1.3: The outline of the 16S rDNA PCR and sequencing method used in this study.
Part I involved designing and optimising various components of the method using known
parameters to determine the experimental limitations. Part II involved using the optimised
conditions to test a range of clinical samples obtained from the Microbiology Diagnostic
Laboratory, University of Malaya Medical Centre.
21
Introduction
1.5 Objective of the Study
The main objective of this study is to develop and optimise a broad-range PCR
protocol to detect bacterial 16S rDNA, allowing for differentiation into Gram-stain types,
and to provide identification of bacteria without the need for cultivation. Development and
optimisation of the broad-range PCR was performed on various clinical samples in a routine
clinical diagnostic laboratory.
Specific objectives of this study:
• To evaluate different methods of DNA extraction from various types of clinical samples
for the optimal recovery of DNA and to overcome the presence of amplification
inhibitors.
• To design and optimize a broad-range PCR for use in a clinical setting that will be able
to detect the presence of bacterial DNA and to determine the Gram-stain type of Gram-
positive and Gram-negative bacteria.
• To determine the sensitivity and specificity of the PCR when applied to clinical
samples.
• To study the range of bacterial pathogens causing culture-negative infections by using
broad-range PCR on culture-negative deep body fluids i.e. CSF, PF, SF and venous
blood in BCB samples.
22
Methodology
2.0 Methodology
2.1 Samples
2.1.1 Bacterial Stock Culture
Pure cultures of Staphylococcus aureus and Escherichia coli identified by standard
bacterial testing techniques were obtained from the Diagnostic Microbiology Laboratory,
University of Malaya Medical Centre (UMMC). The pure cultures were used to optimise
and determine the lowest detection limits of DNA extracted using different techniques. The
specimens were obtained from hospitalised patients in the UMMC and were grown on agar
plates. Single colonies were obtained from purified sub-cultured agar plates and inoculated
into tubes containing 1 ml of Luria-Bertani (LB) broth and incubated at 37°C overnight. If
there was bacterial growth, the tubes were kept at 4°C or used immediately. Stock cultures
were re-grown in LB broth every fortnight, after sub-culturing on agar plates for purity.
2.1.2 DNA Samples
The DNA of S. aureus and E. coli were extracted from LB broth cultures using the
phenol chloroform isoamyl-alcohol method (Section 2.3.4). DNA extracts with an OD
reading between the ratios of 1.8-2.0 were used for PCR optimisation, determination of
PCR sensitivity and specificity, and as positive controls for the optimised PCR.
23
Methodology
Pure cultures of Enterococcus faecalis, Corynebacterium sp., Neisseria
gonorrhoeae, Haemophilus influenzae, Acinetobacter baumanii, Klebsiella pneumoniae,
Enterobacter sp., Proteus sp. and Stenotrophonomas maltophilia were obtained from the
Diagnostic Microbiology Laboratory, UMMC. The samples originated from in-patients of
the hospital and were grown on agar plates. About five single colonies were obtained from
purity plates and inoculated into 0.1 ml of LB broth. The DNAzol method of extraction was
performed on the samples using the method in Section 2.3.5. The samples were used to
determine the PCR specificity in this study.
The DNA of the fungus Cryptococcus neoformans was obtained from the
collections of Dr Tay Sun Tee of the Department of Medical Microbiology in the Faculty of
Medicine, University of Malaya (UM). The sample was used as a negative control in
determining PCR specificity in this study.
2.1.3 Culture-Negative Clinical Specimen
Culture-negative clinical specimens were used to evaluate the choice of extraction
methods in this study. The specimens were deep body fluids from hospital in-patients, sent
to the Diagnostic Microbiology Laboratory, UMMC for microbiological diagnosis. The PF
specimen was from a patient with a pleural effusion, the CSF specimen was pooled from
patients diagnosed with suspected meningitis, the SF specimen was from a patient
diagnosed with suspected septic arthritis and the BACTEC blood culture bottle (BCB;
Becton-Dickinson, USA) sample was cultured from a patient suffering from fever of
unknown origin. Samples were collected and used immediately or stored at -20°C until
required for use.
24
Methodology
2.1.4 Clinical Specimens for 16S rDNA Screening
Clinical specimens that were used for 16S rDNA screening consisted of CSF, SF,
PF and BCB samples collected from the Diagnostic Microbiology Laboratory, UMMC. The
collection was at random and selected only on the basis of sample type. Clinical information
on the patients and culture results were obtained from test request and report forms.
For each specimen, 0.1 ml was placed into a 1.5 ml microtube for DNA extraction.
The remaining sample fluid was stored in -20°C until the end of the study. Extraction was
carried out immediately, or within 2 days. Samples that could not be immediately extracted
were stored at -20°C.
2.2 General Methods
2.2.1 Preparation of Media and Buffers
All media and buffers were prepared in sterilised glassware or Schott bottles using
sterile MilliQ (18.2 megaohm/cm) water (sddH2O). Fresh broth powder and chemicals from
commercial companies were used during preparation (Appendix A). The buffers were kept
for 3 months at room temperature and longer if kept at 4°C. The autoclaved media bottles
were kept for one month at room temperature, and at 4°C when opened. Methods for media
and buffer preparation are outlined in Appendix B.
2.2.2 Sterilisation
Media solutions and water were autoclaved at 121°C at 15 psi for 15 minutes.
Pipette tips and microtubes and other plastics were autoclaved at 121°C at 15 psi for 20
minutes. Glasses and Schott bottles were washed with cleaning solution and dried at 80°C
in an oven.
25
Methodology
2.2.3 Workflow and Special Considerations
Several procedures were implemented to minimize carry-over DNA and sample-to-
sample contamination during PCR. Among them are aliquoting reagents, particularly if the
reagents are used in small amounts, the use of positive displacement pipettes, meticulous
laboratory techniques and the use of dedicated equipment (e.g. micropipettes, tips, tubes,
and centrifuge) in specialised areas (e.g. the Class II biological safety cabinet for extraction,
and the Post-PCR room). Proper negative and positive controls were also included in every
experiment and every batch to help detect contamination. A physical separation of pre- and
post- amplification areas and a unidirectional workflow was strictly implemented in the
following manner:-
Reagent preparation (Reagent Room and laminar flow hood in main laboratory)
PCR Premix (Class II biological safety cabinet, dedicated for PCR only)
Extraction and DNA template addition (Class II biological safety cabinet,
dedicated for sample manipulation) DNA amplification (thermal cycler in main
laboratory) Post-PCR manipulation (in Post-PCR room on separate floor from
main laboratory)
2.3 Extraction Methodology
2.3.1 Cell Counting
A 1 ml volume of E. coli broth culture was transferred into 0.9 ml of sterile LB
broth. Six serial 10-fold dilutions were made and 100 µl of the final three dilutions were
plated on Nutrient Agar. The plates were incubated overnight at 37°C. Colonies were
counted on plates having 30-300 colonies and the colony forming units (CFU) per ml of
each sample was determined using the following formula:
26
Methodology
CFU/ml = __N__
DF x V
With N = the number of colonies counted on the plate; DF = the dilution factor (or the
number of times the sample was diluted), and V = the volume plated in ml (0.1 ml in this
case). This experiment was repeated using S. aureus broth cultures. Known quantities of
CFU/ml in a broth culture were used to determine the best extraction method as well as the
lowest detection limits of the method of choice.
2.3.2 Alkali Heat-Wash Extraction Method
The AH method used in this study was modified from the method proposed by
Kulski and Pryce (1996). To wash the cells, 0.1 ml of the sample and 1.4 ml of alkali wash
solution was placed into a microtube. The lid was closed firmly and the solution mixed by
inversion for 10 minutes in room temperature. The cells were pelleted by centrifugation at
13,000 g for 5 minutes and the supernatant removed. The remaining alkali wash solution
was removed by washing twice with 0.5 ml of 0.5 M Tris-HCl (pH 8.0). At each wash, the
pellet was resuspended in the buffer, and then pelleted again by centrifugation at 13,000 g
for 5 minutes. After the second wash, the pellet was resuspended in 0.1 ml of TE buffer (pH
8.0). The microtube was then placed on the heating block and incubated at 95°C for 25
minutes. The microtube was then removed and placed in -20°C until the lysate was frozen.
The lysate was thawed out by placing the microtube in warm water for 15 minutes. The
freeze/thaw cycle was repeated twice. The lysate was then centrifuged at 13,000 g for 5
minutes and the supernatant transferred into a fresh tube. The supernatant containing DNA
was used immediately or stored at -20°C until use.
27
Methodology
2.3.3 Boiling Extraction Method
A 0.1 ml volume of sample was buffered with 0.4 ml of TE buffer (pH 8.0) and
incubated at 95°C for 25 minutes. The lysate was then frozen at -20°C and then thawed in
warm water for 15 minutes. The freeze/thaw cycle was repeated twice to break down any
remaining cell wall or membrane. The lysate was then centrifuged at 13,000 g for 15
minutes. The supernatant containing DNA was then transferred to a fresh tube and used
immediately or stored at -20°C until use.
2.3.4 Lysis Buffer and Phenol Chloroform Isoamyl-Alcohol Extraction Method
A lysis buffer was added to 0.1 ml of sample in a microtube. The buffer consisted of
146 µl of the buffer TE (10/10 mM), 225 µl of lysozyme (10 µg/ml), 11.5 µl of Proteinase K
(10 µg/ml) and 17.5 µl of 10% SDS. The microtube was then incubated at 65°C for an hour,
and then at 55°C for 3 hours (or 37°C overnight).
An equal volume of phenol (500 µl) was then added to the lysate, and mixed well by
inversion of the microtube. The lysate solution was then centrifuged at 3,500 g for 5
minutes. The resulting aqueous layer was removed carefully and transferred into a fresh
microtube. An equal volume of chloroform-isoamyl-alcohol (24:1) was then added into the
microtube and placed into the centrifuge at 3,500 g for 5 minutes. Again, the aqueous layer
was removed and transferred into a fresh microtube. To precipitate the DNA, 100% ethanol
was added at twice the volume of the aqueous layer and 4 M NaCl at a tenth of the volume.
The microtube was inverted several times to mix and the solution was observed for DNA
precipitation. The microtube was then placed in -20°C overnight or -80°C for 3 hours. The
DNA was pelleted by centrifugation at 13,000 g for 10 minutes and the supernatant
discarded.
28
Methodology
The DNA precipitate was washed using 1 ml of 100% ethanol and then sedimented
by centrifugation at 13,000 g for 10 minutes. The supernatant was discarded. The pelleted
DNA precipitate was then washed again using 1 ml of 70% ethanol and centrifuged as
before. The supernatant was drained from the microtube, and the microtube inverted until
the ethanol had evaporated. The DNA was solubilized using TE buffer (pH 8.0) and used
immediately or kept at -20°C until required.
2.3.5 DNAzol Extraction Method
This method was modified from the Molecular Research Centre protocol for genomic DNA
isolation (found online at http://www.mrcgene.com/dnazol.htm). A 0.1 ml volume of the
sample was placed in a microtube and 0.9 ml of DNAzol was added for cell lysis. The
solution was mixed by inversion for 15-30 seconds and then incubated at 50°C for 15
minutes. The homogenate was then sedimented by centrifugation at 10,000 g for 10
minutes. The resulting viscous supernatant was transferred to a fresh tube. To precipitate the
DNA, 0.5 ml of 100% ethanol was added to the lysate. The sample was mixed by inverting
the tube 5-8 times, making sure that the DNAzol and ethanol mix well to form a
homogenous solution. The microtube was then stored at room temperature for 5 minutes.
DNA was visible as a cloudy precipitate and this was sedimented by centrifugation at 5,000
g for 15 minutes. The supernatant was removed and the precipitated DNA was washed
twice with 1 ml of 70% ethanol. At each wash, the DNA was suspended in ethanol by
inverting the tubes 3-6 times and the DNA sedimented by centrifugation at 5,000 g for 5
minutes before the removal of the supernatant. After the second wash, the microtube was
drained of remaining ethanol and inverted for 1-2 minutes. The DNA was solubilised with
TE buffer (pH 8.0) and used immediately or stored in -20°C until use.
29
Methodology
2.3.6 DNA Quantification of Extracted Samples
DNA concentration for each clinical sample was estimated using the BioPhotometer
(Eppendorf, Hamburg). A 5 µl volume of DNA was diluted into 45 µl of sterile ddH2O to
make a final 1/10 dilution. The absorbance reading for the sample was measured at 260 nm
to estimate the DNA concentration in µg/µl. Protein contamination was measured at 280
nm. DNA purity was measured using absorbance readings at 260/280.
2.4 PCR Primers
2.4.1 Designing Primers
Consensus sequences were determined by aligning the 16S rDNA sequences (≈1500
bp) of various organisms obtained from GenBank (http://www.ncbi.nlm.nih.gov/Genbank/),
using the FastPCR for Windows software v2.4.13 (http://www.biocenter.helsinki.fi/bi/bare-
1_html/oligos.htm) followed by manual alignment. From the aligned sequences, “front” and
“back” end consensus sequences that potentially contained forward and reverse primers
were chosen, with preference on conserved regions flanking variable regions.
The Primo Pro software (http://www.changbioscience.com/primo/primo.html) was
used to select the best primers from the chosen consensus sequences using the following
settings: 5’ primer <1-100>, melting Tm <65°C>, Tm formula <Nearest-N>. From the
many potential primer sequences generated, those that were more than 25 bp in length,
ranked with a lower quality (as defined by FastPCR), formed primer-dimers with existing
primers, and had a non-matching Tm were eliminated from the list. The final primers were
tested for correct matching with target areas by inserting a string of more than 20 Ns
between two primers and performing the search as if it were one sequence on BLAST
(http://www.ncbi.nlm.nih.gov/BLAST/).
30
Methodology
2.4.2 Manufacturing Primer Oligonucleotides
Sequences of primers were synthesised by 1st Base Laboratories Sdn. Bhd
(Selangor, Malaysia). The manufactured oligonucleotides were delivered in lyophilised
form and solubilised with ddH2O to make 100 mM of stock solution which was then diluted
to make a 10 mM of working solution. The primer solutions were aliquoted into small
volumes and kept in -20°C until use.
2.4.3 Primer Profile
Primers nf, NR and f3p (modified) were from Carroll et al. (2000). The primers f4n
and r18n were designed using the method above (Section 2.4.1). Table 2.1 contain details
and sequences of the primers used.
Table 2.1: Details of the oligonucleotide primers used in the study.
Position
on E.coli
Primer Length rRNA
Target Fragment
Sequence (5'-3')
Name (bases) sequence area size
(bases)
Gram-
f4n AGCAGCCGCGGTAATACGGAGG 22 520-541 negative
specific
554 bp
Gram-
1051-
r18n ACGAGCTGACGACAGCCATGCAG 23 negative
1073
specific
Pan
nf GGCGGCAKGCCTAAYACATGCAAGT 25 38-62 bacterial
specific
Gram-
f3p CCGRCTCTCTGGTCTGTAACTGACGC 26 731-756 positive 336 bp
specific and
1029 bp
Pan and
1044- Gram-
NR GACGACAGCCATGCASCACCTGT 23
1066 positive
specific
Note: K=G/T; Y=C/T; R=A/G; S=G/C

31
Methodology
The Pan-bacterial specific primers of nf and NR targeted only the 16S rRNA gene
sequence of bacteria. The nf primers contained two degenerate bases and were 25 bases in
length. The sequence of this oligonucleotide was located on the sense strand of the E. coli
16S rRNA sequence between the bases 38 and 62.
The NR primer was also paired with f3p in the Gram-positive specific PCR. The NR
primer had one degenerate base, was 23 bases in length and was located on the antisense
strand of the E.coli rRNA sequence at 1044-1066 bases.
The f3p primer was based on the P2F primer (Carroll et al., 2000). One of the bases
was changed at the 5'-end and 8 other bases were added at the 3'-end. The 8 bases added
were based on the consensus sequence of several Gram-positive organisms. The length of
the primer was 26 bases with the additions. The primer was located on the sense strand of
the E. coli rRNA sequence (with 8 bases mismatched) and had one degenerate base.
The f4n and r18n primers were Gram-negative specific. The f4n primer was 22
bases in length and was located on the sense strand of the E. coli rRNA sequence between
the bases 520 and 541.
The reverse primer r18n was 23 bases in length and was located at positions 1051 to
1073 of the antisense strand of the E. coli rRNA sequence. The r18n and NR primers
overlap by 16 bases. However, when both the primers were examined by BLAST, r18n
gave results that were more specific to Gram-negative organisms.
32
Methodology
The image on which the primer sequences were matched to those on the E. coli
rRNA sequence is shown in Figure AppC (Appendix C). The potential fragment size of
the amplified products was calculated as the distance between the forward and reverse
primers on the E. coli rRNA sequence. The f4n and r18n primers amplified a fragment that
was 554 bp in size, f3p and NR primers produced a fragment of 336 bp in size, and nf and
NR primers produced a fragment of 1029 bp in size. A diagrammatic view of the PCR
primer target areas and the sizes of the fragments produced are shown in Figure 2.1.
NR 16S rDNA
TARGET nf f4n f3p r18n
AREAS OF
PRIMERS
0 1500 bp
FRAGMENT nf NR Pan-bacterial
SIZES specific
1029 bp PCR product
38 62 1044 1066 bp
KEY
Forward primer for
duplex PCR f3p NR Gram-positive
specific
Forward primer for 336 bp PCR product
Gram-negative
specific PCR 731 756 1044 1066 bp
Reverse primer for

duplex PCR
Gram-negative
Reverse primer for f4n r18n specific
Gram-negative PCR product
specific PCR 554 bp
DNA fragment 520 541 1051 1073 bp
Figure 2.1: A diagram showing the primer annealing positions and fragment sizes of the
PCR products in this study.
33
Methodology
2.5 PCR, Sequencing and Analysis
2.5.1 Preparation of PCR Mixtures
PCR reagents are sensitive to cycles of freezing and thawing, thus, solutions were
aliquoted in small volumes of 50-100 µl in microtubes. The Taq polymerase (recombinant,
1U/µl; Fermentas) and primers were kept at -20°C until use. The stock solution for the
buffer (10X), MgCl2 (25 mM) and dNTPs (10 mM) were kept at -20°C, but the working
solutions were stored at 4°C for a maximum duration of one week to prevent cycles of
freezing and thawing. Frozen solutions were thawed out slowly on ice and centrifuged
before use. The preparation of the PCR mixture was also performed on ice.
A PCR pre-mix solution was prepared by pipetting the buffer solution, MgCl2,
dNTPs, primers, Taq polymerase, and sddH2O into a thin-walled PCR tube and mixing
thoroughly. Template DNA was then added in an area separate from the PCR pre-mix area.
Negative and positive controls with samples containing appropriate DNA were added in
each batch of reactions. In addition, DNA blanks with no DNA added to the PCR tubes
were included in every PCR batch to ensure no DNA contamination.
Following template addition, the tubes were placed in a thermal cycler with a heated
lid (MJ Research Instrument Inc, USA). The file with the appropriate thermal profile was
selected.
When the PCR assay was completed, the tubes were placed into a post-PCR
container, taken to the post-PCR area, and spun down before gel electrophoresis.
34
Methodology
2.5.2 Gel Electrophoresis of Amplified PCR Products
The PCR amplification products were observed using agarose gel-electrophoresis. A
1.5% agarose-TBE gel was made to which 1 µl of ethidium bromide (10 mg/ml) was added.
The solution was mixed by swirling and poured into the acrylic gel tray with the two ends
taped up to make a reservoir. The 14-well comb was set in place and the gel was left to set
for 30 minutes. When the gel solidified, the comb and tapes were removed and the gel tray
placed in the buffer tank. The gel was submerged to a depth of 2-5 mm by pouring 1x TBE
into the tank.
On a strip of parafilm, 1.5 µl of loading dye was mixed with 9 µl of the PCR
amplified DNA sample. The mixture was then carefully loaded into the well of the gel. The
MassRuler DNA Ladder (Fermentas) was used as a molecular weight marker. Gel
electrophoresis was carried out at 90V for one hour (or until the dye reached 3/4 the length
of the gel).
When the run was complete, the gel tray was removed from the buffer tank and the
gel placed on a UV lightbox. The gel was photographed and documented using Polaroid
667 black and white film.
35
Methodology
2.5.3 Min Elute PCR Purification Kit Protocol and Sequencing
Amplified PCR products were purified using the MinElute PCR Purification Kit
(Qiagen) according to manufacturer’s instructions. Absolute ethanol was added to Buffer
PE before use, following the volume written on the bottle label. All centrifuge steps were at
13,000 g. Buffer PB was added to the PCR mixture in a 5:1 ratio and mixed. The MinElute
column was placed in a 2 ml collection tube. The sample was applied to the MinElute
column and centrifuged for 1 minute to bind DNA. The flow-through was discarded and the
MinElute column placed back into the same tube. To wash, 750 µl Buffer PE was added to
the MinElute column and centrifuged for 1 minute. The flow-through was again discarded
and the MinElute column placed back into the same tube. The column was centrifuged for
an additional minute to remove residual ethanol from the Buffer PE. The MinElute column
was then placed in a clean 1.5 ml centrifuge tube. To elute the DNA, 50 µl of ddH20 with a
pH value of between pH 7.0 and 8.5 (as maximum elution efficiency is achieved at that
range) was added to the centre of the membrane. The column was left to stand for 1 minute
and then centrifuged for another minute. The purified PCR products were stored at 4°C
until sent for sequencing.
The purified PCR products and the appropriate primers were collected by 1st Base
Laboratories Sdn. Bhd representatives within 24 hours. Sequencing results were generated
by the company in 2-3 working days and were initially sent via email. Hardcopies of the
results were sent after a week. Results were obtained as electropherograms and .txt file
formats.
36
Methodology
2.5.4 Analysing Sequencing Results
The DNA sequenced results obtained were analysed using databases freely available
online. Analyses from both BLAST (Altschul et. al., 1997) and the RDP Database Project-
II or RDP-II (Cole et. al., 2005; http://rdp.cme.msu.edu/index.jsp) were used to confirm the
identity of the sequenced DNA.
The sequences were sent for BLAST analysis and the percentage of similarity was
noted. The Nucleotide-nucleotide BLAST (blastn) program was used with the default
option selected i.e. nr database, low complexity filter, a word size of 11 and expected 10.
Identification was refined using the RDP-II tools of the Classifier. When the
sequence was tested on the Classifier using an 80% confidence level, the taxa in which the
organism belongs could be determined with the percentage of probability stated.
Information for the identification of bacteria was further obtained by selecting the
SeqMatch (Sequence Match) "type and non-type" and "type only” option for strains, which
provided a possible organism name and a similarity score (where the highest matching score
from a combination of both groups was considered). The “type” option displayed only
sequences of known type strains. Results from unidentified or uncultured organisms were
generally excluded unless there was a high probability match or no other close matches.
2.5.5 Statistical Analyses
Statistical analyses and comparison of the performance of the 16S rDNA PCR and
sequencing assay against culture methods were performed using Fisher’s Exact Test and the
SISA software (Uitenbroek, 1997).
37
Methodology
2.6 Determination of PCR Sensitivity
To determine the sensitivity or lowest detection limit in of DNA concentration for
the PCR, E. coli was used to represent Gram-negative organisms, and S. aureus was used to
represent Gram-positive organisms. The DNA of each organism was extracted using the
PCIA method, DNA concentration was determined spectrophotometrically. Serial dilutions
to 10 ng, 1 ng, 100 pg, 10 pg, 1 pg of DNA per 5 µl of DNA template solution was carried
out. The DNA template solution was then added to 20 µl of PCR pre-mix to make a total of
25 µl per PCR microtube. PCR was performed using the optimised thermal profile and the
results observed on an agarose gel. The lowest detection limit for PCR is the minimum
amount of DNA template needed to produce an amplified product (Figure 2.2).
1/10 1/10 1/10 1/10

dilution dilution dilution dilution
1/10 1/10 1/10
DNA
template
10 ng/5 µl 1 ng/5 µl 100 pg/5 µl 10 pg/5 µl 1 pg/5 µl
5 µl 5 µl 5 µl 5 µl 5 µl
PCR tubes
with 20 µl of
pre-mix
Marker Lane 1 Lane 2 Lane 3 Lane 4 Lane 5 DNA blank
Example of
a PCR result
on an
agarose gel
10 ng 1 ng 100 pg 10 pg 1 pg No DNA
DNA DNA DNA DNA DNA added
A faint amplified specific band observed in Lane 4 and none in Lane 5 indicates
the lowest detection limit for this PCR is 10 pg.
Figure 2.2: Procedure for the determination of PCR sensitivity in this study.
38
Methodology
2.7 Determination of PCR Specificity
For specificity testing of PCR, DNA from a range of organisms was extracted using
the DNAzol method. DNA concentration was determined and 10 ng of DNA from each
sample was then used in each 25 µl PCR mixture. PCR was performed using the optimised
thermal profile and the results observed on an agarose gel. The PCR was considered
specific for a particular microorganism when DNA amplification of a specific product was
obtained (Figure 2.3).
Organism A Organism B Organism C Organism D

DNA template
from various
known
organisms
10 ng 10 ng 10 ng 10 ng
DNA DNA DNA DNA
PCR tubes
with pre-mix
Marker Lane 1 Lane 2 Lane 3 Lane 4 DNA blank
Example of a
PCR result on
an agarose gel
Amplified specific bands observed in Lanes 1, 2 and 4 and none in Lane 3 indicates
organisms A, B and D contain target DNA specific to this particular PCR.
Figure 2.3: Procedure for the determination of PCR specificity in this study.
39
Methodology
2.8 Screening of Clinical Specimens
The clinical specimen was collected and used immediately (or stored at -20°C if
tests could not be performed within the same day). DNA from each specimen was extracted
using the methods found to be most effective for each specimen type (Section 3.1.3).
Procedures for the screening of clinical samples are shown in Figure 2.4.
Clinical DNA
Specimen Extract Template
DNA
10 ng into each
PCR tube
100 pg 100 pg
Staphylococcus Escherichia
aureus DNA coli DNA
PCR tubes
with pre-mix
Tube 1 Tube 2 Tube 3 Tube 4
Pan and Gram-Positive Gram-Negative Specific

Specific Duplex Polymerase Chain Reaction
Diagrammatic examples of possible PCR results on agarose

gel can be seen in Figure 2.5. Gram-type
obtained
Electropherogram
from sequencing
PCR positive BLAST

results sent and
for RDP-II
sequencing search Bacterial
identity
obtained
Figure 2.4: Procedures used in the screening of clinical specimens in this study.
40
Methodology
Following OD readings, 10 ng of extracted DNA was added into PCR pre-mixes.
Each sample was placed into four separate PCR tubes, two tubes containing 10 ng of
sample only, another spiked with an additional 100 pg of S. aureus DNA, and another
spiked with 100 pg of E. coli DNA. The tubes containing 10 ng of samples only, and spiked
with S. aureus DNA were used for Pan and Gram-positive specific PCR while the other
tube containing 10 ng of samples only and spiked with E. coli DNA were used for Gram-
negative specific PCR.
Each PCR batch had E. coli and S. aureus DNA as positive or negative control and a
DNA blank with no DNA template added. E. coli DNA was the negative control and S.
aureus DNA was the positive control in the Gram-positive specific PCR and vice-versa for
the Gram-negative specific PCR. All PCR assays were carried out with at least two positive
and negative control tubes to ensure reproducibility in results. However, in the gel photos
shown in the thesis, only one negative, one positive and one DNA blank were shown. Each
test was performed twice.
Diagrammatic examples of possible PCR results on agarose gel can be seen in
Figure 2.5. DNA blank batch controls that were included in each run were expected not to
have any bands. The positive control for Pan and Gram-positive specific PCR (S. aureus
DNA) was expected to have 1029 bp and 336 bp bands, while the negative control (E. coli
DNA) was expected to have only a 1029 bp band. The positive control for Gram-negative
specific PCR (E. coli DNA) was expected to have a 554 bp band and the negative control
(S. aureus DNA) was expected to have no bands. Clinical specimens producing 1029 bp
and 336 bp bands only were considered to have DNA from Gram-positive organisms, while
specimens producing 1029 bp and 554 bp bands are considered to contain DNA from
Gram-negative organisms. If spiked samples produced bands but no bands were observed in
non-spiked samples, the clinical specimens were considered to be negative for the targeted
DNA sequences.
41
Methodology
Samples that were positive in PCR were purified and sent for sequencing. The
results were analysed using BLAST and RDP-II searches and the possible identity of the
organism determined.
Pan and Gram-positive Gram-negative specific

specific PCR results PCR results
Tube Tube Tube Tube

1 2 GP GN BL Marker 3 4 GP GN BL
DNA was
- 1029 bp
obtained from a
Gram- positive - 554 bp
organism
- 336 bp
Tube Tube Tube Tube

DNA was
- 1029 bp
obtained from a
Gram-negative - 554 bp
organism
- 336 bp
Tube Tube Tube Tube

No DNA
present or - 1029 bp
DNAwas
obtained from a - 554 bp
non-bacterial
- 336 bp
source.
Key:
Tube 1: Clinical specimen DNA only
Tube 2: Clinical specimen spiked with Staphylococcus aureus DNA
Tube 3: Clinical specimen DNA only
Tube 4: Clinical specimen spiked with Esherichia colis DNA
GP: S. aureus DNA

GN: E. coli DNA
BL: No DNA added (blank)
Figure 2.5: Diagrams of possible PCR results on agarose gel during hypothetical clinical
screening of specimens.
42
Results
3.0 Results
The results will be presented in two sections. The first section contains results from
Phase I of the study which involved the optimisation of the various methods used. Phase II
contains the results obtained from the screening of the clinical samples in this study.
PHASE I: Optimisation of Protocols
3.1 DNA Extraction
The clinical specimens used in this study were from different sources. Thus,
different methods of extraction were evaluated for each of the specimen types to determine
the most optimal method for use. The methods tested were the AH, boiling, PCIA and
DNAzol methods on culture-negative CSF, SF, PF and BCB samples (Section 2.1.3).
Whole cells of Escherichia coli and Staphylococcus aureus (1x106 CFU/ml) were
separately spiked into 100 µl of each specimen types prior to extraction. The final choice of
extraction method depended on the comparison of the "Complexity Ranking" for each
method (Section 3.1.1) together with the PCR results of the extracted DNA templates
(Section 3.1.2).
43
Results
3.1.1 Complexity Ranking
The complexity ranking (Table 3.1) is a qualitative analysis of several conditions
during extraction i.e. the number of steps involved, the amount of toxic chemicals used, the
skill level needed to conduct the extraction, and the amount of waste (chemicals and
consumables) generated. Each of the conditions was graded as low (+), medium (++) or
high (+++) in complexity.
Table 3.1: The Complexity Ranking of various DNA extraction methods.
Number Toxic Skill Waste

Method Name
of Steps Chemicals Level Generation
Boiling 10 (+) + + +
Alkali heat-wash (AH) 18 (++) + + +
DNAzol 17 (++) ++ + ++
Phenol chloroform isoamyl-alcohol (PCIA) 23 (+++) +++ +++ +++
Note: + : low complexity

++ : medium complexity
+++ : high complexity
The boiling method had the lowest overall complexity ranking. It required the least
amount of steps compared to the other methods (10 steps, Section 2.3.3), involved almost
no toxic materials, required a low skill level, and the amount of waste generated was
negligible as everything was carried out in the same tube. In addition, the chemicals used
did not require special disposal aside from the usual biohazard disposal system.
The AH method was similar to the boiling method with regards to the amount of
toxic materials used, the skill level needed to perform the extraction, and the amount of
waste generated. However, the number of steps was increased by an additional eight steps
(Section 2.3.2). Thus, the AH method had the second lowest complexity ranking.
44
Results
The method involving DNAzol had the second highest complexity ranking of the
four. The number of steps involved (17 steps, Section 2.3.5) were almost similar to the AH
method but lesser than the steps needed to perform the PCIA method. Because the main
ingredient of DNAzol was guanidium thiocyanate, which is a mildly hazardous irritant and
requires careful attention when in use, the method was given a higher complexity ranking in
terms of the waste generated. Aside from the care needed in handling the toxic material, the
skill level when using DNAzol was low.
The PCIA method required the most number of steps to perform (23 steps, Section
2.3.4). The amount of toxic materials such as phenol, chloroform, isoamyl alcohol and SDS
used gave this method a high complexity ranking. In addition, the step involving the
removal of the aqueous layer with minimal disturbance to the interphase required a steady
hand and this step had to be carried out slowly and carefully. The amount of waste
generated was also high, and as the chemicals are poisons, they have to be stored and
disposed by University of Malaya contract disposal companies.
In summary, the boiling method had the lowest complexity ranking, followed by the
AH, DNAzol and PCIA methods (Boiling<AH<DNAzol<PCIA).
3.1.2 DNA Amplification Results of Extracted Samples
Figures 3.1 and 3.2 show the products of a Gram-negative specific PCR using DNA
from the experiment in which the AH, boiling, PCIA and DNAzol extraction methods were
evaluated on CSF, BCB, PF, SF and water samples spiked with E. coli cells. A standard
DNA concentration of 10 ng was used in the PCRs. The agarose gel-electrophoresis system
was used to observe the amplified product after PCR. The presence of a distinct band with
the specific molecular weight indicated that a particular extraction method used was
successful in removing PCR inhibitors and producing purified DNA. The MassRuler DNA
Ladder (Fermentas) was used as a molecular weight marker.
45
Results
Alkali heat-wash method of extraction
Lane 1: Cerebrospinal fluid sample, 554 bp band.
Lane 2: Blood culture bottle sample, 554 bp band.
Lane 3: Synovial fluid sample, no amplified product.
Lane 4: Peritoneal fluid sample, 554 bp band.
Lane 5: Water sample, no amplified product.
Lane 6: Massruler DNA ladder (Mix)
Boiling method of extraction
Lane 8: Blood culture bottle sample, no amplified product.
Lane 9: Synovial fluid sample, no amplified product.
Lane 10: Peritoneal fluid sample, no amplified product.
Lane 11: Water sample, no amplified product.
Lane 12: 100 pg Escherichia coli DNA (positive control), 554 bp band.
46
Results
1 2 3 4 5 6 7 8 9 10 11 12
10 kbp
1031 bp
554 bp
500 bp
80 bp
Figure 3.1: Gel electrophoresis of PCR products amplified from DNA
extracted using the alkali heat-wash and boiling methods. The Gram-
negative specific primer set (f4n and r18n) was used
47
Results
Phenol chloroform isoamyl-alcohol method of extraction
Lane 3: Synovial fluid sample, 554 bp band.
Lane 4: Peritoneal fluid sample, 554 bp band.
Lane 5: Water sample, 554 bp band.
DNAzol method of extraction
Lane 9: Synovial fluid sample, 554 bp band.
Lane 10: Peritoneal fluid sample, 554 bp band (faintly visible).
Lane 11: Water sample, 554 bp band.
Lane 12: DNA blank, no amplified product.
48
Results
1 2 3 4 5 6 7 8 9 10 11 12
10 kbp
1031 bp
554 bp
500 bp
80 bp
extracted using the phenol chloroform isoamyl-alcohol and DNAzol
methods. The Gram-negative specific primer set (f4n and r18n) was used.
49
Results
Figure 3.1 shows the results using DNA extracted by the AH and boiling methods.
E. coli were added to each sample prior to extraction, thus, successful DNA amplification
using Gram-negative specific primers would produce a specific 554 bp amplified band. For
the AH method of extraction, the specific 554 bp amplified band was observed in DNA
extracted from the CSF sample (lane 1), the BCB sample (lane 2), and the PF sample (lane
4). The SF (lane 3) and water (lane 5) samples had no amplified product. The boiling
method of extraction had a specific 554 bp band amplified from DNA extracted from the
CSF sample (lane 7) but no amplified products were observed from the BCB (lane 8), SF
(lane 9), PF (lane 10) and water (lane 11) samples.
Figure 3.2 shows the results using DNA extracted by the PCIA and DNAzol
methods. The specific 554 bp product was observed in the CSF (lane 1), SF (lane 3), PF
(lane 4), and water (lane 5) samples extracted by the PCIA method. The BCB sample (lane
2) extracted by PCIA showed no amplified product. The DNAzol method of extraction had
amplifiable DNA of the 554 bp molecular size in samples from CSF (lane 7), SF (lane 9),
PF (lane 10), and water (lane 11). The band in Lane 10 was faintly visible. The BCB sample
(lane 8) showed no amplified product. The positive control for this experiment was the E.
coli DNA template which produced a specific 554 bp band (Fig. 3.1, lane 12). There was no
PCR product in the lane where no DNA was added (Figure 3.2, lane 12).
50
Results
The same DNA protocol was performed using S. aureus cells instead of E. coli cells,
and the DNA was extracted, followed by PCR using the Pan and Gram-positive specific
primers in a duplex PCR. The sample types with positive amplifications were similar when
spiked with S. aureus and with E. coli (e.g. compare the DNA profiles in Figures 3.2 and
3.3).
Figure 3.3 shows the results using DNA extracted by the PCIA and DNAzol
methods. A 1029 bp band (obtained using Pan-specific primers of nf and NR) and a 336 bp
band (obtained using Gram-positive specific primers of f3p and NR) were expected from
positive DNA amplifications. The specific 1029 bp and 336 bp bands were observed in
PCIA-extracted CSF (lane 1) and SF (lane 3) samples, and also in DNAzol-extracted CSF
(lane 7), SF (lane 9), PF (lane 10) and water (lane 11) samples. The PCIA-extracted PF
(lane 4) and water (lane 5) samples had positive amplifications but only the 336 bp band
was observed. BCB samples extracted by both PCIA and DNAzol methods (lanes 2 and 8)
did not produce amplifications. The DNAzol extracted PF samples in lane 10 of Figures 3.2
and 3.3 produced weak bands.
51
Results
Phenol chloroform isoamyl-alcohol method of extraction
Lane 1: Cerebrospinal fluid sample, 1029 bp and 336 bp bands.
Lane 3: Synovial fluid sample, 1029 bp and 336 bp bands.
Lane 4: Peritoneal fluid sample, 336 bp band only.
Lane 5: Water sample, 336 bp band only.
DNAzol method of extraction
Lane 7: Cerebrospinal fluid sample, 1029 bp and 336 bp bands.
Lane 9: Synovial fluid sample, 1029 bp and 336 bp bands.
Lane 10: Peritoneal fluid sample, 1029 bp and 336 bp bands.
Lane 11: Water sample, 1029 bp and 336 bp bands.
52
Results
1 2 3 4 5 6 7 8 9 10 11 12
10 kbp
1031 bp 1029 bp
500 bp
336 bp
80 bp
extracted by the phenol chloroform isoamyl-alcohol and DNAzol methods.
The duplex Pan (nf and NR) and Gram-positive specific primer (f3p and
NR) sets were used.
53
Results
3.1.3 Choosing the Best Extraction Methods
DNA extraction methods for the 4 different sample types were determined using the
Complexity Ranking based on the qualitative analysis of the methods used, as well as the
presence or absence of amplified products from DNA amplification using the extracted
DNA. The DNA extraction methods selected for the different clinical samples are shown in
Table 3.2.
Table 3.2: List of DNA extraction methods selected for the different clinical samples.
Samples Methods chosen for each sample

Cerebrospinal fluid (CSF) Boiling
Blood culture bottle (BCB) Alkali heat-wash (AH)
Synovial fluid (SF) DNAzol
Peritoneal fluid (PF) Alkali heat-wash (AH)
As all the methods were suitable for CSF samples, the decision was made based on
the complexity ranking. The boiling method was chosen as the best method for use on CSF.
For BCB samples, only the AH method was found to be effective for DNA
extraction and removal of inhibitors. The AH method was chosen as the best method to
extract DNA from BCB samples.
SF samples were properly extracted by PCIA and DNAzol methods, and the best
choice among the two was made based on the complexity ranking. The DNAzol method
was therefore chosen as the best method to isolate DNA and remove impurities from the SF
samples.
The DNA in PF samples could be isolated using the AH, PCIA and DNAzol
methods and based on the complexity ranking, the AH method was chosen as the best
method to extract DNA from PF samples.
54
Results
3.1.4 Lowest Detection Limit (CFU/ml) of the Extraction Methods
The lowest detection limit (CFU/ml) of the extraction method is the minimum
number of bacterial cells present in a sample (prior to extraction) that is needed to produce
amplifiable DNA. The detection limit was evaluated using a series of dilutions of S. aureus
and E. coli cells. A series of 1x101 CFU/ml to 1x106 CFU/ml of cells were added to the
samples, extracted, and the amplified DNA was observed. Two bands -1029 bp and 336 bp
-are expected from samples containing S. aureus and only the 1029 bp band is expected
from samples containing E. coli.
Figure 3.4 shows the results of DNA amplification using Pan and Gram-positive
specific primers with DNA extracted by the AH method from a spiked PF sample. The
specific 1029 bp and 336 bp amplified bands were present in samples containing 1x106
CFU/ml (lane 1), 1x105 CFU/ml (lane 2), 1x104 CFU/ml (lane 3), and 1x103 CFU/ml (lane
4) of S. aureus cells. The specific 1029 bp band was observed in samples containing 1x106
CFU/ml (lane 6), 1x105 CFU/ml (lane 7), 1x104 CFU/ml (lane 8), and 1x103 CFU/ml (lane
9) of E. coli cells. (Note: the 1x101 CFU/ml and 1x102 CFU/ml samples did not have any
bands and were excluded from the Figure). There was no amplified product in the lane
containing the DNA blank (lane 10).
Lanes 4 and 9 showed the faintest detectable bands and correspond to a minimum of
1x103 CFU/ml needed for positive DNA amplifications from both Gram-positive (S.
aureus) and Gram-negative (E. coli) organisms. Therefore, the lowest detection limit for the
AH method of extraction on PF was found to be 1x103 CFU/ml.
The boiling method on the CSF sample, the DNAzol method on the SF sample and
the AH method on the BCB sample also showed the lowest detection limit to be 1x103
CFU/ml.
55
Results
Lanes with a dilution series of Staphylococcus aureus added prior to extraction:-
Lane 1: 1x106 CFU/ml, 1029 bp and 336 bp bands.
Lane 4: 1x103 CFU/ml, 1029 bp and 336 bp bands (faintly visible).
Lanes with a dilution series of Escherichia coli added prior to extraction:-
Lane 6: 1x106 CFU/ml, 1029 bp band.
Lane 7: 1x105CFU/ml, 1029 bp band.
Lane 8: 1x104 CFU/ml, 1029 bp band.
Lane 9: 1x103 CFU/ml, 1029 bp band (faintly visible).
56
Results
Results
1 2 3 4 5 6 7 8 9 10
10 kbp
1031 bp
1029 bp
500 bp
336 bp
80 bp
Figure 3.4: Gel electrophoresis of PCR products using the duplex Pan (nf
and NR) and Gram-positive specific primer (f3p and NR) sets to determine
the lowest detection limit (Colony Forming Unit/ml) for the alkali heat-
wash method on peritoneal fluid.
57
Results
3.2 PCR Optimisation
PCR optimisation was carried out by evaluation of a single PCR condition while the
other conditions were kept constant. The presence of a specific amplified band after PCR
indicated successful amplification of the target DNA.
3.2.1 Optimisation of Annealing Temperature
The annealing temperature (Ta) of a PCR reaction is usually 5°C less than the
melting temperature of the primers used and occasionally a compromise was made between
the Ta of the two primers. A difference of less than 5°C between the Tm and Ta results in
stringent conditions that may impair the PCR. Annealing temperatures lower than those
calculated for each PCR may not be stringent enough, thus resulting in the amplification of
non-specific bands.
Optimisation of the annealing temperature for the Gram-positive specific PCR is
shown in Figure 3.5. The Ta tested was at 61, 62, 63 and 64°C. Each set contained
templates with standard amounts of S. aureus DNA as the positive control, E. coli DNA as
the negative control and a DNA blank where no template DNA was added.
The negative control with E. coli DNA (lanes 1, 4, 8 and 11) and the DNA blanks
(lanes 3, 6, 10 and 13) did not yield any products. The PCR mixtures containing S. aureus
template DNA showed amplification of the 336 bp product (lanes 2, 5, 9 and 12). Results
for comparison of annealing temperatures were mostly similar, with Ta=64°C having the
faintest bands. The Ta at 63°C was chosen as the Ta for the Gram-positive specific PCR as
a distinct amplified product was observed.
The annealing temperatures for the other DNA amplification protocols were
evaluated in a similar way. The Ta at 63°C also gave the most optimal results for the Gram-
negative specific primers.
58
Results
Annealing temperature, Ta=61°C
Lane 1: 100 pg of E. coli DNA (negative control), no amplified product.
Lane 2: 100 pg of S. aureus DNA (positive control), 336 bp band.
Lane 12: 100 pg of S. aureus DNA (positive control), 336 bp band (faintly visible).
59
Results
1 2 3 4 5 6 7 8 9 10 11 12 13
10 kbp
1031 bp
500 bp
336 bp
80 bp
Figure 3.5: Optimisation of the Gram-positive specific PCR using
different annealing temperatures. DNA from Staphylococcus aureus and
Escherichia coli were used as positive and negative controls respectively.
60
Results
3.2.2 Optimisation for the Number of PCR Cycles
The number of PCR cycles was initially carried out using 30 cycles. The Gram-
negative specific PCR, however, constantly produced a 554 bp amplified product in the
DNA blank despite increasing the stringency of other conditions. This non-specific
amplification was corrected by progressively reducing the number of cycles in the thermal
profile until it was only 26 cycles. Decreasing the cycle number to 26 for the Gram-positive
specific PCR was counter-productive as no bands appeared in the positive control, despite
being present after 30 cycles. For that reason, PCR involving Gram-positive and Gram-
negative specific primers in monoplex were initially optimised using different cycles, 26,
27, and 28 cycles, (Figures 3.6 and 3.7) to prepare for multiplex optimisation. Each set of
reactions had 3 tubes, each respectively containing DNA template in standard amounts of S.
aureus and E. coli DNA and a DNA blank.
In Figures 3.6 and 3.7, the Gram-negative specific PCR produced a 554 bp
amplified product in each reaction containing E. coli DNA as positive control (Figure 3.6,
lane 5; Figure 3.7, lanes 4 and 11), and none from reactions containing the negative control
of S. aureus DNA (Figure 3.6, lane 6; Figure 3.7, lanes 5 and 12) or the DNA blanks
(Figure 3.6, lane 7; Figure 3.7, lanes 6 and 13). Likewise, the Gram-positive specific PCR
produced a 336 bp amplicon in each reaction containing S. aureus DNA as positive control
(Figure 3.6, lane 3; Figure 3.7, lanes 2 and 9), and none in reactions containing the negative
control of E. coli DNA (Figure 3.6, lane 2; Figure 3.7, lanes 1 and 8) or the DNA blanks
(Figure 3.6, lane 4; Figure 3.7, lanes 3 and 10). However, the 336 bp bands obtained in the
PCRs at 26 (Figure 3.6, lane 3) and 27 (Figure 3.7, lane 2) cycles were faint in intensity.
When DNA amplification using the Gram-positive and Gram-negative primers was
carried out for 28 cycles, both the 336 bp band (Figure 3.7, Lane 9) and 554 bp band
(Figure 3.7, lane 11) were distinctly observed. Thus, the 28 cycle reaction was considered
the most optimal number of cycles.
61
Results
Results
1 2 3 4 5 6 7
10 kbp
1031 bp
554 bp
500 bp
336 bp
80 bp
Figure 3.6: Optimisation of DNA amplification for Gram-positive and Gram-

negative specific primers using 26 cycles of PCR. DNA from Escherichia coli
and Staphylococcus aureus were used as controls.
Lane 1: Massruler DNA ladder (Mix).
Gram-positive specific primers
Lane 2: 100 pg E. coli DNA (negative control), no amplified product.
Lane 3: 100 pg S. aureus DNA (positive control), 336 bp band (faintly visible).
Gram-negative specific primers
Lane 5: 100 pg E. coli DNA (positive control), 554 bp band.
Lane 6: 100 pg S. aureus DNA (negative control), no amplified product.
62
Results
27 cycles of PCR
Lane 2: 100 pg of S. aureus DNA (positive control), 336 bp band (faintly visible).
Lane 4: 100 pg of E. coli DNA (positive control), 554 bp band.
Lane 5: 100 pg of S. aureus DNA (negative control), no amplified product.
28 cycles of PCR
Lane 11: 100 pg of E. coli DNA (positive control), 554 bp band.
Lane 12: 100 pg of S. aureus DNA (negative control), no amplified product.
63
Results
1 2 3 4 5 6 7 8 9 10 11 12 13
10 kbp
1031 bp
500 bp 554 bp
336 bp
80 bp
Figure 3.7: Optimisation of DNA amplification for Gram-positive and
Gram-negative specific primers using 27 and 28 cycles of PCR. DNA from
Escherichia coli and Staphylococcus aureus were used as controls.
64
Results
3.2.3 Optimisation of MgCl2 and Taq Polymerase Concentrations
The MgCl2 and Taq polymerase concentrations were evaluated simultaneously. In
Figures 3.8, 3.9 and 3.10, a multiplex PCR, containing Pan, Gram-positive and Gram-
negative specific primers, was optimised for MgCl2 and Taq polymerase concentrations. A
series of Taq polymerase at 0.6, 0.8 and 1.0 Units were compared against a series of MgCl2
concentrations of 1.6, 2.0, 2.4 and 2.8 mM. Each of the evaluation sets consisted of E. coli,
and S. aureus DNA as controls and a DNA blank. The expected results are a 554 bp and a
1029 bp band for reactions containing E. coli DNA, and a 336 bp and 1029 bp band for
reactions containing S. aureus DNA.
However, a 554 bp band appeared in reactions containing S. aureus (Figures 3.8,
lanes 2, 5, 9 and 12; Figure 3.9, lanes 2, 5, and 12; and Figure 3.10, lanes 5, 9, and 12). No
bands were observed in the DNA blanks where no DNA template were added (Figures 3.8-
3.10, lanes 3, 6, 10 and 13).
Figure 3.8 shows the results of DNA amplifications of the multiplex PCR using 0.6
units of Taq polymerase and various concentrations of MgCl2. In DNA amplifications using
2.4 (lanes 8 and 9) and 2.8 mM (lanes 11 and 12) of MgCl2, the 1029 bp bands were absent,
but the 554 bp band was present in lanes containing E. coli DNA (lanes 8 and 11), and the
336 bp band faintly visible in lanes containing S. aureus DNA (lanes 9 and 12).
Amplifications using 1.6 mM of MgCl2 with E. coli DNA showed distinct 1029 bp and 554
bp bands (lane 1), but the amplification using S. aureus DNA showed faintly visible 1029
bp and 336 bp bands (lane 2). The amplifications using 2.0 mM of MgCl2 produced the
1029 bp and 554 bp bands in the lane containing E. coli DNA(lane 4), and the 1029 bp and
336 bp bands in the lane containing S. aureus DNA(lane 5), but all the bands were faint in
intensity.
65
Results
1.6 mM MgCl2
Lane 1: 100 pg of E. coli DNA, 1029 bp and 554 bp bands.
Lane 2: 100 pg of S. aureus DNA, 1029 bp, 554 bp and 336 bp bands (faintly visible).
2.0 mM MgCl2
Lane 4: 100 pg of E. coli DNA, 1029 bp and 554 bp bands (faintly visible).
Lane 5: 100 pg of S. aureus DNA, 1029 bp, 554 bp and 336 bp bands (faintly visible).
2.4 mM MgCl2
Lane 8: 100 pg of E. coli DNA, 554 bp band.
Lane 9: 100 pg of S. aureus DNA, 554 bp and 336 bp bands (faintly visible).
2.8 mM MgCl2
66
Results
1 2 3 4 5 6 7 8 9 10 11 12 13
10 kbp
1031 bp 1029 bp
500 bp 554 bp
336 bp
80 bp
Figure 3.8: Optimisation of DNA amplification protocols for Pan, Gram-
positive and Gram-negative specific primers using 0.6 units of Taq
polymerase and various concentrations of MgCl2. DNA from Escherichia
coli and Staphylococcus aureus were used as controls.
67
Results
1.6 mM MgCl2
Lane 2: 100 pg of S. aureus DNA, 1029 bp, 554 bp and 336 bp bands.
2.0 mM MgCl2
2.4 mM MgCl2
Lane 9: 100 pg of S. aureus DNA, no amplified product.
2.8 mM MgCl2
68
Results
1 2 3 4 5 6 7 8 9 10 11 12 13
10 kbp
1031 bp 1029 bp
554 bp
500 bp
336 bp
80 bp
69
Results
1.6 mM MgCl2
Lane 1: 100 pg of E. coli DNA, no amplified product.
Lane 2: 100 pg of S. aureus DNA, no amplified product.
2.0 mM MgCl2
Lane 4: 100 pg of E. coli DNA, ≈3000 bp, 1029 bp and 554 bp bands.
2.4 mM MgCl2
Lane 8: 100 pg of E. coli DNA, 1029 bp and 554 bp bands (faintly visible).
2.8 mM MgCl2
70
Results
1 2 3 4 5 6 7 8 9 10 11 12 13
10 kbp
1031 bp 1029 bp
500 bp 554 bp
336 bp
80 bp
71
Results
Figure 3.9 shows the results of DNA amplifications of the multiplex PCR using 0.8
units of Taq polymerase and various concentrations of MgCl2. Amplifications using 1.6
(lanes 1 and 2) and 2.0 mM (lanes 4 and 5) of MgCl2 had the expected 1029 bp and 554 bp
bands in lanes containing E. coli DNA (lanes 1 and 4), and the 1029 bp and 336 bp bands in
lanes containing S. aureus DNA (lanes 2 and 5). For the amplifications using 2.4 mM of
MgCl2, the 1029 bp and 554 bp bands were present in the lane containing E. coli DNA (lane
8) but no bands were amplified in the lane containing S. aureus DNA(lane 9). For the
amplifications using 2.8 mM of MgCl2, the 336 bp band was only faintly visible in the lane
containing the S. aureus DNA (lane 12), and the 554 bp band was strongly amplified in the
lane containing E. coli DNA (lane 11), but the expected 1029 bp band was not present in
both lanes.
Figure 3.10 shows the results of DNA amplifications of the multiplex PCR using
1.0 units of Taq polymerase and various concentrations of MgCl2. No amplified products
were obtained when 1.6 mM of MgCl2 was used (lanes 1 and 2). Amplifications using 2.0
mM MgCl2 had distinct 1029 bp and 554 bp bands in the lane containing E. coli DNA (lane
4), but a 3000+ bp non-specific band was also present. The lane containing S. aureus DNA
for the 2.0 mM MgCl2 concentration had 1029 bp and 336 bp bands (lane 5). The S. aureus
DNA template obtained 1029 bp and 336 bp bands using 2.4 mM of MgCl2 (lane 9), but the
amplification using E. coli template had 1029 bp and 554 bp bands that were faint in
intensity (lane 8). The 2.8 mM MgCl2 amplification had visible 1029 bp and 554 bp bands
in the lane containing E. coli DNA (lane 11), and 1029 bp and 336 bp bands in the lane
containing S. aureus DNA (lane 12).
72
Results
Thus, on analysis of the protocols using different Taq polymerase and MgCl2
concentrations, there were three reaction sets that produced distinct amplified bands, the
reactions containing 1.6 mM (Figure 3.9, lanes 1 and 2) and 2.0 mM (Figure 3.9, lanes 4
and 5) MgCl2 with 0.8 Units of Taq polymerase, and the reactions containing 2.8 mM
MgCl2 with 1.0 Unit of Taq polymerase (Figure 3.10, lanes 12 and 13). The set containing
1.0 Unit of Taq polymerase (Figure 3.10, lanes 12 and 13) used more consumables
compared to the 0.8 Unit sets (Figure 3.9) and had a similar outcome, thus, the 1.0 unit
concentration was not chosen for future experiments due to the higher costs. From the
remaining two sets, the PCR protocol requiring 1.6 mM of MgCl2 was not considered as it
had a slight smearing in the lane containing E. coli DNA (Figure 3.9, lane 1).
Thus, the 2.0 mM MgCl2 and 0.8 Units of Taq polymerase (Figure 3.9, lanes 4 and
5) were selected as the optimal concentrations to be used for the Pan, Gram-positive and
Gram-negative specific multiplex, and also in the duplex of Pan and Gram-positive specific
primers. This optimisation strategy was repeated in determining the Taq polymerase and
MgCl2 concentrations in the other PCR reactions.
73
Results
3.2.4 Optimisation of Primer Concentration
The concentrations of the various primers in the Pan and Gram-positive specific
duplex PCR were determined by first varying the concentrations of the nf and NR primers,
followed by the concentration of the f3p primer. Each set of reactions contained the DNA
templates of S. aureus and E. coli DNA as positive and negative controls. In addition, a
DNA blank with no addition of DNA was included to check for DNA contamination. The
expected results were a 1029 bp band and a 336 bp band in lanes from PCR reactions
containing S. aureus DNA. Lanes with E. coli DNA were expected to amplify only the 1029
bp Pan specific amplified product.
Figures 3.11 and 3.12 show the results from DNA amplifications using varying
concentrations of nf and NR primers. The Pan and Gram-positive specific duplex PCR
produced a 1029 bp amplified product in each reaction containing E. coli DNA (Figures
3.11 and 3.12, lanes 1, 4, 8, and 11). The expected 1029 bp and 336 bp bands were present
in lanes containing S. aureus (Figures 3.11 and 3.12, lanes 2, 5, 9, and 12). However, the
1029 bp band amplified from S. aureus DNA in lanes 2 and 12 of Figure 3.11 were faint in
intensity. All lanes with the DNA blanks did not show any amplified bands (Figures 3.11
and 3.12, lanes 3, 6, 10 and 13).
Results from all eight optimisation reactions showed the expected bands but with
varying intensities of the amplified DNA. A non-specific band of 700+ bp was present in
the lanes amplified with S. aureus DNA (Figures 3.11 and 3.12, lanes 2, 5, 9 and 12). This
non-specific band was not present when the Pan (Figure 3.14, Lanes 7-11) and Gram-
positive (Figure 3.7, lane 9) specific primers were in monoplex reactions.
74
Results
0.1 µM nf, 0.2 µM NR
Lane 2: 100 pg of S. aureus DNA, 1029 bp (faintly visible) and 336 bp bands.
Lane 5: 100 pg of S. aureus DNA, 1029 bp and 336 bp bands.
75
Results
Results
1 2 3 4 5 6 7 8 9 10 11 12 13
10 kbp
1031 bp 1029 bp
Non-specific
band
500 bp
336 bp
80 bp
Figure 3.11: Optimisation of DNA amplification for Pan and Gram-
positive specific primers using different nf and NR primer concentrations.
DNA from Escherichia coli and Staphylococcus aureus were used as
controls.
76
Results
77
Results
Results
1 2 3 4 5 6 7 8 9 10 11 12 13
10 kbp
1031 bp 1029 bp
Non-specific
500 bp band
336 bp
80 bp
positive specific primers using different nf and NR primer concentrations.
DNA from Escherichia coli and Staphylococcus aureus were used as
controls.
78
Results
The 0.2 µM nf and 0.4 µM NR primer concentration set (Figure 3.12, lanes 1 and 2)
was chosen as it had the most distinct 336 bp band, and the 1029 bp band in the lane
containing E. coli and S. aureus DNA were almost equal in intensity and had the least
amount of smearing.
Next, an attempt was made to remove the presence of the 700+ non-specific band by
comparing a series of concentrations of f3p primers (Figure 3.13) with the primer
concentrations for nf and NR at 0.2 µM and 0.4 µM respectively.
Figure 3.13 shows the results from DNA amplifications using varying
concentrations of the f3p primer. The Pan and Gram-positive specific duplex PCR produced
a 1029 bp amplified product in each reaction containing E. coli DNA (lanes 1, 4, 8, and 11)
and the expected 1029 bp and 336 bp bands in lanes containing S. aureus DNA (lanes 2, 5,
9, and 12). All lanes containing the DNA blanks did not show any amplified bands (lanes 3,
6, 10 and 13). The sets containing S. aureus DNA with 0.2 µM (lane 5), 0.3 µM (lane 9),
and 0.4 µM (lane 12) of f3p still amplified the 700+ bp non-specific band. The non-specific
band was not present in the reaction containing 0.1 µM of f3p (lane 2). In addition, the 1029
bp amplified product was distinct when the f3p primer was used at 0.1 µM (lanes 1 and 2).
The primer concentrations chosen for nf, p3f and NR in the Pan and Gram-positive
specific duplex were 0.2 µM, 0.1 µM and 0.4 µM respectively. Determination for primer
concentrations in other reactions was conducted in a similar manner.
79
Results
0.1 µM f3p
0.2 µM f3p
0.3 µM f3p
0.4 µM f3p
80
Results
1 2 3 4 5 6 7 8 9 10 11 12 13
10 kbp
1031 bp 1029 bp
Non-specific
500 bp band
336 bp
80 bp
positive specific primers using different f3p primer concentrations. DNA
from Escherichia coli and Staphylococcus aureus were used as controls.
81
Results
3.2.5 Multiplex Optimisation
The PCR reactions were at first set up as single PCR reactions with just one primer
pair per reaction. The conditions of each of the monoplexes were adjusted to be as similar
as possible, in order to make manipulation easier when converted to multiplex. The primers
of the Pan, Gram-positive and Gram-negative specific PCR reactions were then added
together in stages to form a multiplex.
Only the Pan and Gram-positive specific primers were successfully included in a
duplex PCR reaction. Attempts at including the Gram-negative primers into a multiplex
with the other primers failed, as the PCR using S. aureus (a Gram-positive organism) DNA
constantly produced the 554 bp bands in areas targeted by Gram-negative primers (e.g.
Figures 3.8, lanes 2, 5, 9 and 12; Figure 3.9, lanes 2, 5, and 12; and Figure 3.10, lanes 5, 9,
and 12). Despite making the conditions more stringent, this non-specific amplification was
still present.
Because the results were not specific in the multiplex, the Gram-negative specific
primers were separated from the Gram-positive and Pan specific primers. When attempting
to include the Gram-negative and Pan specific primers into the same reaction, non-specific
amplification occurred.
To determine the Gram-typing for bacteria, both the duplex of Pan and Gram-
positive specific reactions and a monoplex of Gram-negative reaction were run concurrently
in separate tubes.
82
Results
3.3 Optimisation of PCR Mixtures and Thermal Profiles
3.3.1 Gram-positive Specific PCR
The optimized monoplex for the Gram-positive specific DNA amplification consists
of 10x buffer, 200 µM dNTPs, 0.2 µM each of primers NR and f3p, 1.5 mM MgCl2, 0.5
Units Taq polymerase, 100 pg DNA template, and sterile double-distilled water to make up
a total volume of 25 µl per reaction tube (Table 3.3). The reaction was subjected to an
initial denaturation cycle at 94°C for 5 min; 26 cycles of denaturation at 94°C for 30s,
annealing at 63°C for 30s and extension at 72°C for 1 min 20s. A further extension of 72°C
for 4 min was then carried out (Table 3.3). The thermal cycler was programmed to be at
20°C for 2 hours after DNA amplification was completed. The PCR tubes were removed
and kept at 4°C before the 2 hour time interval ended.
Table 3.3: The PCR mixture and thermal profile for the Gram-positive specific DNA
amplification.
PCR mixture for Gram- Thermal profile for Gram-

positive specific DNA positive specific DNA
amplification amplification
Final
Components Conc. Temp Time Cyling
10X buffer 1x 94°C 5 min 1x
dNTPs 200 µM 94°C 30s
Primer NR 0.2 µM 63°C 30s 26x
Primer f3p 0.2 µM 72°C 1 min 20s
MgCl2 1.5 mM 72°C 4 min 1x
Taq polymerase 0.5 Units 20°C 2 hours 1x
Total Vol 25 µl
83
Results
3.3.2 Pan-bacterial Specific PCR
The optimized monoplex for the Pan-bacterial specific DNA amplification (Table
3.4) consists of 10x buffer, 200 µM dNTPs, 0.4 µM each of primers NR and nf, 1.5 mM
MgCl2, 1 Unit Taq polymerase, 100 pg DNA template, and sterile double-distilled water to
make up a total volume of 25 µl per reaction tube (Table 3.4) The reaction was subjected to
an initial denaturation cycle at 94°C for 5 min; 26 cycles denaturation at 94°C for 30s,
annealing at 63°C for 30s and extension at 72°C for 1 min 20s. A further extension of 72°C
for 4 min was then carried out (Table 3.4).
Table 3.4: The PCR mixture and thermal profile for the Pan-bacterial specific DNA
amplification.
PCR mixture for Pan specific Thermal profile for Pan

DNA amplification specific DNA amplification
Final
Primer nf 0.4 µM 72°C 1 min 20s
Taq polymerase 1 Unit 20°C 2 hours 1x
Total Vol 25 µl
84
Results
3.3.3 Pan and Gram-positive Specific Duplex PCR
The optimized duplex PCR for the Pan and Gram-positive specific DNA
amplification consists of 10x buffer, 200 µM dNTPs, 0.4 µM primer NR, 0.1 µM primer
f3p, 0.2 µM primer nf, 2.0 mM MgCl2, 0.8 Units Taq polymerase, 100 pg DNA template,
and sterile double-distilled water to make up a total volume of 25 µl per reaction tube
(Table 3.5). The reaction was subjected to an initial denaturation cycle at 94°C for 5 min;
26 cycles of denaturation at 94°C for 30s, annealing at 63°C for 30s and extension at 72°C
for 1 min 20s. A further extension of 72°C for 4 min was then carried out (Table 3.5).
Table 3.5: The PCR mixture and thermal profile for the Pan and Gram-positive specific
primers in a Duplex PCR.
PCR mixture for Pan and Thermal profile for Pan and
Gram-positive specific Gram-positive specific
primers (Duplex PCR) primers (Duplex PCR)
Final
Primer f3p 0.1 µM 72°C 1 min 20s
Primer nf 0.2 µM 72°C 4 min 1x
MgCl2 2.0 mM 20°C 2 hours 1x
Taq polymerase 0.8 Unit
Total Vol 25 µl
85
Results
3.3.4 Gram-negative Specific PCR
The optimized monoplex for the Gram-negative specific DNA amplification
consists of 10x buffer, 200 µM dNTPs, 0.1 µM each of primers r18n and f4n, 1.5 mM
MgCl2, 0.5 Units Taq polymerase, 100 pg DNA template, and sterile double-distilled water
to make up a total volume of 25 µl per reaction tube (Table 3.6). The reaction was
subjected to an initial denaturation cycle at 94°C for 5 min; 26 cycles of denaturation at
94°C for 30s, annealing at 63°C for 30s and extension at 72°C for 1 min 20s. A further
extension of 72°C for 4 min was then carried out (Table 3.6).
Table 3.6: The PCR mixture and thermal profile for the Gram-negative specific DNA
amplification.
PCR mixture for Gram- Thermal profile for Gram-

negative specific DNA negative specific DNA
amplification amplification
Final
Primer r18n 0.1 µM 63°C 30s 26x
Primer f4n 0.1 µM 72°C 1 min 20s
Taq polymerase 0.5 Unit 20°C 2 hours 1x
Total Vol 25 µl
86
Results
3.4 PCR Sensitivity
The sensitivity of each of the PCR reactions was determined by subjecting each of
them to a series of increasingly diluted DNA templates during DNA amplification. The
minimum template concentration needed to produce an amplified product was considered to
be the lowest detection limit of the PCR. Both E. coli and S. aureus DNA were separately
used as templates, to represent Gram-negative and Gram-positive organisms respectively.
Figure 3.14 shows the results of DNA amplification using the Pan specific primers.
A specific 1029 bp band was expected and this was observed in the lanes containing 10 ng
(lane 1), 1 ng (lane 2), 100 pg (lane 3), 10 pg (lane 4) and 1 pg (lane 5) of E. coli DNA, and
lanes containing 10 ng (lane 7), 1 ng (lane 8), 100 pg (lane 9), 10 pg (lane 10) and 1 pg
(lane 11) of S. aureus DNA. DNA amplification using 1 pg of DNA (lanes 5 and 11)
produced faint bands. No bands were observed in lane 12, where DNA template was not
added (DNA blank). The lowest detection limit was 1 pg of both E. coli and S. aureus DNA
for the Pan specific PCR.
Figure 3.15 shows the results of DNA amplification using the Pan and Gram-
positive specific primers in a duplex with different E. coli DNA concentrations. A specific
1029 bp band was expected and this was observed in the lanes containing 10 ng (lane 1), 1
ng (lane 2), 100 pg (lane 3), and 10 pg (lane 4) of E. coli DNA. DNA amplification using
10 pg of DNA (lane 4) produced a faint band. No bands were observed in lanes containing 1
pg (lane 6), 100 fg (lane 7), 10 fg (lane 8) and in the DNA blank (lane 9). The lowest
detection limit was 10 pg of E. coli DNA for the Pan and Gram-positive specific duplex
PCR.
87
Results
Results
1 2 3 4 5 6 7 8 9 10 11 12
10 kbp
1031 bp 1029 bp
500 bp
80 bp
Figure 3.14: Gel electrophoresis of DNA products amplified using the Pan
specific primers with different DNA concentrations.
Escherichia coli DNA

Lane 1: 10 ng, 1029 bp band.
Lane 3: 100 pg, 1029 bp band.
Lane 5: 1 pg, 1029 bp band (faintly visible).
Staphylococcus aureus DNA

88
Results
Results
1 2 3 4 5 6 7 8 9
10 kbp
1031 bp 1029 bp
500 bp
80 bp
and Gram-positive specific primers in a duplex PCR with different
Escherichia coli DNA concentrations.
Lane 1: Massruler DNA ladder (Mix).
E. coli DNA
Lane 6: 1 pg, no amplified product.
Lane 7: 100 fg, no amplified product.
89
Results
positive specific primers in a duplex with S. aureus DNA. Specific 1029 bp and 335 bp
bands were expected and this was observed in the lanes containing 10 ng (lane 2) and 1 ng
(lane 3) of S. aureus DNA. DNA amplification using 100 pg (lane 4) and 10 pg (lane 5) of
DNA only had the 336 bp band. No bands were observed in lanes containing 1 pg (lane 6)
and in the DNA blank (lane 7). The lowest detection limit was 10 pg of S. aureus DNA for
the Gram-positive specific primers and 1 ng for the Pan specific primers in the duplex PCR.
Figure 3.17 shows the results of DNA amplification using the Gram-negative
specific primers with different E. coli DNA concentrations. A specific 554 bp band was
expected and this was observed in the lanes containing 10 ng (lane 2), 1 ng (lane 3), 100 pg
(lane 4), and 10 pg (lane 5) of E. coli DNA. No bands were observed in lanes containing 1
pg (lane 6), 100 fg (lane 7), 10 fg (lane 8) and in the DNA blank (lane 9). The lowest
detection limit was 10 pg of E. coli DNA for the Gram-negative specific monoplex PCR.
90
Results
Results
1 2 3 4 5 6 7
10 kbp
1031 bp 1029 bp
500 bp
336 bp
80 bp
and Gram-positive specific primers in a duplex PCR with different
Staphylococcus aureus DNA concentrations.
S. aureus DNA
Lane 2: 10 ng, 1029 bp and 336 bp bands.
Lane 3: 1 ng, 1029 bp and 336 bp bands.
Lane 4: 100 pg, 336 bp band only.
Lane 5: 10 pg, 336 bp band only.
91
Results
Results
1 2 3 4 5 6 7 8 9
10 kbp
1031 bp
500 bp 554 bp
80 bp
Figure 3.17: Gel electrophoresis of DNA products amplified using the

Gram-negative specific primers with different Escherichia coli DNA
concentrations.
E. coli DNA
92
Results
3.5 PCR Specificity
The PCR specificity in this study not only referred to the ability of the particular
PCR to amplify the proper target sequence, but also to its ability to infer the Gram-type of
the organism tested. In addition, DNA amplification should not occur with the negative
control DNA. DNA was extracted from a range of pure culture organisms of different
Gram-types (Table 3.7) and was used to test the specificity of the different PCRs. The list
of Gram-positive organisms includes two aerobic cocci - Staphylococcus aureus and
Enterococcus faecalis; and the aerobic rod of a Corynebacterium sp. The list of Gram-
negative organisms includes the aerobic cocci of Neisseria gonorrhoeae; the aerobic,
fastidious, glucose-nonfermenting rods of Haemophilus influenzae and Acinetobacter
baumanii; the glucose-fermenting, Enterobacteriaceae rods of Klebsiella pneumoniae,
Enterobacter sp., Escherichia coli, and Proteus sp.; and the glucose-nonfermenting rods of
Stenotrophonomas maltophilia. A fungal organism, Cryptococcus neoformans, was also
evaluated as a negative control (Table 3.7).
Pan specific primers should amplify a 1029 bp band in all bacteria but not in non-
bacterial organisms. Gram-negative specific primers should amplify a 554 bp band from
Gram-negative organisms only, and Gram-positive specific primers should amplify only a
336 bp band from Gram-positive organisms. If a 554 bp band was amplified from the
Gram-negative specific PCR, and only a 1029 bp band was amplified using the Pan specific
primers in the duplex PCR (with no 336 bp band amplified), it is expected that the DNA
template was from a Gram-negative organism. Likewise, if 1029 bp and 336 bp bands were
amplified by the Pan and Gram-positive specific PCR and no band was obtained by the
Gram-negative specific PCR, it is expected that the DNA template was from a Gram-
positive organism.
93
Table 3.7: The list of organisms used in this study confirmed by culture, Gram-stain, and
DNA amplification results.
Presence of PCR product
using:
Gram-type by
Lab Gram-type by Gram- Gram-
No. Organism Name Pan DNA
No. culture positive negative
specific amplification
specific specific
primers
primers primers
PC Staphylococcus Gram-type
1 √ X √
041 aureus Aerobic, Gram- positive
PC Enterococcus positive cocci Gram-type
2 √ X √
022 faecalis positive
Bacterial,
PC Corynebacterium Aerobic, Gram-
3 X X √ possible Gram-
024 sp. positive rods
type positive
PC Neisseria Aerobic, Gram- Gram-type
4 X √ √
021 gonorrhoeae negative cocci negative
PC Haemophilus Aerobic, fastidious, Gram-type
5 X √ √
017 influenzae glucose- negative
PC Acinetobacter nonfermenting, Gram-type
6 Gram-negative rods X √ √
032 baumannii negative
PC Klebsiella Gram-type
7 X √ √
018 pneumoniae negative
Glucose-
PC Gram-type
8 Enterobacter sp. fermenting, Gram- X √ √
014 negative
negative,
PC Enterobacteriaceae Gram-type
9 Escherichia coli X √ √
039 rods negative
PC Gram-type
10 Proteus sp. X √ √
015 negative
Glucose-
PC Stenotrophomonas Gram-type
11 nonfermenting, X √ √
016 maltophila negative
Gram-negative rods
PC Cryptococcus
12 Fungi X X X Non-bacterial
046 neoformans
Note: √ - indicates the presence of a PCR product, X - indicates the absence of a PCR product
94
Results
positive specific primers on DNA obtained from the various organisms. The 1029 bp Pan
specific band was observed in all the lanes containing bacteria (lanes 1-6 and 8-12), but not
in the lane containing fungal DNA (lane 13). The 336 bp Gram-positive specific band was
observed in the lanes containing S. aureus DNA (lane 1, faintly visible) and E. faecalis
(lane 2). DNA from the Gram-positive Corynebacterium sp. bacteria did not produce a 336
bp band. DNA from all the Gram-negative bacteria and from Cyptococcus neoformans also
did not produce the 336 bp band (lanes 4-13). The DNA blank, where no DNA was added
produced no bands (lane 14).
Figure 3.19 shows the results of DNA amplification using the Gram-negative
specific primers on DNA from the same range of organisms. The expected 554 bp specific
band was observed in lanes containing Gram-negative organisms (lanes 4-6 and 8-12). The
lanes containing DNA from Gram-positive organisms (lanes 1-3) and the fungal organism
(lane 13) had no amplified products. The DNA blank, where no DNA was added produced
no bands (lane 14).
The results of the PCR amplifications in Figures 2.18 and 2.19 are shown in Table
3.7. The DNA from the Gram-positive S. aureus (No. 1) and E. faecalis (No. 2) were
amplified by Pan and Gram-positive specific primers, but not by Gram-negative specific
primers. This inferred that the organisms in the pure culture were Gram-type positive, and
this concurred with the Gram-stain. The DNA from the aerobic, Gram-positive rod of
Corynebacterium sp. (No. 3) was not amplified by Gram-negative or Gram-positive
primers, but was amplifiable by Pan specific primers. The Gram-type of the organism could
not be positively determined by PCR, but the DNA likely originated from a bacterial
organism and was possibly a Gram-positive organism, as no DNA was amplified from the
Gram-negative specific PCR.

95
Results
1 2 3 4 5 6 7 8 9 10 11 12 13 14
10 kbp
1029 bp 1031 bp
500 bp
336 bp
80 bp
Figure 3.18: Gel electrophoresis of DNA products amplified using the Pan and
Gram-positive specific primers with template DNA from various Gram-positive and
Gram-negative organisms.
Lane 1: Staphylococcus aureus DNA, 1029 bp and 336 bp bands (faintly visible).
Lane 2: Enterococcus faecalis DNA, 1029 bp and 336 bp bands.
Lane 3: Corynebacterium sp. DNA, 1029 bp band only.
Lane 4: Neisseria gonorrhoeae DNA, 1029 bp band.
Lane 5: Haemophilus influenzae DNA, 1029 bp band.
Lane 6: Acinetobacter baumannii DNA, 1029 bp band.
Lane 8: Klebsiella pneumoniae DNA, 1029 bp band.
Lane 9: Enterobacter sp. DNA, 1029 bp band.
Lane 10: Escherichia coli DNA, 1029 bp band.
Lane 11: Proteus sp. DNA, 1029 bp band.
Lane 12: Stenotrophomonas maltophila DNA, 1029 bp band.
Lane 13: Cryptococcus neoformans DNA, no amplified product.
96
Results
1 2 3 4 5 6 7 8 9 10 11 12 13 14
10 kbp
1031 bp
500 bp 554 bp
80 bp
Figure 3.19: Gel electrophoresis of DNA products amplified using the Gram-
negative specific primers with template DNA from various Gram-positive and
Gram-negative organisms.
Lane 1: Staphylococcus aureus DNA, no amplified product.

Lane 2: Enterococcus faecalis DNA, no amplified product.
Lane 3: Corynebacterium sp. DNA, no amplified product.
Lane 4: Neisseria gonorrhoeae DNA, 554 bp band.
Lane 5: Haemophilus influenzae DNA, 554 bp band.
Lane 6: Acinetobacter baumannii DNA, 554 bp band.
Lane 8: Klebsiella pneumoniae DNA, 554 bp band.
Lane 9: Enterobacter sp. DNA, 554 bp band.
Lane 10: Escherichia coli DNA, 554 bp band.
Lane 11: Proteus sp. DNA, 554 bp band.
Lane 12: Stenotrophomonas maltophila DNA, 554 bp band.
Lane 13: Cryptococcus neoformans DNA, no amplified product.
97
Results
The DNA from the Gram-negative organisms of N. gonorrhoeae (No. 4), H.
influenzae (No. 5), A. baumanii (No. 6), K. pneumoniae (No. 7), Enterobacter sp. (No. 8),
E. coli (No. 9), Proteus sp. (No. 10), and S. maltophilia (No. 11) were found to be
amplifiable by Gram-negative and Pan specific primers, but not by Gram-positive primers
(Table 3.7). The results inferred that all these organisms were Gram-type negative, and this
concurred with the Gram-stain of the culture type.
The DNA from the negative control fungal organism of C. neoformans (No 12) did
not have any amplification from the Gram-negative specific PCR, and the Pan and Gram-
positive specific duplex. The results inferred that the organism was not of bacterial origin
and this concurred with the results of the culture type.
To summarize, the duplex PCR of Pan and Gram-positive specific primers and the
monoplex of Gram-negative specific primers were able to Gram-type the DNA extracted
from the pure culture samples in the study, except for one out of the 12 samples tested.
Specificity was high for the Pan-bacterial specific primers, with all the samples being
correctly identified. The Gram-positive specific primers were not able to correctly amplify
one Gram-positive organism – Corynebacterium sp. The PCR protocol should be repeated
with another pure culture of a Corynebacterium sp. to confirm PCR specificity. Gram-
negative specific primers amplified all DNA isolated from Gram-negative bacteria.
98
Results
3.6 Sequencing and Analyses of Pure Cultures
Sequencing was performed using pure cultures obtained from the Diagnostic
Microbiology Laboratory, UMMC (Section 2.1.2). The objective was to determine if
bacterial identification by analyses of sequencing results (Section 2.5.4) matched the
culture results, or to what extent they differed. As the sequencing initially involved the use
of DNA from known organisms (the pure culture samples), this gave baseline information
that was later useful when working with DNA from unknown organisms. Examples of
electropherograms from DNA sequencing of PCR products from pure culture samples can
be found in Appendix D. Results of BLAST and RDP-II SeqMatch analyses on the 16S
rDNA PCR sequences obtained from pure cultures are shown in Table 3.8 at the end of this
section.
3.6.1 Staphylococcus aureus
The DNA from the pure culture of Staphylococcus aureus (PC041) was found to
have a 99.7% similarity match with either S. aureus, or S. croceolyticus after a 293 bp
sequence was studied using BLAST analysis. Using the Classifier, the sequence was found
to belong 100% to the order Bacillales, with an 86% chance of belonging to the genus
Staphylococcus. Both the type options in SeqMatch showed a high clustering of results
within the species S. aureus. It is very likely then, that the DNA sequences found within
PC041 is that of Staphylococcus aureus.
3.6.2 Enterococcus faecalis
The sequenced 287 bp DNA from the Enterococcus faecalis (PC022) culture was
studied using BLAST analysis and found to be 99.7% similar to DNA from Enterococcus
99
Results
faecalis. The RDP-II Classifier found it to be probably (92%) of the genus Enterococcus
and definitely (100%) of the Order Lactobacillales. SeqMatch results showed only E.
faecalis as a possible organism with a similarity score of 0.965 but type-only analysis
included other species types but with a score below 0.920. Therefore, because of the high
clustering of the species in BLAST and RDP-II (type and non-type) analysis, it is very
likely that the DNA found in PC022 is that of E. faecalis. Identity by sequencing is similar
to that by culture.
3.6.3 Corynebacterium sp.
PC024 was found to be Corynebacterium sp. by culture. The sequenced DNA 740
bp fragment studied using BLAST analysis matched those of Corynebacterium jeikeium
with a 99.5% similarity. The RDP-II Classifier concurred with this analysis and the
sequence was found to be 100% in agreement with the genus Corynebacterium. The
similarity score using the SeqMatch was a little lower as it was only 0.908 for the species
Corynebacterium jeikeium. However, a high clustering of results for that species and a more
than 99% match using BLAST shows that DNA from PC024 is likely from C. jeikeium. The
result by sequencing provides identification to the species level.
3.6.4 Neisseria gonorrhoeae
The DNA from PC021 showed an across the board similarity with the species
Neisseria gonorrhoeae. It had a 100% similarity when the 484 bp sequence was studied
using BLAST analysis, and 1.000 similarity match using the RDP-II. It also had a full
match with the genus Neisseria. The organism was clearly identified by sequencing analysis
as N. gonorrhoeae and matches the identity obtained via culture.
100
Results
3.6.5 Haemophilus influenzae
The DNA from the Haemophilus influenzae culture (PC017) also showed an across
the board full match with BLAST and SeqMatch. However, the 498 bp sequence only had a
full match with the family Pasteurellaceae and a partial match (93%) to the genus
Haemophilus. Despite that, the full match identifies the DNA as belonging to the species H.
influenzae. The result is therefore similar to those determined by culture.
3.6.6 Acinetobacter baumanii
PC032 was identified as Acinetobacter baumanii by culture methods. Results from
BLAST analysis of the 506 bp sequenced showed a 100% similarity with either A.
baumanii or A. calcoaceticus. Classification using the RDP-II tool also showed a highly
probable (100%) match to the genus Acinetobacter. However, while SeqMatch showed a
0.992 match with A. baumanii and A. calcoaceticus, analysis using type strains only
included other species names belonging to the same genus but with a similarity score below
0.911, including the type strain of A. baumanii at 0.865. The clustering of results and
matches above 99% shows that PC032 is either A. baumanii or A. calcoaceticus.
3.6.7 Klebsiella pneumoniae
The DNA of Klebsiella pneumoniae (PC018) was sequenced and the 486 bp product
analysed by BLAST was found to be 100% similar to K. pneumoniae and Enterobacter
dissolvens. When analysed using the RDP-II Classifier, the sequence was shown to belong
100% to the genus Klebsiella. SeqMatch showed a 0.998 similarity score to K. pneumoniae
or E. dissolvens. PC018 is likely to be either K. pneumoniae or E. dissolvens.
101
Results
3.6.8 Enterobacter sp.
PC014 was identified as Enterobacter sp. by culture. When 504 bp of the sequenced
DNA from this sample was analysed by BLAST, it was found to have a 100% similarity
with several different types of species from the genus Enterobacter, namely Enterobacter
cancerogenus, E. aerogenes, E. ludwigii, E. intermedius (now belonging to the genus
Kluyvera), and E. agglomerans (now of the genus Pantoea), and a match to Kluyvera
cryocrescens. Classification on the RDP-II showed a full match with the family
Enterobacteriaceae and 94% match with the genus Enterobacter. Type and non-type
SeqMatch showed a full sequence match with E. cancerogenus, E. aerogenes and P.
agglomerans. Type-only SeqMatch showed similar results for the former two species along
with K. cryocrescens. PC014 is very likely from Enterobacter sp. as it showed a closer
match to the genus Enterobacter during classification, but P. agglomerans and K.
cryocrescens could not be excluded from the final diagnosis.
3.6.9 Escherichia coli
A similar situation was encountered with the culture Escherichia coli (PC039)
which showed full match with the family Enterobacteriaceae but only an 83% match with
the genus Escherichia. BLAST analysis of the 506 bp submitted showed a 100% similarity
with E. coli, E. fergusonii, Shigella boydii, S. flexneri., S. sonnei and Photorhabdus
luminescens. Type and non-type SeqMatch showed similar results at a 0.972 with S. boydii
showing 0.974. Analysis of type strains only had E. coli giving a score of 0.947 and S.
flexneri showing 0.972. The identity of the organism in PC039 could not be conclusively
determined by sequencing analysis.
102
Results
3.6.10 Proteus sp.
The DNA from the sample found to be Proteus sp. (PC015) was sequenced and
analysed and the 502 bp obtained was found to have a 99.8% similarity with Proteus
mirabilis and P. vulgaris. The Classifier concurred with this analysis and found a 100%
match with the genus Proteus. Sequence match had similar results with a score of 0.986 for
each species type. Therefore, the sample is of the genus Proteus and is either P. mirabilis or
P. vulgaris.
3.6.11 Stenotrophomonas maltophilia
The culture Stenotrophomonas maltophilia (PC016) was fully matched in sequence
analysis. The 501 bp sequence matched the genus Stenotrophomonas at 100%. PC016 is
therefore that of S. maltophilia and the result is similar to the culture results.
3.6.12 Summary of Section 3.6
There was some difficulty speciating the family Enterobacteriaceae e.g. those
identified by culture as Escherichia coli, Enterobacter sp., Klebsiella pneumoniae and
Proteus sp. Of the 12 clinical isolates identified by standard bacterial methods used in the
routine diagnostic laboratory, nine were similarly identified by DNA sequencing analysis.
The remaining three were identified to the family level with the species identified by culture
(E. coli, K. pneumoniae and Enterobacter sp.) included as high probability sequence
matches.
103
Table 3.8: The results of BLAST and RDP-II SeqMatch analyses on 16S rDNA sequences obtained from the DNA sequencing of pure
cultures.
BLAST Results RDP-II Sequence Match
Lab
No bp Culture Results % Similarity Similarity Possible Organism
No Organism Name Type & Non-type Type only
similarity Score Score
Staphylococcus
aureus Staphylococcus
PC Staphylococcus Staphylococcus Staphylococcus
1 293 99.7 aureus subsp. 0.953 0.929
041 aureus Staphylococcus aureus aureus
aureus
croceolyticus
Enterococcus
0.913
faecalis
Enterococcus
0.920
haemoperoxidus
PC Enterococcus Enterococcus Enterococcus Enterococcus
2 287 99.7 0.965 Desemzia incerta 0.916
022 faecalis faecalis faecalis faecalis
Enterococcus
0.916
moraviensis
Enterococcus
0.913
dispar
PC Corynebacterium Corynebacterium Corynebacterium Corynebacterium Corynebacterium

3 740 99.5 0.908 0.908
024 sp. jeikeium jeikeium jeikeium jeikeium
PC Neisseria Neisseria Neisseria Neisseria Neisseria

4 484 100.0 1.000 1.000
021 gonorrhoeae gonorrhoeae gonorrhoeae gonorrhoeae gonorrhoeae
PC Haemophilus Haemophilus Haemophilus Haemophilus Haemophilus

5 498 100.0 1.000 0.960
017 influenzae influenzae influenzae influenzae influenzae
104
cultures.
Lab
Acinetobacter
0.865
Acinetobacter Acinetobacter baumannii
baumannii baumannii Acinetobacter
0.992
calcoaceticus
PC Acinetobacter Acinetobacter
6 506 100.0 0.992 0.911 Acinetobacter sp.
032 baumanii lwoffii
Acinetobacter Acinetobacter Acinetobacter
0.901
calcoaceticus calcoaceticus ursingii
Acinetobacter
0.875
radioresistens
Klebsiella Klebsiella Klebsiella Klebsiella
PC Klebsiella pneumoniae pneumoniae pneumoniae pneumoniae or
7 486 100.0 0.998 0.998
018 pneumoniae Enterobacter Enterobacter Enterobacter Enterobacter
dissolvens dissolvens dissolvens dissolvens
Enterobacter
cancerogenus,
E. aerogenes, Enterobacter Enterobacter
Enterobacter sp.,
E. ludwigii, cancerogenus cancerogenus
Kluyvera
PC E. agglomerans,
8 504 Enterobacter sp. 100.0 1.000 1.000 cryocrescens or
014 E. intermedius
Pantoea
Kluyvera Enterobacter Enterobacter agglomerans
cryocrescens aerogenes aerogenes
Pantoea Pantoea Kluyvera
agglomerans agglomerans cryocrescens
105
cultures.
Lab
Escherichia coli Escherichia coli 0.972

Escherichia Escherichia
0.972 Escherichia coli 0.947
fergusonii fergusonii
Escherichia coli,
PC Shigella boydii Shigella boydii 0.974 Shigella sp. or
9 506 Escherichia coli 100
039 Photorhabdus
Shigella flexneri Shigella flexneri 0.972
luminescens
Shigella sonnei Shigella sonnei 0.972 Shigella flexneri 0.972
Photorhabdus Photorhabdus
0.972
luminescens luminescens
PC Proteus mirabilis Proteus mirabilis Proteus mirabilis 0.986

10 502 Proteus sp. 99.8 0.986 Proteus sp.
015 Proteus vulgaris Proteus vulgaris Proteus vulgaris 0.918
PC Stenotrophomonas Stenotrophomonas Stenotrophomonas Stenotrophomonas Stenotrophomonas

11 501 100 1.000 0.992
016 maltophilia maltophilia maltophilia maltophilia maltophilia
106
Results
PHASE II: Screening of Clinical Samples
3.7 Collection of Samples
Different types of clinical specimens were collected from the Microbiological
Diagnostic Laboratory, UMMC to determine the ability of the optimised broad-range PCR
in determining the presence of bacterial DNA.
Four different clinical sample types were collected i.e. CSF, PF, SF, and the
peripheral venous blood in BCB samples (Section 2.1.4). Both culture-positive and culture-
negative samples from patients suspected of having bacterial infections were collected over
a 2 year period between July, 2002 and August 2004. Patient information on the test request
forms such as name, age, registration number, laboratory sample number as well as possible
diagnosis and current treatment (if any) were documented.
DNA was extracted from the clinical specimens, and used for broad-range PCR to
determine Gram-type. The PCR products from DNA amplification were also sequenced,
and the resulting sequences aligned with those in public databases in order to determine the
identity of organisms present in the specimens.
107
Results
3.8 PCR on Clinical Samples
A short explanation on the determination of Gram-type by PCR can be found in
Section 3.5. The full results of Gram-positive (GP), Gram-negative (GN) and Pan specific
PCR on the 233 clinical samples used in this study are presented in Appendix E. The
culture results and the Gram-type of the organisms identified by culture were listed and
compared against the typing results by PCR. Samples with no organisms isolated by culture
were listed in the Gram-type as N/A (not available). A summary of the results in Appendix
E can be found in Table 3.9.
Gram-typing by PCR matched those by culture and full concordance was observed
in the following situations:-
i) When both culture and PCR results were positive e.g. a culture-positive sample
that was identified as Escherichia coli had DNA which was amplified by Gram-
negative specific and Pan-specific primers.
ii) When both culture and PCR results were negative e.g. samples that did not show
any results by culture also did not undergo DNA amplification.
iii) When organisms identified as Gram-positive by staining had DNA amplified by
Gram-positive specific and Pan-specific primers, and when those identified as
Gram-negative by staining had DNA amplified by Gram-negative specific and
Pan-specific primers.
Gram-typing by PCR did not match culture results in cases when culture negative
samples had amplifiable DNA or when culture-positive samples failed to produce
amplifiable DNA.
108
Results
In Table 3.9, 11 of the PCR-positive results were typed as Gram-positive, while 19
were typed as Gram-negative. Of the 11 PCR Gram-positive specific samples, four were
culture-negative; while 5 out of 19 of the PCR Gram-negative specific samples were
culture-negative. The Pan-specific PCR samples made up the total of samples found
positive for Gram-positive and Gram-negative specific PCR. Seven of the 14 of the Gram-
positive organisms isolated by culture could not be amplified by PCR, while three of the 17
Gram-negative organisms were not detectable by PCR.
Table 3.9: The number of specimens found positive or negative by culture and PCR, with
division into Gram-positive and Gram-negative groups.
PCR-positive PCR- Total

Culture results negative for
Gram-positive Gram-negative
Pan-specific specimen culture
specific specific
Gram-positive
culture-positive 7 0 7 7 14
samples
Gram-negative
culture-positive 0 14 14 3 17
samples
Culture-negative
4 5 9 193 202
samples
Total for PCR 11 19 30 203 233
Note: The numbers in the column with the double-lines were disregarded from the total.
The numbers in the Pan-specific column are the total numbers from the Gram-positive
specific and Gram-negative specific column.
109
Results
3.9 Sequencing of Clinical Samples
The PCR products from clinical samples that had amplifiable DNA (Section 3.8)
were purified and sequenced (Section 2.5.3) and the results analysed according to the
method in Section 2.5.4. Examples of electropherograms from the DNA sequencing of PCR
products from clinical samples are presented in Appendix F and the results of the analyses
are presented below.
3.9.1 Clinical Samples That Produced Positive Results by Culture and 16S rDNA
PCR (Refer Table 3.10)
3.9.1a Sample C065 (Identified as Enterobacter sp. by Culture)
Sample C065 was identified as Enterobacter sp. by culture. When the 479 bp
sequenced DNA from this sample was analysed by BLAST, it was found to have a 100%
similarity with several different types of species from the genus Enterobacter i.e.
Enterobacter cancerogenus, E. aerogenes, E. ludwigii, E. intermedius (now belonging to
the genus Kluyvera), and E. agglomerans (now of the genus Pantoea), and Kluyvera
cryocrescens. Classification on the RDP-II showed a full match with the family
Enterobacteriaceae and 96% match with the genus Enterobacter. Type and non-type
SeqMatch showed a full sequence match with E. cancerogenus, E. aerogenes and P.
agglomerans. Type-only SeqMatch showed similar results for the former two species along
with K. cryocrescens. Sequence from C065 is very likely from Enterobacter sp. as it
showed a closer match to the genus Enterobacter during classification, although P.
agglomerans and K. cryocrescens could not be excluded from the final diagnosis. Results
using sequencing are considered similar to that of culture.
110
Results
3.9.1b Samples C089, B082, P045 and P063
(Identified as Klebsiella pneumoniae by Culture)
Samples C089 and B082 which were identified by culture as Klebsiella pneumoniae,
were sequenced and the resulting 504 bp product analysed. The sequence was found to be
100% similar to K. pneumoniae and Enterobacter dissolvens by BLAST analysis. When
analysed using the RDP-II Classifier, the sequence was shown to belong partially (99% for
C089 and 97% for B082) to the genus Klebsiella. SeqMatch showed a 0.996 similarity
score to K. pneumoniae or E. dissolvens for C089 and a full match for B082. The sequences
from C089 and B082 were probably from K. pneumoniae based on the result of the
Classifier, but E. dissolvens could not be excluded from the final analysis. Thus, sequencing
analysis supports those of culture.
In comparison, the DNA from P045 (501 bp) and P063 (479 bp) which were
identified by culture as K. pneumoniae and Klebsiella sp. respectively, were found to have a
complete match when using BLAST and RDP-II analysis. The Classifier agrees with this
result and the sequence matches the genus Klebsiella completely. Thus, sequencing results
are similar to those obtained by culture.
3.9.1c Samples P002, P056 and P055 (Identified as Escherichia coli by Culture)
The DNA acquired from P002 and P056 (identified as Escherichia coli by culture)
were sent for BLAST analysis. The 506 bp and 503 bp products (for P002 and P056
respectively) submitted showed 100% similarity with E. coli, E. fergusonii, Shigella boydii,
S. flexneri, and Photorhabdus luminescens. Type and non-type SeqMatch showed 1.000
similarity scores with the addition of the species S. sonnei. Analysis of type strains only had
S. flexneri showing a full similarity score. The RDP-II classifier showed a full match to the
genus Escherichia. It is to be noted that based on the Bergey’s taxonomy, the Shigella spp.
111
Results
listed from this search were all considered to belong to the genus Escherichia. Considering
the similarity with the results from the pure culture samples (refer Section 3.6.9), samples
P002 and P056 possibly contains E. coli, although the other species could not be excluded
in the final analysis.
The sample P055 had rather similar results to P002 and P056 in which the 506 bp
when analysed with BLAST had 100% similarity to the same species listed above. The
Classifier showed only an 81% match to the genus Escherichia. The sequence had a 0.974
similarity score with S. boydii with SeqMatch and 0.974 score for the other organisms
(similar to those found for the previous paragraph). Type strain only subset showed a 0.972
and 0.947 score for S. flexneri and E. coli respectively. Based on the similarity of results
with that of the pure culture analysis (Section 3.6.9), the sample P055 possibly contains E.
coli but the other species could not be excluded in the final analysis.
3.9.1d Samples P004 and P029 (Identified as Enterococcus sp. by Culture)
Samples P004 and P029 were both identified as Enterococcus sp. by culture. DNA
sequenced from both samples (261 bp) was found to have a 100% similarity with
Enterococcus faecalis, E. saccharolyticus and Lactobacillus plantarum. The former two
also had 1.000 similarity scores when tested by SeqMatch with E. moraviensis showing a
0.961 similarity score as a type species. The sample from P004 showed a 99% match to the
genus Enterococcus but P029 showed a full match. Both samples are more likely to contain
DNA from Enterococcus sp. The results of sequencing analysis support those of culture.
112
Results
3.9.1e Samples P007, B078 and B079
(Identified as Acinetobacter baumanii by Culture)
Samples from P007 (502 bp), B078 and B079 (504 bp) which were all identified as
Acinetobacter baumanii by culture, were analysed and found to have high similarities with
A. baumanii and A. calcoaceticus (99.8, 99.8 and 100% respectively). This high match to
the two species was similar when tested with SeqMatch, with a similarity score of 0.986 for
P007 and B078, and 1.000 for B079. The Classifier found all samples to have a full match
to the genus Acinetobacter. A similar result was found in the pure culture analysis (Section
3.6.6). The samples P007, B078 and B079 are therefore either A. baumanii or A.
calcoaceticus.
3.9.1f Sample C003 (Identified as Streptococcus sp. by Culture)
Sample C003 was found to be Streptococcus sp. by culture methods. When the 207
bp sequence obtained was sent for BLAST analysis, the sequence was found to have a
99.5% homology with S. agalactiae and S. difficilis. Similar results were obtained by RDP-
II SeqMatch analysis with a similarity score of 0.915 only. The Classifier found the
sequence in question to be probably 85% from the genus Streptococcus. The DNA from
C003 is probably that of S. agalactiae or S. difficilis.
3.9.1g Sample P051 (Identified as Group G Streptococci by Culture)
Sample P051 was identified as a group G Streptococci by culture methods. BLAST
analysis and SeqMatch of the 279 bp sequence consistently showed a full match to the
species Streptococcus dysgalactiae. The Classifier also agreed with this by showing a full
match with the genus Streptococcus. The organism found in P051 is very likely S.
dysgalactiae. The results by sequencing provide identification to the species level.

113
Results
3.9.1h Sample P017 (Identified as Staphylococcus aureus by Culture)
Sample P017 was identified as Staphylococcus aureus by culture methods. BLAST
analysis showed that the 281 bp submitted for sequencing had a 100% similarity to S.
aureus, S. croceolyticus or S. haemolyticus. The sequence had a 1.000 similarity score with
the former two using SeqMatch analysis. The classifier showed a high but not full
probability of the sequence belonging to the genus Staphylococcus (99%). P017 is possibly
S. aureus, S. croceolyticus or S. haemolyticus but is more likely to be S. aureus due to the
high clustering of the species during the search.
3.9.1i Sample P014 (Identified as Pseudomonas aeruginosa by Culture)
The sample P014 was identified as Pseudomonas aeruginosa by culture methods.
When the 416 bp sequence product was analysed by BLAST, it was found to be 100%
similar with Citrobacter freundii, C. youngae, C. werkmanii and C. braakii. SeqMatch
analysis showed similar results with 1.000 scores but showed C. murliniae instead of C.
youngae. The Classifier identified the sequence as belonging fully to the family
Enterobacteriaceae and only partially (65%) to the genus Citrobacter. The sequence
analysis showed that P014 is probably Citrobacter sp., which does not agree with the result
obtained by culture.
3.9.1j Sample B080 (Identified as Salmonella enteritidis by Culture)
Salmonella enteritidis was identified from the sample B080. BLAST analysis of the
729 bp sequence product showed a 100% similarity with serovar S. typhimurium. SeqMatch
showed a similarly high score of 1.000 while the Classifier placed the sequence fully among
the genus Salmonella. The DNA in the sample B080 likely belongs to serovar S.
typhimurium.
114
Results
3.9.1k Samples B073 and B074
(Identified as Coagulase-negative Staphylococci by Culture)
Samples B073 and B074 were both identified as coagulase-negative Staphylococci
by culture methods. BLAST analysis of the 281 bp sequence obtained from both showed
full similarity with Staphylococcus caprae, S. epidermidis, S. capitis, and S. saccharolyticus
which are all coagulase-negative Staphylococci. SeqMatch on the RDP-II showed similar
results. The Classifier identified the sequences as belonging to the genus Staphylococcus.
The DNA from both samples probably belongs to Staphylococcus sp. and is likely one of
the four organisms listed. Results are considered similar to those by culture.
3.9.1l Sample B076 (Identified as Gram-negative Rod by Culture)
The sample B076 could only be identified as having a Gram-negative rod by culture
methods. BLAST analysis of the 502 bp sequence showed a 100% homology to the species
Escherichia coli and Shigella boydii. Results were replicated in SeqMatch. The Classifier
found the sequence to match fully with the family Enterobacteriaceae and only 97% of the
genus Escherichia. The organism in B076 is either E. coli or S. boydii.
3.9.1m Summary of Section 3.9.1
To sum up the results of sequence analyses from this section, nine samples could be
identified to genus level (P004, P029, P007, B078, B079, C003, P017, B073, and B074),
four to species level (P045, P063, P051, and B080), and seven to family level (C065, C089,
B082, P002, P056, P055, and B076) and all of these were in agreement with culture results.
Only one (P014) out of the 21 PCR and culture-positive samples was not in agreement.
115
Table 3.10 : List of clinical specimens found positive by 16S rDNA PCR and culture, with results from BLAST and RDP-II analyses.

Lab
No. Organism Name Type & Non-type Type only
Streptococcus Streptococcus Streptococcus
agalactiae agalactiae Streptococcus agalactiae or
1 C003 207 Streptococcus sp. 99.5 0.915 0.915
Streptococcus Streptococcus agalactiae Streptococcus
difficilis difficilis difficilis
Enterobacter
aerogenes Enterobacter Enterobacter
Enterobacter aerogenes aerogenes
intermedius
Enterobacter
Enterobacter sp.,
ludwigii Enterobacter Enterobacter
Kluyvera
Enterobacter cancerogenus cancerogenus
2 C065 479 Enterobacter sp. 100.0 1.000 1.000 cryocrescens or
cancerogenus
Pantoea
Enterobacter agglomerans
agglomerans
Kluyvera Pantoea Kluyvera
cryocrescens agglomerans cryocrescens
Pantoea
agglomerans
Klebsiella pneumoniae pneumoniae pneumoniae pneumoniae or
3 C089 504 100.0 0.996 0.996
pneumoniae Enterobacter Enterobacter Enterobacter Enterobacter
116

Lab
Escherichia coli Escherichia coli
fergusonii fergusonii Escherichia coli,
Shigella boydii Shigella boydii Shigella sp. or
4 P002 505 Escherichia coli 100.0 1.000 Shigella flexneri 1.000
Shigella flexneri Shigella flexneri Photorhabdus
Photorhabdus luminescens
Photorhabdus
luminescens
luminescens
Shigella sonnei
Enterococcus Enterococcus
faecalis faecalis
Enterococcus sp.
5 P004 261 Enterococcus sp. 100.0 1.000 0.961 or Lactobacillus
saccharolyticus Enterococcus moraviensis
plantarum
Lactobacillus saccharolyticus
plantarum
Acinetobacter baumanii baumanii Acinetobacter baumanii or
6 P007 502 99.8 0.986 0.986
baumanii Acinetobacter Acinetobacter baumanii Acinetobacter
calcoaceticus calcoaceticus calcoaceticus
Citrobacter Citrobacter Citrobacter
freundii freundii freundii
Pseudomonas youngae murliniae murliniae
7 P014 416 100.0 1.000 1.000 Citrobacter sp.
aeruginosa Citrobacter Citrobacter Citrobacter
werkmanii werkmanii werkmanii
braakii braakii braakii
117

Lab
Staphylococcus Staphylococcus
aureus Staphylococcus aureus
aureus Staphylococcus
Staphylococcus saprophyticus
Staphylococcus croceolyticus Staphylococcus
8 P017 281 100.0 1.000 0.975 Staphylococcus sp.
aureus haemolyticus
Staphylococcus Staphylococcus
Staphylococcus croceolyticus cohnii
haemolyticus Staphylococcus
gallinarum
faecalis faecalis
Enterococcus sp.
9 P029 261 Enterococcus sp. 100.0 1.000 0.961 or Lactobacillus
saccharolyticus Enterococcus moraviensis
plantarum
Lactobacillus saccharolyticus
plantarum
Klebsiella Klebsiella Klebsiella Klebsiella Klebsiella
10 P045 501 100.0 1.000 1.000
pneumoniae pneumoniae pneumoniae pneumoniae pneumoniae
Group G Streptococcus Streptococcus Streptococcus Streptococcus

11 P051 279 100.0 1.000 0.982
Streptococci dysgalactiae dysgalactiae dysgalactiae dysgalactiae
118

Lab
Escherichia coli Shigella boydii 0.974
Escherichia
Escherichia coli Shigella flexneri 0.972
fergusonii
Escherichia Escherichia coli,
Shigella boydii Shigella sp. or
12 P055 506 Escherichia coli 100.0 fergusonii
0.972 Photorhabdus
Shigella flexneri Shigella sonnei
luminescens
Shigella flexneri Escherichia coli 0.947
Photorhabdus
luminescens Photorhabdus
luminescens
Escherichia coli Escherichia coli
Shigella flexneri 1.000
fergusonii fergusonii Escherichia coli,
Shigella boydii Shigella boydii Shigella sp. or
13 P056 503 Escherichia coli 100.0 1.000
Shigella flexneri Shigella flexneri Photorhabdus
luminescens
Shigella sonnei Escherichia coli 0.973
Photorhabdus
luminescens Photorhabdus
luminescens
14 P063 479 Klebsiella sp. 100.0 1.000 1.000
pneumoniae pneumoniae pneumoniae pneumoniae
119

Lab
Staphylococcus Staphylococcus Staphylococcus Staphylococcus
caprae caprae caprae caprae,
Coagulase-
epidermidis epidermidis epidermidis epidermidis,
15 B073 281 negative 100.0 1.000 1.000
Staphylococci
capitis capitis capitis capitis or
saccharolyticus saccharolyticus saccharolyticus saccharolyticus
caprae caprae caprae caprae,
Coagulase-
epidermidis epidermidis epidermidis epidermidis,
16 B074 281 negative 100.0 1.000 1.000
Staphylococci
capitis capitis capitis capitis or
saccharolyticus saccharolyticus saccharolyticus saccharolyticus
Gram negative Escherichia coli Escherichia coli Shigella Escherichia coli or
17 B076 502 100.0 1.000 0.943
rod Shigella boydii Shigella boydii dysenteriae Shigella boydii
Acinetobacter baumannii baumannii Acinetobacter baumanii or
18 B078 504 99.8 0.986 0.986
baumanii Acinetobacter Acinetobacter baumannii Acinetobacter
120

Lab
No bp Culture Results Possible Organism
No. % Similarity Similarity
Organism Name Type & Non-type Type only
Acinetobacter baumannii baumannii Acinetobacter baumanii or
19 B079 504 100.0 1.000 1.000
baumanii Acinetobacter Acinetobacter baumannii Acinetobacter
Salmonella
Salmonella Salmonella Salmonella 0.964 Salmonella
20 B080 729 100.0 1.000 typhimurium
enteritidis typhimurium typhimurium typhimurium
Salmonella typhi 0.973
Klebsiella pneumoniae pneumoniae pneumoniae pneumoniae or
21 B082 504 100.0 1.000 1.000
pneumoniae Enterobacter Enterobacter Enterobacter Enterobacter
121
Results
3.9.2 Clinical Samples Found Positive by 16S rDNA PCR but Negative by Culture
(Refer Table 3.11)
3.9.2a Cerebrospinal Fluid Samples (C016, C027, C033, C051 and C067)
DNA was amplified in sample C016 and the 283 bp sequence was sent for BLAST
analysis and found to have a 99.6% similarity with many organisms of the genus
Brevibacillus i.e. Brevibacillus agri, B. parabrevis, B. formosus, B. limnophilus, B. brevis,
B. centrosporus, and B. choshinensis. SeqMatch found similar results but with a similarity
score of 0.971. The Classifier agreed with the results found and the sequence was fully
matched to the genus Brevibacillus. DNA from this sample is likely from Brevibacillus sp.
C027 produced a 504 bp sequence that showed a 100% similarity to that of
Acinetobacter baumanii and A. calcoaceticus. The result was similar by SeqMatch but with
a similarity score of 0.994. The Classifier showed the sequence to have a 100% match to the
genus Acinetobacter. The DNA from this sample is likely from A. baumanii or A.
calcoaceticus.
The 224 bp sequence from the sample C033 yielded a 100% homology with
sequences from Bacillus sp., Planococcus sp. and Planomicrobium sp. SeqMatch showed a
closer match to the sequence from Bacillus infernus with a 0.995 similarity score. The
Classifier could only classify the sequence fully to the class Bacilli and partially (at 36%) to
the genus Bacillus. The DNA from this sample is likely from Bacillus infernus, Bacillus sp.,
Planococcus sp. or Planomicrobium sp.
122
Results
The 284 bp sequence from sample C051 was shown to have a 99.6% similarity with
Oceanobacillus iheyensis via BLAST analysis, and a 0.975 score to the same organism via
SeqMatch. The Classifier showed a full match to the class Bacilli and a partial match to the
genus Virgibacillus, to which O. iheyensis belongs. The DNA amplified is likely from
Oceanobacillus iheyensis or a similar organism.
Sample C067 had DNA amplified and the resulting 478 bp sequence was 100%
similar to Brevundimonas aurantiaca and Caulobacter henricii by BLAST analysis. The
results were similar with SeqMatch with a 1.000 similarity score. The Classifier showed a
99% match to the genus Brevundimonas. The DNA in this sample is likely from B.
aurantiaca or C. henricii.
3.9.2b Peritoneal Fluid Sample (P020)
Sample P020 produced a 479 bp sequence that had 100% similarity (by BLAST)
and a 1.000 similarity score (by SeqMatch) with Acinetobacter rhizosphaerae, A. baumanii
and A. calcoaceticus. The Classifier matched the sequence to the genus Acinetobacter. The
DNA from this sample is likely from Acinetobacter sp.
3.9.2C Synovial Fluid Samples (S010, S017 and S033)
A 506 bp sequence was obtained from the sample S010 which showed a 99.8%
similarity to an uncultured Sphingomonadaceae bacterium when analysed with BLAST.
The same result was obtained from SeqMatch with a 0.986 similarity score. Type-only
analysis showed a 0.978 similarity to Sphingomonas sanguinis. Classification showed a
100% match with the genus Sphingomonas. DNA from this sample is likely from
Sphingomonas sanguinis.
123
Results
Sample S017 provided a 279 bp sequence that showed 100% similarity with
Streptococcus constellatus, S. intermedius and S. anginosus with BLAST analysis and a full
similarity score with SeqMatch. The Classifier agreed with this result as it showed a 100%
match to the genus Streptococcus. DNA from this sample is likely from Streptococcus sp.
The 506 bp sequence obtained from S033 showed a full match with Acinetobacter
baumanii and A. calcoaceticus when analysed by BLAST. By SeqMatch, the similarity
score was 0.988. The Classifier showed a 100% match to the genus Acinetobacter. DNA
from this sample is likely from A. baumanii or A. calcoaceticus.
124
Table 3.11: List of clinical specimens found positive by 16S rDNA PCR assay and negative by culture, with BLAST and RDP-II analyses.

Lab
No bp % Similarity Similarity Possible Organism
Brevibacillus agri Brevibacillus agri
Brevibacillus Brevibacillus
parabrevis parabrevis
formosus formosus
Brevibacillus Brevibacillus Brevibacillus
1 C016 283 99.6 0.971 0.946 Brevibacillus sp.
limnophilus limnophilus reuszeri
Brevibacillus brevis Brevibacillus brevis
centrosporus centrosporus
choshinensis choshinensis
baumannii baumannii Acinetobacter baumanii or
2 C027 504 100.0 0.994 0.994
Acinetobacter Acinetobacter baumannii Acinetobacter
Oceanobacillus Oceanobacillus Virgibacillus Oceanobacillus
3 C051 284 99.6 0.975 0.906
iheyensis iheyensis marismortui iheyensis
Brevundimonas Brevundimonas
Brevundimonas
aurantiaca aurantiaca Brevundimonas
4 C067 478 100.0 1.000 1.000 aurantiaca or
aurantiaca
Caulobacter henricii Caulobacter henricii Caulobacter henricii
125

Lab
Bacillus drentensis
Bacillus circulans
Bacillus eolicus
Bacillus niacini
Bacillus fumarioli
Bacillus firmus
Bacillus macroides
Bacillus muralis
Bacillus Bacillus infernus,
methanolicus Bacillus Bacillus sp.,
5 C033 224 100.0 Bacillus infernus 0.995 0.995
Bacillus coagulans infernus Planococcus sp. or
Planococcus citreus Planomicrobium sp.
Planococcus
rifitiensis
Planococcus
maritimus
Planomicrobium
chinense
Planococcus
psychrotoleratus
Planomicrobium
okeanokoites
126

Lab
Acinetobacter Acinetobacter
rhizosphaerae rhizosphaerae
6 P020 479 100.0 1.000 1.000 Acintobacter sp.
baumannii baumannii calcoaceticus
Acinetobacter Acinetobacter
calcoaceticus calcoaceticus
Uncultured Uncultured
Sphingomonas Sphingomonas
7 S010 506 Sphingomonadaceae 99.8 Sphingomonadaceae 0.986 0.978
sanguinis sanguinis
bacterium bacterium
Streptococcus Streptococcus
constellatus constellatus
Streptococcus Streptococcus Streptococcus
8 S017 279 100.0 1.000 0.875 Streptococcus sp.
intermedius intermedius intermedius
Streptococcus Streptococcus
anginosus anginosus
baumannii baumannii Acinetobacter baumanii or
9 S033 506 100.0 0.988 0.988
Acinetobacter Acinetobacter baumannii Acinetobacter
127
Results
3.9.3 Clinical Samples Found Negative by 16S rDNA PCR but Positive by Culture.
The 16S rDNA PCR assay did not amplify DNA from 10 samples that showed
viable cultures as can be seen in Table 3.12. Four of the samples (C090, P030, P048 and
P069) were shown to be Staphylococcus aureus by culture. Bacillus sp. was isolated by
culture in two BCB samples (B077 and B081) and Enterococcus sp. in a CSF sample
(C048). The other three samples, P042, P052 and P066, were found by culture to contain
Pseudomonas aeruginosa, Acinetobacter baumanii and Escherichia coli respectively.
Gram-positive organisms made up most of the samples that grew viable cultures but
did not produce amplified DNA. Seven of the samples were Gram-positive, and the
remaining three were Gram-negative. Of the 10 clinical specimens that were positive by
culture but negative by 16S rDNA PCR, six of the samples were PF specimen, 2 were CSF
specimen and 2 others were from BCB.
Table 3.12: List of clinical samples that produced negative results using 16S rDNA PCR
assay but showed positive culture results.
No. Lab No. Specimen type Culture Results Gram-type

1 C 048 Cerebrospinal fluid Enterococcus sp. Positive
2 C 090 Cerebrospinal fluid Staphylococcus aureus Positive
3 P 030 Peritoneal fluid Staphylococcus aureus Positive
4 P 042 Peritoneal fluid Pseudomonas aeruginosa Negative
6 P 052 Peritoneal fluid Acinetobacter baumanii Negative
7 P 066 Peritoneal fluid Escherichia coli Negative
9 B 077 BACTEC fluid Bacillus sp. Positive
10 B 081 BACTEC fluid Bacillus sp. Positive
128
Results
3.10 Comparison of the 16S rDNA PCR with Culture
3.10.1 Overall Results
Results from PCR, sequencing and consequent sequencing analysis (hereby
collectively referred to as 16S rDNA PCR) were compared with those from culture and
collated into four major groups (Table 3.13). The groups consist of samples positive for
both 16S rDNA PCR and culture results, samples positive for 16S rDNA PCR but negative
for culture, samples negative for 16S rDNA PCR but positive for culture and samples
negative for both 16S rDNA PCR and culture. A positive sample for 16S rDNA PCR refers
to successful amplification of the specific target sequence from the extracted DNA sample.
Culture results refer to results obtained using standard microbiological methods and clinical
diagnosis. A positive sample for culture refers to the growth of a bacterial organism in
media and the successful isolation and identification of that organism.
When the 16S rDNA PCR results of 233 clinical samples were compared with the
results obtained by culture, it was found that 21 samples were both culture and 16S rDNA
PCR positive. Of the 21 samples, twenty were found to be fully concordant i.e. the Gram-
typing by PCR and the identification by sequencing and BLAST analysis were similar to
that obtained by culture. However, one of the samples was discordant (Section 3.9.1i) i.e.
the Gram-typing was similar by PCR and culture, but the identification of the organism by
sequencing and BLAST analysis differed from that by culture methods. There were nine
samples found to be positive by 16S rDNA PCR but negative by culture results. Ten of the
culture-positive samples were negative by 16S rDNA PCR. A major portion of the samples
(193 samples) were found to be both culture and 16S rDNA PCR negative. The 16S rDNA
PCR gave positive results for a total of 30 samples out of 233 and negative results for 203
samples. Total culture-positives number at 31 samples, while there was a total of 193
culture-negative samples (Table 3.13).
129
Results
Table 3.13: Results obtained from 16S rDNA broad-range PCR and sequencing compared
with those obtained from cultures in the 233 clinical samples studied.
Culture + Culture -
Concordant 20 Total PCR

PCR + Discordant 1 positives
21 9 30
Total PCR
PCR - negatives
10 193 203
Total culture positives 31 Total culture negatives 202 233
3.10.2 Breakdown of Results into Sample Types
The overall results was broken down into four other groups comprising the different
sample types used in this study as can be seen in Table 3.14.
CSF samples accounted for three of the 16S rDNA PCR and culture-positive
samples. Of the eight 16S rDNA PCR-positive samples, five were culture-negatives. Of the
71 16S rDNA PCR-negative samples, two were culture-positives and the remaining 69 were
culture-negative. Of the 79 CSF samples collected, 5 were culture positive and 74 were
culture-negative.
A total of 64 PF samples were collected. The 16S rDNA PCR-positive samples
numbered at 12 while there were 51 samples that were 16S rDNA PCR-negative. Of the
16S rDNA PCR-positives, one sample was culture-negative. Of the 16S rDNA PCR-
negatives, six were culture-positive and 45 were culture-negative. In total, there were 18
culture-positive PF samples and 46 culture-negative samples.
130
Results
There were no culture-positive samples in the SF sampling. Of the 42 culture-
negative samples collected, three were found to be positive by 16S rDNA PCR while the
remainder was found to be negative.
The BCB samples had seven that were both 16S rDNA PCR and culture-positive.
There were no 16S rDNA PCR-positives that were culture-negative. A total of 42 PCR
negatives were found, two of them positive by culture. Of the 49 BACTEC samples, nine
were culture positive and the rest were culture negative.
Table 3.14: Results obtained from 16S rDNA broad-range PCR and sequencing compared
with those obtained from culture methods. The samples consist of cerebrospinal fluid
(CSF), peritoneal fluid (PF), synovial fluid (SF) and blood culture bottle (BCB) samples.
Culture + Culture -
PCR + 3 5 8
PCR - 2 69 71 Cerebrospinal fluid
5 74 79
Culture + Culture -
PCR + 11 1 12
PCR - 6 45 51 Peritoneal fluid
17 46 63
Culture + Culture -
PCR + 0 3 3
PCR - 0 39 39 Synovial fluid
0 42 42
Culture + Culture -
PCR + 7 0 7
PCR - 2 40 42 Blood Culture Bottle
9 40 49
131
Results
3.10.3 Performance of the 16S rDNA PCR Assay Compared to Culture
The results from Sections 3.10.1 and 3.10.2 were entered into the Simple Interactive
Statistical Analysis (SISA) software that was available online
(http://home.clara.net/sisa/diagnos.htm) and the effectiveness and predictive accuracy of the
16S rDNA PCR assay was compared to those by culture methods. The performance results
are shown in Table 3.15.
Table 3.15: Performance of the 16S rDNA PCR assay compared to the culture results of
cerebrospinal fluid (CSF), peritoneal fluid (PF), synovial fluid (SF) and blood culture bottle
(BCB) samples.
Positive Negative
Number of Sensitivity Specificity predictive predictive
Sample type
samples (%) (%) value, value,
PPV (%) NPV (%)
Cerebrospinal fluid 79 60 93.24 37.5 97.2
Peritoneal fluid 63 64.71 97.83 91.7 88.2
*NaN
Synovial fluid 42 92.86 0 100
(0/0)
BACTEC fluid 49 77.78 100 100 95.2
All samples 233 67.74 95.54 70 95.1
* NaN: not any number
The 16S rDNA PCR was shown to have 60% sensitivity and 93.24% specificity
when used on CSF samples. The positive predictive value (PPV) and negative predictive
value (NPV) of the assay on CSF samples were 37.5% and 97.2% respectively.
Specificity of the assay was higher in PF samples at 97.83%, and the sensitivity was
at 64.71%. The PPV of the assay on PF samples was 91.75 % and the NPV was 88.2%.
132
Results
SF samples provided unusual results. The sensitivity of the assay could not be
determined accurately as results showed NaN (0/0) and the PPV was at zero. The specificity
and NPV of the assay on synovial fluid samples were 92.86% and 100% respectively.
The 16S rDNA PCR assay showed the best results on BCB samples, with sensitivity
at 77.78%, specificity at 100%, PPV at 100% and NPV at 95.2%.
The performance of the assay on all 233 samples of varying types was 67.74%
sensitivity, 95.54% specificity, 70% PPV and 95.1% NPV.
The assay had better specificity (above 92%) than sensitivity (ranging from 60-
78%). The PPV varied depending on the sample types but the NPV of the assays were
generally high.
133
Discussion
4.0 Discussion
4.1 Contamination Issues in Broad-range PCR

Broad-range rDNA PCR is prone to experimental contaminants, as shown by Tanner
et al. (1998), where they found that rDNA from different environmental settings correlate
with experimental contaminants, particularly in extraction of DNA from low-biomass
samples, as there is a minimal dilution of the contaminant DNA with the sample DNA.
They also reported that the Taq polymerase and the amplification buffer were not
responsible for the contamination and the source of contamination was more likely the salt
and buffers, lysozyme, and proteinase K used during extraction.
Carroll et al. (1999) found it necessary to eliminate contaminating bacterial DNA
from Taq DNA polymerase by using Restriction Endonucleases (RE) Digestion. Meier et
al. (1993) used 8-methoxypsoralen as an additive to reduce DNA contaminants. However,
using a real-time 16S rDNA PCR, Corless et al. (2000) reported that the commonly used
methods for eliminating false-positives such as UV irradiation, 8-methoxypsoralen facilitate
by UV, and DNase and RE led to a 4-log, 5-log and 1.66-log reduction in PCR sensitivity
respectively. They reported it was difficult to determine the source of contaminating DNA,
and surmised that it was likely from the water, plastics and reagents. They concluded that it
was not possible to eliminate contaminating DNA for broad-range 16S rDNA PCR without
some decrease in sensitivity.

134
Discussion
With these issues in mind, it was decided that good laboratory practices, dedicated
material, filtered tips, and a strict separation of pre- and post- PCR areas (Burkardt, 2000;
Millar et al., 2002) would be implemented to avoid false-positives in this study (Section
2.2.3). The inclusion of positive and negative controls (Figures 2.4 and 2.5) helped in
detecting false-positive or false-negative results.
4.2 Extraction Methods
Optimal extraction methods are important as they affect downstream applications
such as PCR and sequencing (Aoyagi, 2001). There are many kinds of extraction methods,
each suitable for different specimen types. It is advantageous to avoid hazardous solutions,
multiple centrifugations, multiple steps and special equipment if possible, and select a
protocol that is robust, fits the choice of specimen and removes PCR inhibition (Greenfield
and White, 1993).
4.2.1 Complexity Ranking
The qualitative Complexity Ranking analysis (Section 3.1.1) was implemented on
the range of methods tested, from the simple (boiling) to the difficult (PCIA). This
comparison was performed as the lowest detection levels of the various methods may be
similar (Section 3.1.4), thus there was a need to determine if the method was suitable
enough to be used in routine diagnostics i.e. with high throughput of samples, the need for
rapid results, and must be easily performed.
135
Discussion
The number of steps was one of the criteria ranked, as an increase in steps
performed could lead to a higher probability of contamination and errors, and would need
extra time to complete. The presence of toxic chemicals was also considered as the material
could be hazardous to laboratory workers. The skill level needed to perform the methods
was also evaluated as methods requiring a skilled manipulation could be prone to errors,
require extensive training, and cause difficulties in standardisation. The extent of waste
generation was also ranked as it could affect the overall cost of the laboratory that requires
the waste to be disposed safely.
4.2.2 DNA Amplification of Extracted Samples
Four extraction methods, the AH, boiling, PCIA and the DNAzol method were
compared using CSF, PF, SF and BCB samples (Section 3.1.2). All samples started with
the same initial volume of 100 µl prior to extraction.
The AH method was successful in extracting bacterial DNA from CSF, BCB, and
PF samples but not in SF or water samples (Figure 3.1). It was possible that inhibitory
substances in SF were not completely removed using this method. It was doubtful that the
water samples contained inhibitory substances, thus the lack of amplification could be due
to the loss of bacterial cells during the washing steps.
The boiling method was successful in extracting bacterial DNA only from CSF but
not from BCB, PF, SF or water samples (Figure 3.1). The BCB, PF and SF samples
possibly contained inhibitors that were not completely diluted by the buffer. The bacterial
DNA in the water sample was either lost during the final centrifugation or was totally lysed
during heating.
136
Discussion
The PCIA method extracted DNA from all samples except the BCB sample (Figure
3.2). It was possibly the presence of a PCR inhibitor, sodium polyanetholesulfonate (SPS),
in the BCB sample could not be completely removed by the PCIA method (Fredricks and
Relman, 1998). It must be noted that the PCR using Pan and Gram-positive specific primers
produced only the Gram-positive specific bands from PF and water samples (Figure 3.3). It
is possible that some inhibitors were not completely removed during the extraction.
A similar situation occurred with DNAzol extracted samples (Figures 3.2 and 3.3).
The BCB sample did not show any amplification, possibly due to the presence of SPS, but
the DNA in other samples was successfully extracted using DNAzol.
4.2.3 Boiling Method on CSF Specimen
The boiling extraction method was the method of choice for CSF specimens in this
study (Section 3.1.3). The method initially involved heating the sample without the addition
of buffer or other steps, and this caused inhibition during the PCR. This inhibition was
overcome by the addition of the TE buffer prior to extraction, and the freezing and thawing
steps after heating (Section 2.3.3). The boiling method is a rapid method which was
comparable to the other methods tested in this study (Section 3.1.4).
CSF samples extracted via the boiling method has been said to be refractory to
amplification (Greenfield and White, 1993), but this was not the case in this study as
determined by positive controls spiked into each clinical specimen (Section 3.1.2). The
boiling method worked better on CSF samples compared to other sample types, possibly
due to the low number of nucleated cells.
137
Discussion
4.2.4 AH Method on BCB and PF Specimen
The AH extraction method was the method of choice for BCB and PF specimens
used in this study (Section 3.1.3). This simple and effective method involves a simple alkali
wash and heat lysis, and provides DNA templates suitable for use in PCR, particularly those
obtained from mycobacterium and blood samples (Kulski and Pryce, 1996).
In a study carried out by Millar et al. (2000), the AH method was found to be the
only method that completely removed PCR inhibitors and inherent DNA from virgin
BacT/Alert aerobic, anaerobic and paediatric blood culture bottles. The main PCR inhibitor
in BCB samples was the additive SPS, which had similar properties to DNA that enables it
to co-purify during extraction (Fredricks and Relman, 1998). This would explain why DNA
templates extracted from BCB samples using the boiling, PCIA and DNAzol methods did
not produce amplified products.
The AH extraction method was chosen for PF as it was the most simple and
effective method compared to PCIA and DNAzol. The boiling method did not produce
DNA that was amplifiable by PCR.
4.2.5 DNAzol and SF Specimen
DNAzol is a ready-to-use chemical that consists of guanidine thiocyanate and a
proprietary detergent that hydrolyses RNA and allows the selective precipitation of DNA
from cells. The method requires fewer steps and is simpler than PCIA, involves the use of a
mild irritant which is less toxic than phenol, and produces pure DNA (Chomczynski et al.,
1997). It is these properties and a lower complexity ranking compared to PCIA, which
makes DNAzol extraction the method of choice for the SF specimens used in this study
(Section 3.1.3). The boiling and AH methods did not sufficiently remove the proteins
present in SF.
138
Discussion
4.2.6 Other Methods
The PCIA method, while often considered as the standard in DNA extraction
methods (Sambrook et al. 1989) was not the preferred method in this study. This was
mostly because the PCIA method involved the use of phenol, which is highly toxic. As the
protocols in this study were designed for use in a routine diagnostic laboratory, it was
preferable to use simpler methods suitable for low volume samples and high throughput
conditions. Also, the PCIA method was not as sensitive according to some researchers
(Rantakokko-Jalava and Jalava, 2002) as their protocol could only detect Streptococcus
pyogenes at more than 200,000 CFU and Haemophilus influenzae at 20,000 CFU.
Commercial kits were not used as there have been reports of contaminating material
(Evans et al., 2003; van der zee et al., 2002) that could be detected using the broad-range
16S rDNA method, thereby causing false-positives. In addition, commercial kits can be
expensive and increase the cost of laboratory tests.
4.3 PCR Optimisation
During PCR optimisation, certain conditions were observed that should be noted as
it can affect the overall results and performance of the assay.
The annealing temperatures for the primers used in this study were found to be
optimal at 63°C (Section 3.2.1). The expected annealing temperature for each primer was
approximately 5°C less than the melting temperatures and is as follows; NR=61.3°C,
nf=62.9°C, f3p= 65.1°C, f4n= 63.3°C, and r18n= 63.1°C. Therefore, the optimised
annealing temperature was the best match to the expected temperature of the f4n and r18n
primers, which is used for Gram-negative specific PCR; and the nf primer, which is part of
139
Discussion
the Pan-specific PCR primer set. Annealing temperature conditions were of low stringency
for f3p (Gram-positive specific primer) and stringent for NR (used for Pan and Gram-
positive specific PCR).
During optimisation of PCR for cycle times, 28 cycles were found to be optimal in
producing products in the Gram-positive specific PCR (Figure 3.7, lane 9). For Gram-
negative specific PCR however, 26 cycles of PCR were sufficient (Figure 3.6, lane 5).
Attempts were made to standardise the cycle times in order to run samples either in the
same tube or at the same time (to reduce waiting time and usage of the thermal cycler).
Eventually, a 26 cycle amplification procedure was selected as it was able to
produce amplifications in the Gram-positive specific PCR in a multiplex (Figure 3.16).
This allowed for a single thermal profile (and thermal cycler and test run) to be used on
several tubes of the same sample (Figure 2.4).
During optimisation for MgCl2 and Taq polymerase concentrations, it was observed
that a 554 bp Gram-negative specific band appeared in multiplex reactions containing
Gram-positive organism DNA (S. aureus) despite using Gram-negative specific primers
(Figure 3.8, lanes 2, 5, 9 and 12; Figure 3.9, lanes 2, 5 and 12; Figure 3.10, lanes 5, 9
and 12). This non-specific amplification had been reported in a paper using broad-range
PCR for Gram-typing (Klausegger et al., 1998) and implies a lack of specificity with low
stringency conditions. This was rectified by separating Gram-negative primers from Gram-
positive primers in subsequent amplification reactions.
During primer optimisation of f3p (Gram-positive specific) primer concentrations, a
non-specific 700+ bp band was observed (Figure 3.13, lanes 5, 9 and 12) that was not
present in the monoplex Gram-positive specific PCR (Figure 3.5, lanes 2, 5, 9 and 12). The
presence of this band in low stringency conditions could possibly be caused by mispriming
of 8 bases (5’-CTGGTCTG-3’) in the f3p primer to an area in the 16S rRNA (290-297 bp
140
Discussion
on the E. coli rRNA sequence) that is not the f3p target site (Figure AppC). The resulting
amplification product from this mispriming would be 784 bp in size and this fits the profile
of the non-specific band. This situation was rectified by increasing the stringency of the
Gram-positive specific PCR.
When multiplexing Pan, Gram-positive and Gram-negative primers, only Pan and
Gram-positive specific primers (nf, p3f and NR) were included in a duplex (Section 3.2.5).
Gram-negative primers (f4n and r18n) were performed in a separate reaction due to failure
to reduce non-specific priming when in a multiplex (as mentioned above). This difficulty
could have been encountered by other researchers, whose broad-range Gram-negative PCR
were typically in monoplex reactions (Klausegger et al., 1998; Carroll et al., 2000).
The mispriming of Gram-negative specific primers could be due to an inherent bias
in template annealing in multiplex or multitemplate amplifications (Suzuki and Giovannoni,
1996; Polz and Cavanaugh, 1998) in which the ratio of the initial template and the product
of amplification is skewed. This inherent bias could be aided by primer quality, whereby
primers with better amplification efficiency could lead to preferential amplification of the
template. As mentioned above, the final annealing temperature in the thermal profile
matches closely with the expected annealing temperature of the Gram-negative specific
primers. Furthermore, the primer quality (implying amplification efficiency as determined
by the FastPCR software, Section 2.4.1) of each of the primers is as follows: NR is 61, nf is
64, f3p is 71, f4n is 86 and r18n is 100, with a higher score indicating better amplification
efficiency. It can be surmised that the non-specific amplifications involving the Gram-
negative specific primers (f4n and r18n) were caused by the low stringency conditions
present in the multiplex (e.g. higher concentrations of Taq polymerase, and dNTPs), the
optimal annealing temperature for the primer set, and the high amplification efficiency of
these primers compared to the others.

141
Discussion
4.4 PCR Sensitivity
Results from PCR sensitivity tests (Section 3.4) showed that the lowest detection
limit for both the duplex Pan and Gram-positive specific PCR and the monoplex Gram-
negative specific PCR was 10 pg for E. coli and S. aureus DNA. The Pan-specific primer
set had a lowest detection limit of 1 ng in the duplex PCR but was 1 pg for both E. coli and
S. aureus in a monoplex PCR.
Calculations (Appendix G) show that approximately 1965 copies of the E. coli
genome are present in 10 pg of the template. This would mean that 197 genomes are present
in 1 pg of the template. The lowest detection limits for extraction methods (Section 3.1.4)
was 1000 CFU/ml or 5 CFU per reaction (as each PCR reaction use 5 µl of template
solution). Therefore, approximately 5 to 1965 CFU can be detected per reaction.
Comparatively, Klausegger et al. (1999) could detect 10 CFU of E. coli per reaction
and 1000 CFU of S. aureus per reaction, using pure culture templates and a 50 cycle PCR.
Harris and Hartley (2003) detected 10-100 CFU E. coli per reaction and 100-1000 CFU of
S. aureus per reaction which was then improved to 10-100 CFU of S. aureus per reaction
after changing methods of extraction. Schuurman et al. (2004) detected 100-200 CFU/ml
per CSF sample. Meanwhile, Carroll et al. (2000) detected 100 fg to 1pg on intraocular
fluid using a nested broad-range PCR and Wilkinson et al. (1999) detected 1 fg to 10 pg of
bacterial DNA per reaction on joint fluid using nested broad-range PCR.
The results from this study are comparable to the other studies, considering that the
numbers of cycles during amplification were lower and nested PCR was not utilized.
However, the sensitivity may be improved by using different methods of extraction or by
reducing the stringency in the PCR.
142
Discussion
4.5 PCR Specificity

The PCR primers used in this study were found to be quite specific when tested on
pure cultures (Section 3.5). Only one out of 12 of the cultures tested gave unusual results.
The Pan specific PCR produced amplifications on all bacterial cultures but the fungal
Cryptococcus neoformans sample produced no amplification as expected. The Gram-
negative specific PCR produced amplifications from all Gram-negative organisms but none
from Gram-positive organisms. The Gram-positive specific PCR produced amplifications
from all Gram-positive organisms except for Corynebacterium sp., and did not produce
amplifications from Gram-negative organisms.
To determine why the Gram-positive specific primers did not produce any
amplification from Corynebacterium sp., the Gram-positive specific primer (f3p) was
evaluated on BLAST (Section 2.5.4) using the “Search for short, nearly exact matches” tool
limited by an entrez query for “Corynebacterium jeikeium”. A match was found, thus a
target area matching the f3p primer is available on the organism. This implies that the lack
of amplified products was due to reasons other than a lack of f3p primer target area on this
particular organism. The16S rDNA broadrange PCR can be biased and DNA from different
species contain segments outside the template region that could inhibit PCR to different
degrees (Hansen et al., 1998). Also, the amount of bias depended on the position of primer
sites and could be overcome by using two different primer sets. It is possible that the
amplification on the Gram-positive specific primer site was inhibited by segments outside
the template region in Corynebacterium sp.
This confirms the need for separating the Gram-negative specific PCR from the Pan
and Gram-positive specific PCR, as it could be used to confirm or support the results of the
other test. There is a need for more pure culture samples to be tested on the various PCRs
used in the study.
143
Discussion
4.6 Sequencing
4.6.1 Fragment Size
According to Hugenholtz et al. (1998), sequences less than 500 nucleotides long are
sufficient for placement in a phylogenetic tree (thereby implying identity of organism) if the
sequences are closely related and there was more than a 90% identity with homologous
nucleotides, but in cases of novel sequences where less than 85% of the identity are similar,
500 nucleotides are not suitable for placement. Harris and Hartley (2003) sequenced only a
320 bp hypervariable region at the 5’ end of the 16S rDNA, which was used as sole
evidence of pathogenic infection in 71 out of 382 paediatric specimens tested at the Great
Ormond Street Hospital for Children (London). Rantakokko-Jalava et al. (2000) found that
sequences 164-484 bp in length was sufficient for sole evidence of diagnosis in 11 out of
459 patients hospitalised for various illnesses at the Turku University Central Hospital
(Finland). Tang et al. (1998) used the first 527 bp of the 16S rDNA to obtain genus
information on 72 unusual (i.e. unidentifiable by an in-house method) aerobic Gram-
negative bacilli isolates tested at the Mayo Clinic (Rochester, USA) and species information
on 67 of the isolates.
In this study, the usable sequencing results from the pure culture samples were 260 -
506 bp in length and placed at the 520-1073 bp region of the Escherichia coli 16S rDNA,
which is the middle third region of the 16S rDNA. Shorter sequences were preferred as it is
costlier to sequence DNA more than 600 bases in length. Analyses of the sequences
obtained from pure culture samples showed that the short fragments were suitable to
determine the identity of most organisms to genus level (Section 3.6 and 4.6.3). Therefore,
based on the pure culture sequencing results, the short fragment was deemed adequate for
use in identifying the 16S rDNA of organisms to the genus level.
144
Discussion
4.6.2 Sequencing Results Analyses and Cut-off Points
In order to determine the organism identity of the sequences obtained, it is important
that there is a standard cut-off point for identification to species or genus level during
comparison of the query sequence with sequences in the database.
Drancourt et al. (2000) sets the cut-off point for identification to species level at 16S
rDNA similarity from 99-100%, identification to genus level at 97-99% similarity with
sequences in GenBank, and a less than 97% similarity as a failure to designate genus.
Harris and Hartley (2003) noted that not all bacterial species have representatives in
database and that a difference of more than 1% could reflect either an incomplete database
or indicate a novel species. Also, they noted that some phenotypically distinct species can
share up to 100% identity in 16S rDNA sequence e.g. Escherichia coli and Shigella sonnei;
Bacillus antracis and Bacillus cereus, while some strains of the same species vary in 16S
rDNA by more than 10%. Their criteria for species identification was a 98-100% similarity
to more than one GenBank sequences of the same species or for tight clustering with
members of one species in an in-house database and genus identification was set at more
than 95% similarity to more than one species in GenBank sequences of the same species or
for tight clustering with members of one species in an in-house database.
Other researchers consider the highest scoring match as definitive of sequence
identity (Qian et al., 2001; Schuurman et al., 2004).
In this study, species identity on BLAST was considered to be a 99-100% similarity
to sequences in GenBank and genus identity as a 97-99% similarity to database sequences
with a highest scoring match and clustering of hits taken into consideration. The Harris and
Hartley (2003) definition of identity to more than one GenBank sequences of the same
species was not considered as even a single hit provided by the search could be indicative of
145
Discussion
a species match. This however, could cause a problem if the single sequence provided was
possibly an error in submission (Lactobacillus plantarum in Section 4.8.1)
The Classifier was useful in identifying the higher order taxa of the query sequence.
The highest similarity scores found using SeqMatch were considered if it was in agreement
with BLAST and clustering of results, as the similarity score using SeqMatch were often
lower than the 99-100% similarity determined by BLAST. If the RDP-II was not used in
conjunction with BLAST, sequence identity would be considered as the highest score from
“Type and Non-Type” and “Type strain only” searches on SeqMatch, clustering of results
to a particular species or genus, and probability of the organism belonging to a particular
taxa using the Classifier.
Overall, BLAST gives information about other species aside from bacterial and this
could give information about possible contamination, but can also complicate the search.
The RDP-II is annotated and contain only rRNA sequences, allowing for better searches but
no cut-off point has been determined as yet, with only highest scores and clustering patterns
to guide. Both BLAST and RDP-II were qualitatively compared in this study but where
BLAST gives only a general overview of taxonomic placement and the RDP-II gives a
more specific identification, both tools work well in conjunction with the other to provide
useful information on the whole.
4.6.3 Sequencing Analyses for Pure Culture Samples
The DNA from pure culture samples were sent for sequencing and the results
analysed using the BLAST and RDP-II programs. The names of the organisms obtained
were then investigated further to determine the extent of match to the culture results.
The Staphylococcus aureus pure culture (Section 3.6.1) was identified as either
Staphylococcus aureus or S. croceolyticus by BLAST. Biochemically, S. croceolyticus

146
Discussion
could be easily ruled out by a coagulase test as it tests negative; whereas S. aureus is a
coagulase-positive organism, indicating that a mistake in the identification from culture
results is not possible. A BLAST search using the full S. croceolyticus 16S rRNA gene
found that the sequence was not similar to the S. aureus sequence and a similarity match
possibly occurred because the query sequence was relatively short (293 bp). The S.
croceolyticus (GenBank AY953148) which showed up on the BLAST search was from an
unpublished data and was a new coagulase-negative species isolated from otic infections
(Dajcs et al., 2005). If the Harris and Hartley (2003) cut-off point for sequence
identification were to be used (in which species identification was a 98-100% similarity to
more than one GenBank sequences of the same species; Section 4.6.2), S. croceolyticus
could be excluded as there was only one similarity hit on this species using the BLAST
search. Furthermore, a high clustering of results on S. aureus using SeqMatch indicates that
the organism was of the species S. aureus.
The Acinetobacter baumanii pure culture sample (Section 3.6.6) was found to be
either A. baumanii or A. calcoaceticus. Both species are often referred to as the A.
calcoaceticus- A. baumanii complex, as biochemically they are both glucose-acidifying and
are difficult to be differentiated from each other. Reports of infection caused by A.
baumanii does not necessarily test for the specific organism, rather, it is presumptive as it
could be any of the glucose acidifying organisms in the complex; and also, delineation of
species within this genus is still the subject of research e.g. A. calcoaceticus subsp.
anitratus was not formally accepted by taxonomists and has been found to be A. baumanii
(Bergogne-Bérézin and Towner, 1996). Whether there is a misidentification of the organism
prior to sequencing and submission to the database, or a name change that was not updated,
A. baumanii and A. calcoaceticus could not be differentiated using sequencing and
identification could only be carried out to the genus (or complex) level.
147
Discussion
The Klebsiella pneumoniae culture (Section 3.6.7) had a 100% similarity with K.
pneumoniae as well as Enterobacter dissolvens. These two species can be differentiated
biochemically by the motility test in which K. pneumoniae is found to be non-motile
(Farmer et al., 1985a). A BLAST search using a full E. dissolvens 16S rDNA gene
(296079) from GenBank matched 98.8% with K. pneumoniae which would imply that both
species were from the same genus. High clustering in both BLAST and RDP-II analyses
indicate that the organism is K. pneumoniae but E. dissolvens could not be excluded without
further tests.
The Enterobacter sp. pure culture was found to have matches to organisms of the
same genus as well as others of the genus Kluyvera and Pantoea (Section 3.6.8). Kluyvera
intermedius was formerly of the genus Enterobacter (Pavan et al., 2005) as was Pantoea
agglomerans which had a long history of name changes according to the List of Prokaryotic
Names with Standing in Nomenclature (http://www.bacterio.cict.fr/; last update Nov 10,
2005). Heterogenous biochemical reactions make identification difficult among the
enterobacters e.g. K. cryocrescens can be differentiated from others in the genus Kluyvera
by a negative Voges-Proskauer (VP) test but K. intermedius is VP positive and can not be
differentiated from other enterobacters (Farmer et al., 1985a). The organism was considered
to be an Enterobacter sp.
The Escherichia coli pure culture (Section 3.6.9) showed matches to E. coli, E.
fergusonii, Shigella boydii, S. flexneri, S. sonnei and Photorhabdus luminescens. E. coli and
Shigella sp. are biochemically quite similar and often referred to as the E. coli-Shigella
complex. The complex is difficult to classify by 16S rRNA studies (Christensen et al.,
1998) and DNA hybridisation studies found them to be so similar as to be same species
evolutionary speaking; but the two different genera were maintained because the Shigella
sp. causes bacillary dysentery (Farmer et al., 1985a). E. fergusonii can be differentiated
148
Discussion
biochemically from E. coli as the former can ferment adonitol, cellubiose and D-Arabitol.
However, a BLAST search using an E. fergusonii sequence found high similarity of more
than 99% among various Shigella sp. and E. coli and thus cannot be differentiated using the
16S rDNA PCR and sequencing (Farmer et al., 1985b). Photorhabdus luminescens is
biochemically and molecularly (by DNA hybridisation with similarity of 20%) distinct from
E. coli, has a weak bioluminescence and is an insect pathogen that has been isolated from
humans (Peel et al., 1999). However, a BLAST of the P. luminescens (GenBank
AY444555) 16S rRNA sequence found that it only differed from S. sonnei in 2 bases and
from E. coli in 3 bases out of 1439 bases. This suggested that E. coli could not be
adequately identified using the DNA sequence analysis, and final identification would
depend on the clinical and biochemical examination of the samples.
The Proteus sp. pure culture (Section 3.6.10) showed matches to Proteus mirabilis
or P. vulgaris. The two sequences could be differentiated using the spot indole test whereby
P. mirabilis is indole-negative and P. vulgaris is indole-positive (Bale et al., 1985).
However, a full sequence BLAST test of sequences from the two organisms found only
minor differences which made it difficult to differentiate by the sequences in the database.
Organisms whose query sequences had high sequence match and clustering and did
not share results with other species were Enterococcus faecalis (Section 3.6.2),
Corynebacterium sp. (Section 3.6.3) which was identified as Corynebacterium jeikeium,
Neisseria gonorrhoeae (Section 3.6.4), Haemophilus influenzae (Section 3.6.5), and
Stenotrophomonas maltophilia (Section 3.6.11)
149
Discussion
4.6.4 The Limitations of the 16S rDNA PCR and DNA Sequence Analyses for the
Identification of Bacterial Isolates
The determination of the 16S rDNA sequence does not necessarily lead to species
identification as shown in the case of the Enterobacteriaceae, particularly for
phenotypically and taxonomically closely related organisms like Escherichia coli-Shigella
species, and Klebsiella-Enterobacter species (Section 4.6.3). The method may be more
appropriate for the determination of inter- or intragenomic relationship than for speciation
(Fox et al., 1992). It has been said that identical 16S rDNA genes can be found in bacteria
with highly divergent genomes and geophysiologies (Jaspers and Overmann, 2004). DNA-
DNA reassociation has been reported to be superior to 16S rDNA sequencing as some taxa
show a higher level of rRNA variability and some with little variability (Stackerbrandt and
Goebel, 1994).
The difficulty in speciation using 16S rDNA sequence analysis may be caused by
interoperon variation within a strain, strain-to-strain variation within a species, inadequate
taxon delineation, sequencing or other laboratory errors. These may cause ambiguous
results as the accuracy of the sequence depends upon the proper characterization of a strain.
(Clayton et al., 1995; Janda and Abbott, 2002)
Previously, the 16S rRNA gene was thought to be stable but comparative sequence
analyses reveal fragment inaccuracies of short segments containing an abnormally high
number of non-random base variations in the bacterial rDNA of some species, which were
believed to be caused by lateral gene transfer (Wang and Zhang, 2000).
These limitations mean that the 16S rDNA gene analysis alone is insufficient and
there must be efforts to analyse more than one set of genes in a multilocus analysis during
delineation of related species (Hanage et al., 2005). A small number of carefully selected
bacterial gene sequences, such as the recN (a recombination and repair protein-encoding
150
Discussion
gene), thdF (the gene that encodes for the thiophene oxidation enxyme) and rpoA (the gene
that encodes the RNA polymerase α-subunit), can be equal or superior to DNA-DNA
hybridization for determining relatedness (Zeigler, 2003).
4.7 PCR on Clinical Samples
In this section, the Gram-typing by PCR (Section 3.8) is discussed and the overall
assay results will be further elaborated in Section 4.9.
The Pan-specific PCR detected some culture-negative samples as PCR-positive and
failed to detect some culture-positive samples. However, all samples positive in the Pan-
specific PCR could be amplified by either Gram-positive or Gram-negative primers as well,
indicating that the Pan-specific primers are specific for both Gram types.
From the total number of PCR-positive samples, 11 out of 30 (36.7%) were typed as
Gram-positive organisms while the remaining 19 (63.3%) were typed as Gram-negative
organisms. By culture, 14 out of 31 samples (45.2%) were found to be Gram-positive
organisms while the remaining 17 (54.8%) of samples were Gram-negative. In culture-
positive samples, there was complete agreement between the Gram-types obtained by PCR
and by culture.
However, PCR was negative in three of 17 (17.6%) samples that grew a Gram-
positive organism and in seven of 14 (50%) of samples that yielded Gram-negative
organisms. This implies that the Gram-positive organisms were not as efficiently detected
by the PCR techniques as compared to Gram-negative organisms. One possible reason
could be the differences in the cell wall structure among the two Gram-types, the Gram-
positive cell wall being more difficult to lyse to release DNA for amplification. DNA
extraction by mechanical disruption had been suggested as a method to improve the
151
Discussion
sensitivity of PCR detection of Gram-positive bacteria (Rantokokko-Jalava et al., 2000;
Harris and Hartley, 2003).
Culture was negative in four of 11 (36.4%) samples amplified in the Gram-positive
PCR compared to five of 19 (26.3%) amplified in the Gram-negative PCR, suggesting that
possible false PCR-positives are more likely with the Gram-positive PCR. However,
application of the Fisher exact test showed that the difference is not significant.
4.8 Sequencing on Clinical Samples
4.8.1 Clinical Samples that Gave Positive Results by Culture and 16S rDNA PCR.
As previously mentioned, those from the family Enterobacteriaceae (Escherichia
coli, Klebsiella pneumoniae and Enterobacter sp.) were difficult to be differentiated using
the 16S rDNA sequencing analysis (Section 3.6). Analyses of the sequencing results of
some of the clinical samples showed results similar to those of pure culture DNA
sequencing analysis (Section 4.6.3) and could not be elaborated further. Among them were
culture-identified Escherichia coli (P002, P056, P055; Section 3.9.1c) that were confirmed
by 16S sequencing analysis as the Shigella-Escherichia coli complex; the Gram-negative
rod in the sample B076 was identified as either Shigella boydii or E. coli (Section 3.9.1l);
the culture-identified Enterobacter sp. (C065; Section 3.9.1a) that was linked to
Enterobacter sp., Pantoea agglomerans and Kluyvera cryocrescens; and the culture-
identified Klebsiella pneumoniae samples of C089 and B082 could not be differentiated
between K. pneumoniae and Enterobacter dissolvens (Section 3.9.1b). However, the K.
pneumoniae identified by culture in samples P045 and P063 were found to be definite K.
pneumoniae by sequencing analysis (Section 3.9.1b). Other samples with similar
152
Discussion
explanations to those mentioned in Section 4.6.3 were samples P007, B078 and B079
(Section 3.9.1c) which were identified as either Acinetobacter baumanii or A.
calcoaceticus; and sample P017 which was culture-identified as Staphylococcus aureus but
could not be differentiated from S. croceolyticus and S. haemolyticus, both of which were
coagulase-negative Staphylococci (Section 3.9.1h).
Group G Streptococci were isolated by culture in sample P051 (Section 3.9.1g) and
identified as Streptococcus dysgalactiae, which is indeed a member of that group.
Sequencing analyses could speciate the microorganism present in this sample.
The culture-identified Streptococcus sp. (C003; Section 3.9.1f) was found to be
either Streptococcus dysgalactiae or S. difficilis. The two species could not be resolved
further using this method as they were reported to have a high genetic similarity i.e. 100%
for 16S rRNA genes despite having biochemical differences (Kawamura et al., 2005).
However, compared to the routine laboratory culture diagnosis, the sequence analyses
managed to identify down to only two probable species names. There was an agreement
with culture results in the sample, with sequencing providing a narrower target for
identification.
The samples P004 and P029 (Section 3.9.1d) were found by culture methods to
contain Enterococcus sp. but sequencing analyses identified the 16S rDNA as belonging to
Enterococcus faecalis, E. saccharolyticus and Lactobacillus plantarum. The E. faecalis and
E. saccharolyticus were able to be differentiated into species lines using 16S rDNA analysis
(Monstein et al., 1998) but could not be resolved in this study. L. plantarum could be easily
be differentiated via molecular means (Moreira et al., 2005) and thus should not show up in
the search. Further investigation using the GenBank database showed that only one L.
plantarum strain was found by the similarity search, i.e. strain PFK2 (GenBank DQ295035;
Sequence ID: S000627085) which had its genus wrongly listed as Enterococcus.
153
Discussion
Interestingly, the full sequence of the L. plantarum PFK2 is similar to the E. faecalis PFK3
sequence (GenBank DQ295036; Sequence ID: S000627086) and both strains were from
unpublished data by similar authors (Dan et al., 2005). Further checks on BLAST using
sequences from other strains of L. plantarum available on the database showed that it could
be differentiated quite clearly from members of the genus Enterococcus. It is possible that
there was a mistake in the database, and therefore the sequencing identification should read
as Enterococcus sp. which is in agreement with that of culture.
The organisms in samples B073 and B074 (Section 3.9.1k) were culture-identified
as coagulase-negative Staphylococci, and DNA amplified from the samples were similar to
those of Staphylococcus caprae, S. epidermidis, S. capitis, and S. saccharolyticus, all of
which are coagulase-negative Staphylococci. The members of this group could not be
resolved further into individual species in other studies, where the analysis of the HSP60
gene instead of the 16S rDNA was suggested (Kwok et al., 1999). The rpoB gene was also
suggested to speciate Staphylococci, but the 16S rDNA sequencing and analyses still
remain suitable for higher classification above the genus level (Drancourt and Raoult,
2002).
The DNA amplified from sample B080 was found to be similar to those of
Salmonella typhimurium instead of the culture-identified S. enteritidis (Section 3.9.1j).
Both species are heterotypic synonyms of Salmonella enterica subsp. enterica (ex
Kauffman and Edwards 1952) Le Minor and Popoff 1987, subsp. nov. according to the List
of Prokaryotic Names with Standing in Nomenclature (http://www.bacterio.cict.fr/). The
genus has a long history, which is not yet resolved with regards to nomenclature (Tindall et
al., 2005) and thus, the GenBank database would have several naming systems co-existing,
causing discrepancies during similarity searches. However, there was an agreement in
identification down to genus level.

154
Discussion
Pseudomonas aeruginosa was isolated by culture from the sample P014 but
sequencing analysis did not agree and instead, identified the amplified DNA as belonging to
Citrobacter sp. (Section 3.9.1i). The two organisms are easily differentiated by biochemical
or molecular methods. Possible reasons for the misidentification (either by culture or
sequencing analyses) is; that Citrobacter sp. was dismissed as a contaminant and not noted
in the test work-sheet, or the P. aeruginosa contaminated the sample plate but was not
present in the original specimen collected from the patient. There was no indication (by
literature) that both organisms had similar 16S rDNA, nor was there evidence of
contamination during PCR according to the controls.
4.8.2 Clinical Samples Found Positive by 16S rDNA PCR but Negative by Culture
This section will discuss the samples that had amplifiable 16S rDNA targets despite
being found negative for growth by culture methods (Section 3.9.2). The target sequences
were identified as belonging to certain organisms by analyses of the sequencing results.
The DNA amplified from the sample C016 was identified by sequencing analysis as
Brevibacillus sp. Organisms from this genus had been isolated before from ‘sterilised’ milk,
water-borne illnesses, pharmaceutical manufacturing plants and blood; with no
characteristic profile as yet for the genus (Logan et al., 2002). It is possible for this
organism to be found in CSF but it is more likely to be an environmental contaminant.
The C027 and S033 samples yielded DNA that was identified as Acinetobacter
baumanii or A. calcoaceticus, which has been discussed previously (Section 4.6.3). In
neonatal meningitis, Acinetobacter sp. is a possible pathogen; in adults this is unlikely
unless the patient has special predisposing factors. The sample C027 was obtained from a
male patient, 50 years of age, and the CSF sample was noted to be bloody. Patient history
and information about prior antibiotic treatment could not be ascertained.

155
Discussion
The DNA amplified from P020 was also identified as Acinetobacter baumanii or A.
calcoaceticus but with the addition of similarity hits on A. rhizophaerae (GenBank
AY364536) which was not validly published at the time of submission of entry (2003), nor
was it available on the List of Prokaryotic Names with Standing in Nomenclature
(http://www.bacterio.cict.fr/) as of the end of 2005. It could not be determined if A.
rhizophaerae was a possible lab contaminant or if it has clinical implications. However,
there was evidence that P020 was obtained from a patient who was treated with antibiotics
prior to sample collection.
The DNA from C033 showed similarity with sequences from the genus Planococcus
and Planomicrobium which were related to the genus Bacillus. The former two were
usually isolated from marine water, and seafood (fresh or processed) and reportedly isolated
from a traditional Korean fermented food (Yoon et al., 2001). There was also similarity to
Bacillus infernus, which is a strict anaerobe isolated from deep below the land surface
(Boone et al., 1995). As yet, there are no reports on whether it has been isolated from
clinical samples, or even as a common lab contaminant; thus, taking into consideration the
short sequence sent for search (224 bp) it was likely that the target DNA was obtained from
an organism somewhat similar to Bacillus but has not been described, is a PCR-based
chimera, or simply a contaminant DNA.
The sequences obtained from sample C051 was identified as Oceanobacillus
iheyensis which is a deep-sea, halotolerant, alkaphilic species which grew at salinities
between 0-21% (w/v) NaCl at pH 7.5 (Lu et al., 2001). No clinical cases have as yet been
accorded to this organism but it was found to be comparatively close to B. subtilis using
16S rDNA sequence analyses. It is possible that the DNA from this sample was from B.
subtilis but is an unreported strain or a chimera.
156
Discussion
Sequences from Brevundimonas aurantiaca or Caulobacter henricii were found to
be similar to those amplified from the sample C067. The two species are closely related as
some species from the genus Brevundimonas fall within the Caulobacter cluster. Both
species are also usually found in fresh or marine water and the genera have not as yet been
fully described (Sly et al., 1999). The clinical significance of either of these samples could
not be determined.
The DNA amplified from the S010 sample had sequences that matched those of
Sphingomonas sanguinis. This organism has been isolated from clinical samples but its
causative role in infections is uncertain (Takeuchi et al., 2001).
The sample S017 yielded DNA that had similarities with sequences from the species
Streptococcus constellatus, S. intermedius and S. anginosus, all of which can be found
within the S. milleri group. The S. milleri group were known to cause abscesses and were
found in the central nervous system, CSF, brain abscesses, respiratory tracts,
gastrointestinal tracts, abdominal pelvic sites, genitourinary sites, skin, soft tissue and bones
as well as blood cultures and is very likely to be the organism responsible (Whiley et al.,
1992) for the infection in S017. The species in the group can be differentiated
phenotypically (Whiley et al., 1990) and by 16S rDNA PCR (Clarridge et al., 2001) but not
by the sequences amplified in this study.
The following are several aspects to consider when analysing the results discussed
in this section. It is possible for easily isolated organisms to be culture-negative (e.g.
Acinetobacter baumanii), and then found in the sample by using 16S rDNA PCR
(Drancourt et al., 2000). In most cases, it is not known if the DNA was from an infection or
from a laboratory contaminant (Nikkari et al., 2001). Also, researchers are constantly
finding new species never before isolated from humans using 16S rDNA (Drancourt et al.,
2004), where some of the organisms found were initially isolated from extreme conditions
157
Discussion
(Eckburg et al., 2003). Although some of the organisms identified by 16S rDNA analysis
are not previously recognized as human pathogens, in immunocompomised patients, it is
possible that they can cause an infection. For these reasons, it is possible that PCR and
sequencing analyses were able to identify cause of infection in the samples above.
Possible reasons for the failure of culture include (i) patients could have undergone
antibiotic treatment with or without the knowledge of the doctor treating him/her at UMMC
(patients could have sought treatment elsewhere and this would not have been documented),
(ii) bacterial cells causing the infection could have degraded due to activity in the bodily
fluids, (iii) the non-viable cells would not have grown on culture but can be detected using
the molecular methods in this study, (iv) there was inhibition in the bodily fluids that could
have been inhibitory to culture but not to PCR and sequencing, and (v) routine hospital
diagnostic laboratories are not equipped to detect some of these organisms.
4.8.3 Clinical Specimen Found Negative by 16S rDNA PCR but Positive by Culture
The organisms that could not be detected by 16S rDNA PCR but were positive by
culture (Section 3.9.3) were bacteria that are commonly isolated in routine laboratories, e.g.
Staphylococcus aureus, Bacillus sp., Enterococcus sp., Pseudomonas aeruginosa,
Acinetobacter baumanii, and Escherichia coli. With the exception of P. aeruginosa, all of
these samples were identified by 16S rDNA sequencing analysis in this study (Sections
4.6.3, 4.8.1 and 4.8.2).
Of the culture-positive samples tested in this study, two out of five (40%) from CSF
samples could not be identified by PCR, while six out of 17 (35.3%) and two out of 9
(22.2%) of PF and BCB samples respectively could not be identified by PCR.
The reasons for the high number of PCR-negative culture-positive CSF samples
could be: (i) the crude boiling method used to extract DNA from CSF is not sufficiently
158
Discussion
effective, (ii) as CSF samples are only available in small volumes, a much smaller volume
was used for DNA extraction than for other specimen types, (iii) the number of CSF
samples examined was small, (iv) CSF contains proteins that degrade DNA at a higher rate
than proteins in other specimen types.
Generally, molecular methods fail to detect organisms in culture-positive specimens
when: (i) the target DNA has been degraded, (ii) there are low numbers of DNA copies in
the sample, and (iii) the extraction method used does not efficiently release DNA from cells
and remove inhibitors of DNA amplification.
4.9 Comparison of the 16S rDNA Assay with Culture
The total results in Section 3.10.1 were broken down into analyses of sample types
in Section 3.10.2 and the performance of the assay was statistically compared to culture in
Section 3.10.3. There was a 91.8% agreement in results between the 16S rDNA assay and
culture (Section 3.10.1), whereby 21 samples were PCR and culture-positive and 193
samples were PCR and culture-negative (214/233 samples). Overall, the results of both
PCR Gram-typing and identification by DNA sequence analysis were in agreement with
culture results, with the only discrepancy being sample P014 (Section 3.9.1i) where PCR
Gram-typing was in agreement (Gram-negative organism) but sequence identity was not i.e.
instead of Pseudomonas aeruginosa, sequence analysis identified the target sequence to be
from Citrobacter sp. The reason for this discrepancy could be that the sample had a mixed
culture or was contaminated at some stage during investigation.
159
Discussion
Generally, the results show that the 16S rDNA assay was almost at par with the
culture method. Discordant results that were deemed false-positive could have been due to
contaminants or a better detection of DNA by the 16S rDNA method. Either of these two
explanations could be possible but due to certain limitations of this study, follow-up on the
patient samples could not be performed to determine the possible cause of false-positives.
The false-negatives could be more easily explained by the following: as the samples were
collected from the Diagnostic Microbiology Laboratory of UMMC post-culture, DNA
could have already degraded despite efforts to preserve them by freezing or immediate
extraction of DNA. There was also the possibility that the cells were in very low quantities,
enabling growth by culture but losing DNA through the extraction process. Also, there was
the slim possibility that the culture plate itself was contaminated, leading to a positive
culture result despite there being no microbes in the specimen. Inhibition of the PCR was
also considered, but this was unlikely, as each of the samples were spiked by a sample
control.
The overall specificity of the 16S rDNA PCR and sequence analysis was high at
95.54% with a NPV of 95.1%, while the overall sensitivity was 67.74% with a PPV of 70%.
However, different sample types had different scores for sensitivity, specificity, positive
predictive values (PPV) and negative predictive values (NPV). Generally, it was found that
if specificity was high, sensitivity would be slightly sacrificed and vice versa e.g. if steps
were taken to reduce false-positives in terms of contaminants, there is a higher likelihood
that sensitivity would be lowered, and also a more sensitive method such as nested PCR
would have a higher chance of being contaminated.
Of the four sample types, the type that best matches culture results using the16S
rDNA assay was the BCB samples. The specificity was very high at 100% as there were no
culture-negative samples that were PCR-positive. This probably reflects the aseptic
160
Discussion
techniques used in blood collection and processing to prevent contamination. The chance
of a positive PCR result being accurate (PPV) was at 100%. The high sensitivity and PPV
could be attributed to the fact that BCB is a culture medium and after incubation, the
bacterial count is generally high enough to support PCR detection. Sensitivity was
acceptable at 77.78% and the probability of the negative results being accurate was at
95.2%, as two out of nine culture-positives were not detectable by PCR. Both of these are
of Bacillus sp. and non-detection could have been due to sedimentation in the bottles, the
lack of viable DNA present, or the target DNA being somehow inhibited, and most likely,
the isolates were laboratory contaminants introduced during culture. Instrument false-
positive (in which the system signalled a positive but was Gram-stain and culture-negative
on chocolate agar) was reportedly at 1.3% but could not be verified in this case (Qian et al.,
2001).
For PF samples, the specificity, sensitivity, PPV and NPV were 97.83%, 64.71%,
91.7 % and 88.2%, respectively. The sensitivity was affected by the inability of the assay to
detect six culture-positive samples by PCR. The organisms that could not be detected by
PCR were Pseudomonas aeruginosa, Staphylococcus aureus, Acinetobacter baumanii and
Escherichia coli, of which the latter three were found to be detectable by this assay
(Sections 3.6.1, 3.6.6 and 3.6.9). These negative PCRs could have been caused by small
bacterial loads vastly diluted in large volumes of peritoneal fluid collected or degradation of
DNA in the samples.
Sensitivity of the CSF samples was low at 60% and the PPV very low at 37.5%,
indicating a high level of false-positives. This is very likely because of the 8 PCR-positive
samples, 5 were not initially detected by culture. The low (60%) sensitivity for CSF
samples indicates that this assay, without further optimization, may not be useful for the
diagnosis of bacterial meningitis. The very low PPV (37.5%) is due to the large number of
161
Discussion
PCR-positives not confirmed by culture (Section 4.8.2). However, except for Acinetobacter,
the other 4 organisms identified by PCR are very likely to be laboratory contaminants.
Hence, the low PPV probably reflects the high risk of false-positives in a very sensitive
DNA amplification assay.
For the SF samples, sensitivity could not be determined as there were no positive
cultures. With culture as the gold standard, all three PCR positive results should be
classified as false-positives but the organisms detected were possible causes of infection in
synovial fluid and the patients’ symptoms and signs suggested bacterial infection. Hence
the results could indicate a higher sensitivity for PCR than culture. The 100% NPV suggests
that the chance of a false-negative PCR is negligible.
4.10 Limitations of the 16S rDNA PCR and DNA Sequencing
Assay for Use on Clinical Specimens
Limitations of the PCR and sequencing assay in this study are inherent problems
present in the PCR method - the bias caused by template annealing during the PCR (Suzuki
and Giovannoni, 1996) and the bias in the template to product ratio in multitemplate PCR
(Polz and Cavanaugh, 1998). This bias could cause a skew in the products and this should
be taken into consideration as there can be more than one organism present in clinical
samples.
Another limitation would be the effect of genome size and the 16S rDNA copy
number on PCR amplification as it is impossible to quantify the number of species
represented if the parameters (of each organism) are unknown (Farrelly et al., 1995; Fogel
162
Discussion
et al., 1999). An infection with a low 16S rDNA copy number could be missed if organisms
from normal flora or other contaminants that have a higher copy number are also present.
The organism detected in a clinical specimen by PCR may not be cause of infection
as the organism amplified could be a by-stander that is present in larger numbers than the
infecting agent and therefore more easily amplified by PCR (Fredricks and Relman, 1996).
Even sterile body fluids like blood of healthy subjects may contain bacterial rDNA of
unknown origins as a result of contamination (Nikkari et al., 2001).
A further limitation of the PCR for diagnosis is its inability to distinguish living
from dead cells (Eckberg et al., 2005). Hence, DNA remaining after a previous or treated
infection may be amplified to give a wrong diagnosis of current infection.
The formation of chimeric sequences in the public database is an especially
worrying limitation of this method (Hugenholtz and Huber, 2003). The frequency of
forming chimeric PCR molecules increases during co-amplification of 16S rDNA from
mixed bacterial genomes or from different rDNA copies in the same organism and the
chimeras are especially abundant if lower amounts of 16S DNA are present during PCR
(Wang and Wang, 1997).
The 16S rDNA assay in this study used an in-house extraction method instead of
kits, thereby requiring different methods for different sample types and indicates
standardisation issues in the future. There were indications that the current extraction
methods used may not be fully releasing DNA especially from Gram-positive cells. A
mechanical disruption method has been recommended (Harris and Hartley, 2003).
The PCR protocols in the study were only able to detect 1,965 genomes in 5 µl of
template DNA (Appendix G). Steps have to be taken to increase the sensitivity of the
broad-range PCR without increasing the rate of detecting false-positives.
163
Discussion
Incidences of mixed cultures, where 16S rDNA sequences from more than one
bacterial species were present in the specimens, were not addressed in this study. Should
mixed cultures be indicated, PCR cloning should be performed and the colonies amplified
and sequenced (Harris and Hartley, 2003).
Also, the efficacy of the PCR in Gram-typing were not tested on organisms with
ambiguous cell wall staining types e.g. organisms of the genus Mycobacterium.
4.11 Significance of Findings
There are two factors to be considered when presenting the significance of the
findings in this study. Firstly, can this method be adopted by laboratories performing
routine clinical diagnostic services? Secondly, if that is not possible, what applications can
the findings be useful in?
The findings show that for this technique to be useful in a clinical laboratory setting,
optimisation and improvements should be carried out in the following areas:
(a) The DNA extraction methods should be better able to break down cellular material
in order to retrieve amplifiable DNA. Preferably, one standard method of DNA
extraction should be established for DNA extraction from the different of sample
sources as this will allow simplicity in protocol. Commercial kits (which are quite
affordable) or mechanical disruption can be investigated to allow for a more
sizeable increase in DNA yield and purity.
(b) The panel of broad-range primers should be increased to include primers specific
for viruses or fungi. Different target areas in addition to the 16S rDNA presently
studied should be investigated to improve the identification of organisms.
164
Discussion
(c) A more rapid method of obtaining or viewing results, for example, Real-Time PCR
can be looked into to allow faster diagnostic tests.
(d) Automated DNA sequencing should be carried out as an "in-house" technique with
dedicated hospital staff to run the service. This will allow more rapid analysis.
(e) Better guidelines for collection of samples and dissemination of results need to be
drawn up. These are extra-laboratory activities would require a different mindset,
training and collaboration of clinicians, particularly in ordering laboratory work on
specimens, or when determining treatment based on the results.
The current broad-range PCR techniques could ideally be a routine tool in clinical
diagnostic laboratories of the future. The existing techniques developed in this study can
still be administered in an ad hoc basis on samples whereby;
(a) Clinical symptoms show clear indication of bacterial infection but culture was
negative by conventional methods. Direct amplification and sequencing from the
samples are possible. Screening of all culture-negative samples could be performed,
and the PCR-positive samples could be further investigated.
(b) Organisms were cultured but could not be identified by standard biochemical tests.
In most cases, save for the Enterobacteriaceae, identification could be performed up
to the genus level. The technique could serve as a screening tool for these
"unidentifiable" cultures and initial identification could be determined.
A limitation of this study is the lack of coordination between the laboratory and the
clinician. This resulted in an inability to address the issues of false-positive and false-
negative results beyond the confines of the laboratory. However, this was only a
preliminary study and the findings are nevertheless significant as they will provide a
165
Discussion
framework where future steps can be planned to improve and adapt the techniques for
implementation in a clinical diagnostic laboratory. It is absolutely crucial that consulting
clinicians be involved in the pre-laboratory set up (sample collection to ensure proper
collection and storage before despatch to the laboratories) and in the post-laboratory results
(identification of the organisms and the proper treatment options).
4.12 Conclusion
A broad-range PCR protocol was developed and optimised that was able to detect
bacterial 16S rDNA using Pan-bacterial specific primers, and Gram-type using Gram-
positive and Gram-negative specific primers. Sequencing and sequence analyses of the
amplified DNA were able to provide higher order identification of bacteria without the need
for cultivation. The optimised 16S rDNA PCR and sequencing assay can be applied for use
on various clinical samples in a routine clinical diagnostic laboratory, albeit with
limitations, most notably regarding the sensitivity of the method and issues with analyses
using the public database.
The broad-range 16S rDNA could be prone to contamination, and this was
prevented by good laboratory practices, dedicated material and preparatory areas, and
inclusion of positive and negative controls to detect false-positive and false-negative results.
Extraction methods were chosen using a qualitative complexity ranking of the method and
observation of the results obtained from the DNA amplification of the extracted samples.
The boiling method was found to be effective for CSF samples, AH method for BCB and
PF samples, and DNAzol for SF samples. Commercial kits were not used due to cost and
contamination issues, and the PCIA method was not preferred due to the use of highly toxic
materials, and the high cost of waste removal. The extraction methods developed were
166
Discussion
adequate for this study but a more standardised and sensitive extraction method should be
evaluated and optimised e.g. using mechanical disruption as a method to improve the
sensitivity of PCR detection of Gram-positive bacteria.
The Gram-positive and Gram-negative primer pairs required high-stringency
conditions when placed together in the same reaction. As this affected the sensitivity of the
method, the two primer sets were subsequently separated into separate reactions. The
optimised duplex PCR for Pan and Gram-positive specific PCR detected 10 pg of
Staphylococcus aureus DNA while the Gram-negative specific PCR detected 10 pg of
Escherichia coli DNA. The Gram-positive and Gram-negative specific primers were able to
differentiate 12 pure culture samples with known identities into their respective Gram-
types. Also, the Gram-typing results of PCR-positive clinical samples were in agreement
with the results by culture. Therefore, Gram-typing by PCR was suitable for differentiating
organisms into Gram-type, and the results were available on the same day (about 5 hours
total) or by the next day. This will allow sufficient information to begin preliminary
antibiotic therapy.
A major drawback of the method was using the 16S rDNA analysis to determine
bacterial identification to species level. While the method is sound for higher order
identification, there were problems in resolving the species identity (and on occasion genus
identity) for organisms within the family Enterobacteriaceae and the genus Staphylococcus.
The 16S rDNA analysis was not as useful as phenotypic characterization for common
bacteria like the Staphylococci that are easily classified by coagulase test and Klebsiella-
Enterobacter that are differentiated by motility. These problems are inherent to using this
gene for gene analyses, thereby other genes could be suggested to replace or enhance the
usage of 16S rDNA gene analyses.
167
Discussion
Analyses using the public database were also problematic as anyone could upload
sequences, some of which are unpublished and unverifiable. For adequate understanding of
the results obtained by Gram-typing and bacterial identification, there is a need for an
understanding of prokaryotic taxonomy and clinical microbiology (to evaluate if the sample
is a probable contamination or has clinical implications), which could make the method
difficult as a routine diagnostic assay.
The overall specificity of the 16S rDNA PCR and sequence analyses was high at
95.54% with a NPV of 95.1%, while the overall sensitivity was 67.74% with a PPV of 70%.
The 16S rDNA PCR assays were in agreement with culture results in 91.8% of the samples.
Of the four sample types, the type that best matches culture results using the 16S rDNA
assay was the BCB samples as the BCB is a culture medium and after incubation, the
bacterial count is generally high enough to support PCR detection.
There were no unusual organisms found in culture-negative clinical specimens. The
clinical significance of the DNA found in PCR-positive samples obtained from culture-
negative infections could not be determined. More details on the patient case history should
be obtained in future studies involving the same methods.
The 16S rDNA PCR assay in this study had been found to be useful for rapid Gram-
typing of bacteria in patient samples, but bacterial identification via sequencing and
analyses was not as useful or reliable as expected when used in a routine microbiology
laboratory diagnostic capacity. However, sequencing analyses can be helpful in cases where
other methods fail in identifying the organism, as it provides useful information for
identification to higher order taxa.
168
Appendices
Appendices
Appendix A- Lists of Chemicals, Media, Kits and Equipment
Chemicals
Trizma hydrochloride, Tris-HCl

Sigma, USA.
Lysozyme
Isoamyl alcohol
Natrium hydroxide, NaOH
Boric acid
Merck, Germany
Chloroform
Absolute ethanol
Tris base (Molecular Biology Grade)

Promega, USA.
Agarose LE Grade
Disodium ethylenediaminetetraacetic acid, EDTA

Univar, Australia
Sodium chloride, NaCl
Buffer-saturated Phenol
Invitrogen, Ca, USA
Ethidium bromide (10 mg/ml)
Proteinase K
Tri-sodium citrate
Sodium Dodecyl Sulphate, SDS BDH Lab, England
Sodium acetate
DNAzol Molecular Research Centre, Ohio USA

Appendices
Media
Luria-Bertani (LB) broth Gibco BRL, USA
Nutrient agar Media room, UMMC Microbiology Diagnostic Laboratories
Kits
Taq polymerase (recombinant, 1U/µl), supplied with
-10x PCR buffer with (NH4)2SO4 and
-25mM MgCl2
Fermentas
Deoxynucleotide triphosphates, dNTPs
-(dGTP, dATP, dTTP and dCTP)
MassRuler (DNA ladder, Mix)
6x Mass Loading Dye Solution from Fermentas
MinElute PCR Purification Kit Qiagen
Equipment
Buffer tank (Easy-cast Electrophoresis Systems) Owl Scientific Plastics Inc., Cambridge USA
Power supply pack (EC 250-90 EC Apparatus Corporation) Biodiagnostics Sdn Bhd, Malaysia
UV lightbox (Fotoprep Transilluminator) Fotodyne, USA
Polaroid Camera Polaroid, UK
BioPhotometer Eppendorf, Hamburg
Thermal Cycler PTC-100 MJ Research Instrument Inc., USA

Appendices
Appendix B- Preparation of Media, Stocks and Buffers
Luria-Bertani (LB) Broth

Use: 25 g LB broth powder
Add 1L of sddH2O. Measure into 100 or 250 ml Schott Bottles and sterilize by autoclaving.
Store at room temperature for up to 1 month (or 10 days when open).
Alkali Wash Solution

(0.5 M NaOH, 0.05 M sodium citrate/tri-sodium citrate)
Use: 2 g NaOH (MW~ 40.00)
1.47g tri-sodium citrate (MW~294.1)
Add sddH2O to make 100 ml of solution and store at room temperature for up to 3 months.
0.5 M Tris-HCl (pH 8.0)

Use: 7.88g Tris-HCl (MW~157.6)
TE (Tris-EDTA) Buffer (10/10 mM)

(1 M Tris-HCl, 0.5 M EDTA)
Use: 0.3941 g Tris-HCl (MW~ 167.64)
0.9306 g EDTA (MW~372.24)
Appendices
l0% SDS
Use: 1g SDS
Add 10 ml of sddH2O, mix gently and store at room temperature for up to 3 months.
10 mg/ml Proteinase K
Use: 0.01 g Proteinase K
Add 1 ml of sddH2O. Prepare in 1.5 ml Eppendorf tubes and store at -20°C for 3 months.
10 mg/ml lysozyme
Use: 0.01 g lysozyme
Add 1 ml of sddH2O. Prepare in 1.5 ml Eppendorf tubes and store at -20°C for 3 months.
Chloroform-isoamyl alcohol (24:1)

To every 24 ml of chloroform, add 1 ml of isoamyl alcohol.
4.0M NaCl
Use: 2.338 g NaCl (MW~58.44)
Add 10 ml of sddH2O and store at room temperature for up to 3 months.
70% ethanol
To every 70 ml of ethanol, add 30 ml of sddH2O.
Appendices
TE (Tris-EDTA) buffer pH 8.0

Use: 10 mM Tris-HCl [1 ml of 1M stock, pH 8.0]
1 mM EDTA [200 ul of 0.5M stock, pH 8.0]
Add 100 ml of sddH2O. Filter and store at room temperature for up to 3 months.
1.0 M Tris, pH 8.0

Use: 60.57 g Tris
Add 350 ml of ddH2O. Adjust pH to 8.0 with concentrated HCl. Bring to 500 ml with
ddH2O. Filter and store at room temperature for up to 3 months.
0.5 M EDTA, pH 8.0

Use: 93.05 g EDTA
Add 350 ml of sddH2O. Stir vigorously on a magnetic stirrer and stir vigorously. Adjust the
pH to 8.0 by adding approximately NaOH pellets. Bring to 500 ml with sdd H2O. Filter and
store at room temperature for up to 3 months.
5X TBE (Tris-Borate EDTA) buffer, pH 8.0

(0.45M Tris-borate, 0.01M EDTA in stock)
Use: 54g Tris base
27.5g Boric Acid
Dissolve using 20 ml of 0.5M EDTA (pH 8.0). Add sddH2o to make 1 L. Store at room
temperature for 3 months.
Appendices
Appendix C- Primer Location on the 16S rRNA
Key: Primers
f3p
f4n
nf
r18n
r18n and NR overlap
NR
Figure AppC: The location of the primers used in this study on a higher-order structure model
for Escherichia coli 16S rRNA that was obtained from Gutell et al. (1994).
Appendix C
Appendices
Appendix D
Examples of
Electropherograms
from the DNA Sequencing
of Pure Culture Samples
Appendix D- Examples of Electropherograms from the DNA Sequencing of Pure Culture Samples
Figure AppD-1: Electropherogram from the DNA sequencing of 16S rDNA obtained from the Staphylococcus aureus (PC041) pure culture
sample.
Appendix D-1
Figure AppD-2: Electropherogram from the DNA sequencing of 16S rDNA obtained from the Enterococcus faecalis (PC022) pure culture
sample.
Appendix D-2
Figure AppD-3: Electropherogram from the DNA sequencing of 16S rDNA obtained from the Escherichia coli (PC039) pure culture sample.
Appendix D-3
Figure AppD-4: Electropherogram from the DNA sequencing of 16S rDNA obtained from the Haemophilus influenzae (PC017) pure culture
sample.
Appendix D-4
Appendices
Appendix E
Table AppE:
The results of Gram-positive (GP),
Gram-negative (GN),
and Pan specific primers PCR on the
233 clinical samples studied.
Table AppE: The results of Gram-positive (GP), Gram-negative (GN) and
Pan specific primers PCR on the 233 clinical samples studied.
Culture Results PCR-typing Results*

Sample Organism Identified
No. Name Gram-type GP GN Pan Overall
1 C 001 None N/A No No No None detected
2 C 003 Streptococcus sp. Positive Yes No Yes Gram-type positive
13 C 016 None N/A Yes No Yes Gram-type positive
21 C 027 None N/A No Yes Yes Gram-type negative
*The Yes/No in this section refers to the presence or absence of amplicons when the PCR
reaction contains Gram-positive (GP), Gram-negative (GN) or Pan specific primers. The overall
results refer to the Gram-type of the organism as deduced from the PCR reactions.
Appendix E-1
Culture Results PCR-typing Results

Sample
Organism Identified
39 C 048 Enterococcus sp. Positive No No No None detected
56 C 065 Enterobacter sp. Negative No Yes Yes Gram-type negative
58 C 067 None N/A No Yes Yes Gram-type negative
77 C 089 Klebsiella pneumoniae Negative No Yes Yes Gram-type negative
78 C 090 Staphylococcus aureus Positive No No No None detected
Appendix E-2

Sample
Organism Identified
80 P 001 None N/A No No No None detected
81 P 002 Escherichia coli Negative No Yes Yes Gram-type negative
83 P 004 Enterococcus sp. Positive Yes No Yes Gram-type positive
85 P 007 Acinetobacter baumanii Negative No Yes Yes Gram-type negative
91 P 014 Pseudomonas aeruginosa Negative No Yes Yes Gram-type negative
93 P 017 Staphylococcus aureus Positive Yes No Yes Gram-type positive
96 P 020 None N/A No Yes Yes Gram-type negative
103 P 029 Enterococcus sp. Positive Yes No Yes Gram-type positive
104 P 030 Staphylococcus aureus Positive No No No None detected
115 P 042 Pseudomonas aeruginosa Negative No No No None detected
118 P 045 Klebsiella pneumoniae Negative No Yes Yes Gram-type negative
Appendix E-3

Sample
Organism Identified
124 P 051 Group G Streptococci Positive Yes No Yes Gram-type positive
125 P 052 Acinetobacter baumanii Negative No No No None detected
136 P 063 Klebsiella sp. Negative No Yes Yes Gram-type negative
139 P 066 Escherichia coli Negative No No No None detected
143 S 001 None N/A No No No None detected
152 S 010 None N/A No Yes Yes Gram-type negative
159 S 017 None N/A Yes No Yes Gram-type positive
Appendix E-4

Sample
Organism Identified
175 S 033 None N/A No Yes Yes Gram-type negative
185 B 001 None N/A No No No None detected
Appendix E-5

Sample
Organism Identified
203 B 019
None N/A No No No None detected
204 B 020
205 B 021
206 B 022
207 B 023
208 B 024
209 B 025
210 B 026
211 B 027
212 B 028
213 B 029
214 B 030
215 B 031
216 B 032
217 B 033
218 B 034
219 B 035
220 B 036
221 B 037
222 B 038
223 B 039
224 B 040
Coagulase negative
225 B 073 Staphylococci Positive Yes No Yes Gram-type positive
Coagulase negative
226 B 074 Staphylococci Positive Yes No Yes Gram-type positive
227 B 076 Gram-negative rod Negative No Yes Yes Gram-type negative
228 B 077 Bacillus sp. Positive No No No None detected
229 B 078 Acinetobacter baumanii Negative No Yes Yes Gram-type negative
230 B 079 Acinetobacter baumanii Negative No Yes Yes Gram-type negative
231 B 080 Salmonella enteritidis Negative No Yes Yes Gram-type negative
232 B 081 Bacillus sp. Positive No No No None detected
233 B 082 Klebsiella pneumoniae Negative No Yes Yes Gram-type negative
Appendix E-6
Appendices
Appendix F
Examples of
Electropherograms
from the DNA Sequencing
of the PCR-positive
Clinical Samples
Appendix F- Examples of Electropherograms from the DNA Sequencing of the PCR-positive Clinical Samples.
Figure AppF-1: Electropherogram from the DNA sequencing of 16S rDNA obtained from a cerebrospinal fluid sample (C003).
Appendix F-1
Figure AppF-2: Electropherogram from the DNA sequencing of 16S rDNA obtained from a blood culture bottle sample (B073).
Appendix F-2
Figure AppF-3: Electropherogram from the DNA sequencing of 16S rDNA obtained from a peritoneal fluid sample (P045).
Appendix F-3
Figure AppF-4: Electropherogram from the DNA sequencing of 16S rDNA obtained from a synovial fluid sample (S010).
Appendix F-4
Appendices
Appendix G- Calculation of the Number of Escherichia coli cells
detected by DNA amplification in this study.
It is given that:
1. Escherichia coli K12 (reference strain MG1655) consists of 4,639,221 bp from a
single circular DNA molecule (no plasmids) and has 7 rRNA gene operons (Blattner
et al., 1997).
2. 1 pmol of double-stranded DNA that is 1kb in size weighs 0.66 µg.
3. 1 pmol of double-stranded DNA that is 1kb in size contains 6.02x1011 genomes.
Therefore:
1 pmol of E. coli DNA that is 1 kb in size
= 4, 639.221 kb x 0.66 µg
= 3, 061.89 µg
The lowest detection limit for the Gram-negative specific primer on E. coli DNA is 10 pg
per 5 µl of sample (Section 3.4) or 2 pg/µl or 2x10-3 µg/ml.
Number of genomes in 2x10-3 µg/ml of E. coli DNA
= 2x10-3 x 6.02x1011
3, 061.89
= 3.93x105 genome/ml
Number of genomes in 5 µl of E. coli template solution is 1,965 genomes.

References
References
Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W., and. Lipman,
D.J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs, Nucleic Acids Res. 25: 3389-3402.
Amann, R.I., Ludwig, W., and Schleifer, K.-H. (1995). Phylogenetic identification and in
situ detection of individual microbial cells without cultivation. Microbiol. Rev., 59(1): 143-
169.
Aoyagi, K. (2001). Chapter 11: PCR. IN Gerstein, A.S. (Ed.), Molecular Biology Problem
Solver: A laboratory guide. New York: Wiley-Liss. pg 291-329.
Bale, M.J., McLaws, B.M., and Matsen, J.M. (1985). The spot indole test for identification
of warming Proteus. Am. J. Clin. Pathol., 83(1): 87-90.
Barenfanger, J., Drake, C., and Kacich, G. (1999). Clinical and financial benefits of rapid
bacterial identification and antimicrobial susceptibility testing. J. Clin. Microbiol., 37(5):
1415-1418.
Bergogne-Bérézin, E., and Towner, K.J. (1996). Acinetobacter spp. as nosocomial

pathogens: microbiological, clinical, and epidemiological features. Clin. Microbiol. Rev.,
9(2): 148-165.
Blattner, F.R., Plunkett, G. III, Bloch, C.A., Perna, N.T., Burland, V., Riley, M., Collado-
Vides, J., Glasner, J.D., Rode, C.K., Mayhew, G.F., Gregor, J., Davis, N.W., Kirkpatrick,
H.A., Goeden, M.A., Rose, D.J., Mau, B., and Shao, Y. (1997). The complete genome
sequence of Escherichia coli K-12. Science, 277 (5331): 1453 – 1462.
Boone, D.R., Liu, Y., Zhao, Z-J., Balkwill, D.L., Drake, G.R., Stevens, T.O., and Aldrich,
H.C. (1996). Bacillus infernus sp. nov., an Fe(III)- and Mn(IV)-Reducing Anaerobe from
the Deep Terrestrial Subsurface. Int. J. Syst. Bacteriol., 45(3): 441-448.
Burkardt, H.-J. (2000). Standardization and quality control of PCR analyses. Clin. Chem.
Lab. Med., 38(2): 87-91.
References
Carroll, N.M., Adamson, P, and Okhravi, N. (1999). Elimination of bacterial DNA from
Taq polymerases by restriction endonuclease digestion. J. Clin. Microbiol., 37(10): 3402-
3404.
Carroll, N.M., Jaeger, E.E.M., Choudhury, S., Dunlop, A.A.S., Matheson, M.M., Adamson,
P., Okhravi, N., and Lightman, S. (2000). Detection of and discrimination between Gram-
positive and Gram-negative bacteria in intraocular samples by using nested PCR. J. Clin.
Microbiol., 38(5): 1753-1757.
Chomczynski, P., Mackey, K., Drews, R., and Wilfinger, W. (1997). DNAzol: a reagent for
the rapid isolation of genomic DNA. Biotechniques, 22(3):550-3.
Christensen, H., Nordentoft, S., and Olsen, J.E. (1998). Phylogenic relationship of
Salmonella based on rRNA sequencing. Int. J. Syst. Bacteriol., 48: 605-610.
Clarridge, J.E.III, Attorri, S., Musher, D.M., Hebert, J., and Dunbar, S. (2001).
Streptococcus intermedius, Streptococcus constellatus, and Streptococcus anginosus
(“Streptococcus milleri Group”) are of different clinical importance and are not equally
associated with abscess. Clin. Infect. Dis., 32: 1511-1515.
Clayton, R.A., Sutton, G., Hinkle, P.S.Jr., Bult, C., and Fields, C. (1995). Intraspecific
variation in small-subunit rRNA sequences in GenBank: why single sequences may not
adequately represent prokaryotic taxa. Int. J. Syst. Bacteriol., 45(3): 595-599.
Cole, J.R., Chai, B., Farris, R.J., Wang, Q., Kulam, S.A., McGarrell, D.M., Garrity, G.M.,
and Tiedje, J.M. (2005) The Ribosomal Database Project (RDP-II): sequences and tools for
high-throughput rRNA analysis. Nucleic Acids Res., 33(Database Issue):D294-D296.
Corless, C.E., Guiver, M., Borrow, R., Edwards-Jones, V., Kaczmarski, E.B., and Fox, A.J.
(2000). Contamination and sensitivity issues with a real-time universal 16S rRNA PCR. J.
Clin. Microbiol., 38(5): 1747-1752.
Dajcs, J.J., Clark, L.L., Karr, D.L., Bartel,l J.G., and Stroman D.W. (2005). Staphylococcus
croceolyticus sp. nov., a new coagulase-negative species isolated from otic infections.
Unpublished data; GenBank Sequence ID S000514602.
Dan G.R., Wei H., and Yuan J. (2005). Identification and isolation of bacteria from
probiotic products. Unpublished data; GenBank Sequence ID S000627085 and
S000627086.
References
Doern, G.V., Vautour, M., Gaudet, M., and Levy, B. (1994). Clinical impact of rapid in
vitro susceptibility testing and bacterial identification. J. Clin. Microbiol., 32: 1757-1762.
Drancourt, M., Berger, P., and Raoult, D. (2004). Systematic 16S rRNA gene sequencing of
atypical clinical isolates identified 27 new bacterial species associated with humans. J. Clin.
Microbiol., 42(5): 2197-2202.
Drancourt, M., Bollet, C., Carlioz, A., Martelin, R., Gayral, J.-P., and Raoult, D. (2000).
16S ribosomal DNA sequence analysis of a large collection of environmental and clinical
unidentifiable bacterial isolates. J. Clin. Microbiol., 38 (10): 3623-3630.
Drancourt, M., and Raoult, D. (2002). rpoB gene sequence-based identification of

Staphylococcus species. J. Clin. Microbiol., 40(4): 1333-1338.
Eckburg, P.B., Bik, E.M., Bernstein, C.N., Purdom, E., Dethlefsen, L., Sargent, M., Gill,
S.R., Nelson, K.E., and Relman, D.A. (2005). Diversity of the human intestinal microbial
flora. Science, 308(5728): 1635 – 1638.
Eckburg, P.B., Lepp, P.W., and Relman, D.A.(2003). Archaea and their potential role in
human disease. Infect. Immun., 71(2): 591-596.
Edwards, U., Rogall, T., Blöcker, H., Emde, M., Böttger, E.C. (1989). Isolation and direct
complete nucleotide determination of entire genes. Characterization of a gene coding for
16S ribosomal RNA. Nucleic Acids Res., 17(19): 7843-7853
Evans, G.E., Murdoch, D.R., Anderson, T.P., Potter, H.C., George, P.M., Chambers. S.T.
(2003). Contamination of Qiagen DNA extraction kits with Legionella DNA. J. Clin.
Microbiol., 41(7): 3452-3453.
Farmer, J.J.III, Davis, B.R., Hickman-Brenner, F.W., McWhorter, A., Huntley-Carter, G.P.,
Asbury, M.A., Riddle, C., Wathen-Grady, H.G., Elias, C., Fanning,G.R., Steigerwalt, A.G.,
O’Hara, C.M., Morris, G.K., Smith, P.B., and Brenner, D.J. (1985a). Biochemical
identification of new species and biogroups of Enterobacteriaceae isolated from clinical
specimens. J. Clin. Microbiol., 21(1): 46-76.
Farmer, J.J.III, Fanning,G.R., Davis, B.R., O’Hara, C.M., Riddle, C., Hickman-Brenner,
F.W., G.P., Asbury, Lowery, A.III, and Brenner, D.J. (1985b). Escherichia fergusonii and
Enterobacter taylorae, two new species of Enterobacteriaceae isolated from clinical
specimens. J. Clin. Microbiol., 21(1): 77-81.
References
Farrelly, V., Rainey, F.A., and Stackebrandt, E. (1995). Effect of genome size and rrn copy
number on PCR amplification and 16S rRNA genes from a mixture of bacterial species.
Appl. Env. Microbiol., 61(7): 2798-2801.
Fogel, G.B., Collins, C.R., Li, J., and Brunk, C.F. (1999). Prokaryotic genome size and SSU
rDNA copy number: estimation of microbial abundance from a mixed population. Microb.
Ecol., 38: 93-113.
Fox, G.E., Wisotzkey, J.D., and Jurtshuk, P. Jr. (1992). How close is close: 16S rRNA
sequence identity may not be sufficient to guarantee species identity. Int. J. Syst. Bacteriol.,
42(1): 166-170.
Fredricks, D.N., Fiedler, T.L., and Marrazzo, J.M. (2005). Molecular identification of
bacteria associated with bacterial vaginosis. N. Eng. J. Med., 353(18): 1899-1911.
Fredricks, D.N. and Relman, D.A. (1998).Improved amplification of microbial DNA from
blood cultures by removal of the PCR inhibitor sodium polyanetholesulfonate. J. Clin.
Microbiol., 36(10): 2810-2816.
Fredricks, D.N. and Relman, D.A. (1996). Sequence-based identification of microbial

pathogens: a reconsideration of Koch’s Postulates. Clin. Microbiol. Rev., 9(1): 18-33.
Garrity, G.M., Bell, J.A., Lilburn, T.G. (2004). Taxonomic outline of the Prokaryotes
Release 5.0. Bergey’s Manual of Systematic Bacteriology, 2nd edn. New York: Bergey’s
Manual Trust. Retrieved from the World Wide Web: DOI 10.1007/bergeysoutline200405.
Goldenberger, D., Kunzli, A., Vogt, P., Zbinden, R., and Altwegg, M. (1997). Molecular
diagnosis of bacterial endocarditis by broad-range PCR amplification and direct sequencing.
J. Clin. Microbiol., 35(11): 2733-2739.
Gould., I.M. (1999). A review of the role of antibiotic policies in the control of antibiotic
resistance. J. Antimicrob. Chemoth., 43: 459-465.
Greenfield, L., and White, T.J. (1993). Chapter 6: Sample Preparation Methods. IN Persing,
D.H., Tenover, F.C., Smith, T.F., White, T.J. (Eds.). Diagnostic Molecular Biology:
pinciples and applications. Washington D.C.: American Society for Microbiology. pg 122-
137.
References
Greisen. K., Loeffelholz, M., Purohit, A., and Leong, D. (1994). PCR primers and probes
for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in
cerebrospinal fluid. J. Clin. Microbiol., 32(2): 335-351.
Gutell, R.R., Larsen, N., and Woese, C.R. (1994). Lessons from an evolving rRNA: 16S
and 23S rRNA structures from a comparative perspective. Microbiol. Rev., 58(1): 10-26.
Hanage, W.P., Fraser, C., and Spratt, B.G. (2005). Fuzzy species among recombinogenic
bacteria. BMC Biology, 3:6
Hansen, M.C., Tolker-Nielsen, T., Givskov, M., and Molin, S. (1998). Biased 16S rDNA
PCR amplification caused by interference from DNA flanking the template region. FEMS
Microbiol. Ecol., 26: 141-149.
Harris, K.A., and Hartley, J.C. (2003). Development of broad-range 16S rDNA PCR for use
in the routine diagnostic clinical microbiology service. J. Med. Microbiol., 52: 685-691.
Houpikian, P. and Raoult, D. (2002). Traditional and molecular techniques for the study of
emerging bacterial diseases: one laboratory’s perspective. Emerg. Infect. Dis. 8(2): 122-131.
Hugenholtz, P., Goebel, B.M., and Pace, N.R. (1998). Impact of culture-independent studies
on the emerging phylogenetic view of bacterial diversity. J. Bacteriol., 180(18): 4765-4774.
Hugenholtz, P., and Huber, T. (2003). Chimeric 16S rDNA sequences of diverse origins are
accumulating in the public databases. Int. J. Syst. Evol. Microbiol., 53: 289-293.
Inan, D., Saba, R., Gunseren, F., Ongut, G., Turhan, O., Yalcin, A.N., Mamikoglu, L.
(2005). Daily antibiotic cost of nosocomial infections in a Turkish university hospital. BMC
Infect. Dis., 5:5-10.
Jalava, J., Kotilainen, P., Nikkari, S., Skurnik, M., Vanttinen, E., Lehtonen, O.-P., Eerola,
E., and Toivanen, P. (1995). Use of the polymerase chain reaction and DNA sequencing for
the detection of Bartonella quintana in the aortic valve of a patient with culture-negative
infective endocarditis. Clin. Infect. Dis., 21: 891-986.
Janda, J.M, and Abbott, S.L. (2002). Bacterial identification for publication: when is
enough enough? J. Clin. Microbiol., 40(6): 1887-1891.
References
Jaspers, E., and Overmann, J. (2004). Ecological significance of microdiversity: identical

16S rRNA gene sequences can be found in bacteria with highly divergent genomes and
ecophysiologies. Appl. Environ. Microb., 70(8): 4831-4839.
Kawamura, Y., Itoh, Y., Mishima, N., Ohkusu, K., Kosai, H., and Ezaki, T. (2005). High
genetic similarity of Streptococcus agalactiae and Streptococcus difficilis: S. difficilis Eldor
et al. 1995 is a later synonym of S. agalactiae Lehmann and Neumann 1896 (Approved
Lists 1980). Int. J. Syst. Evol. Microbiol., 55: 961-965.
Klaschik, S., Lehmann, L.E., Raadts, A., Book, M., Hoeft, A, Stuber, F. (2002). Real-time
PCR for detection and differentiation of Gram-positive and Gram-negative bacteria. J. Clin.
Microbiol., 40(11): 4304-4307.
Klausegger, A., Hell, M., Berger,A., Zinober, K., Baier, S., Jones, N., Sperl, W., and
Kofler, B. (1999). Gram type-specific broad-range PCR amplification for rapid detection of
62 pathogenic bacteria. J. Clin. Microbiol., 37(2): 464-466.
Kotilainen, P., Jalava, J., Meurman, O., Lehtonen, O.-P., Rintala, E., Seppala, O.-P., Eerola,
E., and Nikkari, S. (1998). Diagnosis of meningococcal meningitis by broad-range bacterial
PCR with cerebrospinal fluid. J. Clin. Microbiol., 36(8): 2205-2209.
Kulski, J.K., and Pryce, T. (1996). Preparation of mycobacterial DNA from blood culture
fluids by simple alkali wash and heat lysis method for PCR detection. J. Clin. Microbiol.,
34(8): 1985-1991.
Kwok, A.Y.C., Su, -C., Reynolds, R.P., Bay, S.J., Av-Gay, Y., Dovichi, N.J., and Chow,
A.W. (1999). Species identification and phylogenetic relationships based on partial HSP60
gene sequences within the genus Staphylococcus. Int. J. Syst. Bacteriol., 49: 1181-1192.
La Scola, B., Fenollar, F., Fournier, P.-E., Altwegg, M., Mallet, M.-N., Raoult, D. (2001).
Description of Tropheryma whipplei gen. nov., sp. nov., the Whipple’s disease bacillus. Int.
J. Syst. Evol. Micr., 51: 1471-1479.
Logan, N. A. Forsyth, G., Lebbe, L., Goris, J., Heyndrickx, M., Balcaen, A., Verhelst, A.,
Falsen, E., Ljungh, Å, Hansson, H.B., and De Vos, P. (2002). Polyphasic identification of
Bacillus and Brevibacillus strains from clinical, dairy and industrial specimens and proposal
of Brevibacillus invocatus sp. nov. Int. J. Syst. Evol. Micr., 52: 953–966.
References
Lu, J., Nogi, Y., and Takami, H. (2001). Oceanobacillus iheyensis gen. nov., sp. nov., a
deep-sea extremely halotelarant and alkaliphilic species isolated from a depth of 1050 m on
the Iheya Ridge. FEMS Microbiol. Lett., 205: 291-297.
Madigan, M.T., Martinko, J.M., and Parker, J. (Eds.). (1997). Macromolecules and
Molecular Genetics. IN Brock: Biology of Microorganisms (8th Ed.). New Jersey: Prentice-
Hall. pp 178-225.
Maidak, B.L., Larsen, N., McCaughey, M.J., Overbeek, R., Olsen, G.J., Fogel, K., Blandy,
J., and Woese, C.R. (1994). The Ribosomal Database project. Nucl. Acids Res., 22: 3485-
3487.
Mariani, B.D., Martin, D.S., Levine, M.J., Booth, R.E.Jr., and Tuan, R.S. (1996).
Polymerase chain reaction detection of bacterial infection in total knee arthroplasty. Clin.
Orthop. 331: 11-22.
Meier, A., Persing, D.H., Finken, M., and Böttger, E.C. (1993). Elimination of
contaminating DNA within Polymerase Chain Reaction reagents: implications for a general
approach to detection of uncultured pathogens. J. Clin. Microbiol., 31(3): 646-652.
Millar, B.C., Xu, J., Moore, J.E. (2002). Risk assessment models and contamination
management: implications for broad-range ribosomal DNA PCR as a diagnostic tool in
medical bacteriology. J. Clin. Microbiol., 40(5): 1575-1580.
Millar, B.C., Xu, J., Moore, J.E. and Earle, J.A.P. (2000). A simple and sensitive method to
extract bacterial, yeast and fungal DNA from blood culture material. J. Microbiol. Meth.,
42: 139-147.
Monstein, H.-J., Quednau, M., Samuelsson, A., Ahrne, S., Isaksson, B., and Jonasson, J.
(1998). Division of the genus Enterococcus into species groups using PCR-based molecular
typing methods. Microbiology, 144: 1171-1179.
Moreira, J.L., Mota, R.M., Horta, H.F., Teixeira, S.M.R., Neumann, E., Nicoli, J.R., and
Nunes, Á.C. (2005). Identification to the species level of Lactobacillus isolated in probiotic
prospecting studes of human, animal or food origin by 16S-23S rRNA restriction profiling.
BMC Microbiology, 5:15.
Nikkari, S., Lopez, F.A., Lepp, P.W., Cieslak, P.R., Ladd-Wilson, S., Passaro.D., Danila,R.,
and Relman, D.A. (2002). Broad-range bacterial detection and the analysis of unexplained
death and critical illness. Emerg. Infect. Dis. 8(2): 188-194.
References
Nikkari, S., McLaughlin, I.J., Bi, W., Dodge, D.E., and Relman, D.A. (2001). Does blood
of healthy subjects contain bacterial ribosomal DNA? J. Clin. Microbiol., 39(5): 1956-1959.
Pavan, M.E., Franco, R.J., Rodriguez, J.M., Gadaleta, P., Abbott, S.L., Janda, JM., and
Zorzópulos, J. (2005). Phylogenetic relationships of the genus Kluyvera: transfer of
Enterobacter intermedius Izard et al. 1980 to the genus Kluyvera as Kluyvera intermedia
comb. nov. and reclassification of Kluyvera cochleae as a later synonym of K. intermedia.
Int. J. Syst. Evol. Microbiol., 55: 437-442.
Peel, M.M., Alfredson, D.A., Gerrard, J.G., Davis, J.M., Robson, J.M., McDougall, R.J.,
Scullie, B.L., Akhurst, R.J. (1999). Isolation, identification, and molecular characterization
of strains of Photorhabdus luminescens from infected humans in Australia. J. Clin.
Microbiol., 37(11): 3647-3653.
Perkins, B.A., Flood, J.M., Danila, R., Holman, R.C., Reingold, A.L., Klug, L.A., Virata,
M., Cieslak, P.R., Zaki, S.R., Pinner, R.W., Khabbaz, R.F., and the Unexplained Deaths
Working Group. (1996). Unexplained deaths due to possibly infectious causes in the United
States: defining the problem and designing surveillance and laboratory approaches. Emerg.
Infect. Dis., 2(1): 47-53.
Podzorski, R.P. and Persing, D.H. (1995). Molecular detection and identification of
microorganisms. IN Murray, P.R., Baron, E.J., Pfaller, M.A, Tenover, F.C., and Yolken
F.C.(Eds.) Manual of clinical microbiology (6th Ed). Washington: ASM. pp.130-157.
Polz, M.F., and Cavanaugh, C.M. (1998). Bias in template-to-product ratios in

multitemplate PCR. Appl. Env. Microbiol., 64(10): 3724-3730.
Qian, Q., Tang, Y.-W., Kolbert, C.P., Torgerson, C.A., Hughes, J.G., Vetter, E.A.,
Harmsen, W.S., Montgomery, S.O., Cockerill, F.R. III, and Persing, D.H. (2001). J. Clin.
Microbiol., 39(10): 3578-3582.
Rantakokko-Jalava, K., and S., Jalava (2002). Optimal DNA isolation method for detection
of bacteria in clinical specimens by broad-range PCR. J. Clin. Microbiol., 40(11): 4211-
4217.
Rantakokko-Jalava, K., Nikkari, S., Jalava, J., Eerola, E., Skurnik, M., Meurman, O.,
Ruuskanen, O., Alanen, A., Kotilainen, E., Toivanen P., and Kotilainen, P. (2000). Direct
amplification of rRNA genes in diagnosis of bacterial infections. J. Clin. Microbiol., 38(1):
32-39.
Relman, D.A. (1998). Detection and identification of previously unrecognized microbial

pathogens. Emerg. Infect. Dis., 4(1): 382-389.
References
Relman, D.A. (1999). The search for unrecognized pathogens. Science, 284: 1308-1310.
Relman, D.A., Loutit, J.S., Schmidt, T.M., Falkow, S., and Tomkins. (1990). The agent of
bacillary angiomatosis- an approach to the identification of uncultured pathogens. N. Engl.
J. Med., 323: 1573-1580.
Relman, D.A., Schmidt, M.D., MacDermott, R.P., Falkow, S. (1992). Identification of the
uncultured bacillus of Whipple’s disease. N. Engl. J. Med., 327: 293-301.
Sambrook, J., Fritsch, E.F., & Maniatis, T. (1989). Molecular cloning: a laboratory manual
(2nd Ed). Cold Spring Harbor Press: NY.
Schuurman, T., de Boer, R.F., Kooistra-Smid, A.M.D., and van Zwet, A.A. (2004).
Prospective study of use of PCR amplification and sequencing of 16S ribosomal DNA from
cerebrospinal fluid for diagnosis of bacterial meningitis in a clinical setting. J. Clin.
Microbiol., 42(2): 734-740.
Sly, L.I., Cox, T.L., and Beckenham, T.B. (1999). The phylogenetic relationships of
Caulobacter. Asticcacaulis and Brevundimonasi species and their taxonomic implications.
Int. J. Syst. Bacteriol., 49: 483-488.
Stackebrandt, E. (2001). Phylogeny based on 16S rRNA/DNA. Encyclopedia of Life

Sciences. Retrieved from the World Wide Web: http://www.els.net: Nature Publishing
Group.
Stackebrandt, E., and Goebel, B.M. (1994). Taxonomic note: a place for DNA-DNA
reassociation and 16S rRNA sequence analysis in the present species definition in
bacteriology. Int. J. Syst. Bacteriol., 44(4): 846-849.
Suzuki, M., and Giovannoni, S.J. (1996). Bias caused by template annealing in the
amplification of mixtures of 16S rRNA genes by PCR. Appl. Env. Microbiol., 62(2): 625-
630.
Takeuchi, M., Hamana, K., and Hiraishi, A. (2001). Proposal of the genus Sphingomonas
sensu stricto and three new genera, Sphingobium, Novosphingobium and Sphingopyxis, on
the basis of phylogenetic and chemotaxonomic analyses. Int. J. Syst. Evol. Microbiol., 51:
1405-1417.
References
Tang, Y.-W., Ellis, N.M., Hopkins, M.K., Smith, D.H., Dodge, D.E., and Person, D.H.
(1998). Comparison of phenotypic and genotypic techniques for identification of unusual
aerobic pathogenic Gram-negative bacilli. J. Clin. Microbiol., 36(12): 3674-3679.
Tang, Y.W., Procop, G.W., and Persing, D.H. (1997). Molecular diagnostics of infectious
diseases. Clin. Chem., 43(11): 2021-2038.
Tanner, M.A., Goebel, B.M., Dojka, M.A., and Pace, N.R. (1998). Specific ribosomal DNA
sequences from diverse environmental settings correlate with experimental contaminants.
Appl. Env. Microbiol., 64(8): 3110-3113.
Tindall, B.J., Grimont, P.A.D., Garrity, G.M., and Euzéby, J.P. (2005). Nomenclature and
taxonomy of the genus Salmonella. Int. J. Syst. Evol. Microbiol., 55: 521-524.
Torsvik, V. and Øvreås, L. (2002). Microbial diversity and function in soil: from genes to
ecosystems. Curr. Opin. Microbiol., 5: 240-245.
Uitenbroek, D.G. (1997). SISA Binomial. Southampton: D.G. Uitenbroek. Retrieved

January 01, 2004, from the World Wide Web: http://home.clara.net/sisa/binomial.htm.
van der Zee, A. Peeters, M., de Jong, C., Verbakel, H., Crielaard, J.W., Claas, E.G.J.,
Templeton, K.E. (2002). Qiagen DNA extraction kits for sample preparation for Legionella
PCR are not suitable for diagnostic purposes. J. Clin Microbiol., 40(3): 1126.
Visca, P., Petrucca, A., De Mori, P., Festa, A., Boumis, E., Antinori, A., and Petrossilo, N.
(2001). Community-acquired Acinetobacter radioresistens bacteremia in an HIV-positive
patient. Emerg. Infect. Dis. 7(6): 1032-1035.
Wang, G.C.Y, and Wang, Y. (1997). Frequency of formation of chimeric molecules as a

consequence of PCR coamplification of 16S rRNA genes from mixed bacterial genomes. .
Appl. Environ. Microb., 63(12): 4645-4650.
Wang, Y., and Zhang, Z. (2000). Comparative sequence analyses reveal frequent
occurrences of short segments containing an abnormally high number of non-random base
variations in bacterial rRNA genes. Microbiology, 146: 2845-2854.
References
Whiley, R.A., Beighton, D., Winstanley, T.G., Fraser, H.Y., Hardie, J.M. (1992).
Streptococcus intermedius, Streptococcus constellatus, and Streptococcus anginosus (the
Streptococcus milleri group): association with different body sites and clinical infections. J.
Clin. Microbiol., 30(1): 243-244.
Whiley, R.A., Fraser, H., Hardie, J.M., and Beighton, D., (1990). Phenotypic differentiation
of Streptococcus intermedius, Streptococcus constellatus, and Streptococcus anginosus
Strains within the "Streptococcus milleri Group". J. Clin. Microbiol., 28(7): 1497-1501.
Wilbrink, B., van der Heijden, I.M., Schouls, L.M., van Embden, J.D.A., Hazes, J.M.W.,
Breedveld, F.C. and Tak P.P. (1998). Detection of bacterial DNA in joint samples from
patients with undifferentiated arthritis and reactive arthritis, using polymerase chain
reaction with universal 16S ribosomal RNA primers. Arthritis Rheum., 41(3): 535-543.
Wilck, M.B., Wu, Y., Howe, J.G., Crouch, J.Y., Edberg, S.C. (2001). Endocarditis caused
by culture-negative organisms visible by Brown and Brenn staining: utility of PCR and
DNA sequencing for diagnosis. J. Clin. Microbiol., 39(5): 2025-2027.
Wilkinson, N.Z., Kingsley, G.H., Jones, H.W., Sieper, J., Braun, J. and Ward, M.E. (1999).
The detection of DNA from a range of bacterial species in the joints of patients with a
variety of arthritides using a nested, broad-range polymerase chain reaction. Rheumatology,
38: 260-266.
Wilson, K.H., Blitchington, R., Frothingham, R., and Wilson, J.A. (1991). Phylogeny of the
Whipple's-disease-associated bacterium. Lancet, 338(8765):474-475.
Wilson, K.H., Blitchington, R.B., and Greene, R.C. (1990). Amplification of bacterial 16S
ribosomal DNA with polymerase chain reaction. J. Clin. Microbiol., 28(9): 1942-1946.
Woese, C.R. (1987). Bacterial evolution. Microbiol. Rev., 51: 221-227.
Yoon, J.-H., Kang, S.-S., Lee, K.-C., Lee E.S., Kho, Y.H., Kang, K.H., and Park, Y.-H.
(2001). Planomicrobium koreense gen. nov., sp. nov., a bacterium isolated from the Korean
traditional fermented seafood jeotgal, and transfer of Planococcus okeanokoites (Nakagawa
et al. 1996) and Planococcus mcmeekinii (Junge et al. 1998) to the genus Planomicrobium.
Int. J. Syst. Evol. Microbiol., 51: 1511-1520.
Zeigler, D.R. (2003). Gene sequences useful for predicting relatedness of whole genomes in
bacteria. Int. J. Syst. Evol. Microbiol., 53: 1893-1900.
References
Internet Links:
Basic Local Alignment Search Tool (BLAST; Altschul et al., 1997)

http://www.ncbi.nlm.nih.gov/BLAST/
BLAST Helpfile
http://www.ncbi.nlm.nih.gov/education/BLASTinfo/similarity.html
GenBank
http://www.ncbi.nlm.nih.gov/Genbank/
FastPCR for windows software v2.4.13 (retrieved 02 April, 2003)

http://www.biocentre.helsinki.fi/bi/bare-1_html/oligos.htm
List of Prokaryotic Names with Standing in Nomenclature (Last update: Nov 10, 2005)
http://www.bacterio.cict.fr/
Molecular Research Centre- Protocol for genomic DNA isolation

http://www.mrcgene.com/dnazol.htm
Primo Pro 3.4: PCR Primer Design software.

http://www.changbioscience.com/primo/primo.html
Ribosomal Database Project Release 9 (RDP-II; Cole et al., 2005)

http://rdp.cme.msu.edu/index.jsp
RDP-II Helpfile
http://rdp.cme.msu.edu/classifier/class_help.jsp (Classifier)
http://rdp.cme.msu.edu/seqmatch/seqmatch_help.jsp (SeqMatch)
SISA Binomial (Uitenbroek, 1997)

http://home.clara.net/sisa/binomial.htm

PCR Amplification of Bacterial DNA For The Rapid Diagnosis of Infections

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

PCR Amplification of Bacterial DNA For The Rapid Diagnosis of Infections

Uploaded by

Copyright:

Available Formats

BROAD-RANGE PCR AMPLIFICATION OF BACTERIAL DNA IN VARIOUS

CLINICAL SAMPLES FOR THE RAPID DIAGNOSIS OF INFECTIONS

DEPARTMENT OF MEDICAL MICROBIOLOGY

Gram-positive specific PCR detected 10 pg of Staphylococcus aureus DNA while the

List of Figures xiii

List of Tables xviii

List of Symbols and Abbreviations xx

1.1 The Diagnosis of Infections 2

1.1.1 The Status Quo 2

1.1.2 Rapid Diagnosis: The Benefits 3

1.1.3 The Hurdle: Drawbacks of Culture Method 4

1.1.4 A Solution: Benefits of Molecular Methods 5

1.2 Broad-range 16S rDNA Amplification and Sequencing 6

1.2.1 Polymerase Chain Reaction 6

1.2.2 Analysis of Amplification Products 9

1.2.3 Analysis of Sequencing Results 9

1.2.4 The 16S ribosomal RNA Gene (16S rDNA) 11

1.2.5 A Broad Outline of the Method 13

1.3.1 Used in the Identification of Unknown Etiologic Agents 14

1.3.2 Important Highlights Regarding the 16S rDNA 15

1.3.3 16S rDNA PCR as a Routine Clinical Diagnostic Service 17

1.3.4 16S rDNA PCR in Specific Clinical Conditions 18

1.4 Outline of the Method used in this Study 20

1.5 Objective of the Study 22

2.1.1 Bacterial Stock Culture 23

2.1.2 DNA Samples 23

2.1.3 Culture-Negative Clinical Specimen 24

2.1.4 Clinical Specimens for 16S rDNA Screening 25

2.2 General Methods 25

2.2.1 Preparation of Media and Buffers 25

2.2.3 Workflow and Special Considerations 26

2.3 Extraction Methodology 26

2.3.1 Cell Counting 26

2.3.3 Boiling Extraction Method 28

2.3.4 Lysis Buffer and Phenol Chloroform Isoamyl-Alcohol 28

2.3.5 DNAzol Extraction Method 29

2.3.6 DNA Quantification of Extracted Samples 30

2.4 PCR Primers 30

2.4.1 Designing Primers 30

2.4.2 Manufacturing Primer Oligonucleotides 31

2.4.3 Primer Profile 31

2.5 PCR, Sequencing and Analysis 34

2.5.1 Preparation of PCR Mixtures 34

2.5.2 Gel Electrophoresis of Amplified PCR Products 35

2.5.3 Min Elute PCR Purification Kit Protocol and Sequencing 36

2.5.4 Analysing Sequencing Results 37

2.5.5 Statistical Analyses 37

2.6 Determination of PCR Sensitivity 38

2.7 Determination of PCR Specificity 39

2.8 Screening of Clinical Specimens 40

PHASE I: Optimisation of Protocols

3.1 DNA Extraction 43

3.1.1 Complexity Ranking 44

3.1.2 DNA Amplification Results of Extracted Samples 45

3.1.3 Choosing the Best Extraction Methods 54

3.1.4 Lowest Detection Limit (CFU/ml) of the Extraction Methods 55

3.2 PCR Optimisation 58

3.2.1 Optimisation of Annealing Temperature 58

3.2.2 Optimisation for the Number of PCR Cycles 61

3.2.3 Optimisation of MgCl2 and Taq Polymerase Concentrations 65

3.2.4 Optimisation of Primer Concentration 74

3.2.5 Multiplex Optimisation 82

3.3 Optimisation of PCR Mixtures and Thermal Profiles 83