NANO LETTERS

Unzipping DNA Oligomers

Rupert Krautbauer, Matthias Rief,* and Hermann E. Gaub
Lehrstuhl fur Angewandte Physik & CeNS, Ludwig-Maximilians-UniVersitat Munchen, Amalienstrasse 54, 80799 Munchen, Germany
Received January 28, 2003

2003 Vol. 3, No. 4 493-496

ABSTRACT
We applied AFM-based single-molecule force spectroscopy to investigate the unziping of double-stranded DNA molecules with different sequences. The forces needed to open the double strands showed variations between 10 and 20 pN on a length scale of 10 bases. The force profiles were characteristic for each DNA sequence and could be described quantitatively using a thermodynamic equilibrium model.

In past years, direct mechanical measurements on single molecules have been reported with a number of different techniques.1-3 Because of its outstanding importance, DNA is among the most intensively studied polymeric molecules. Various studies have shown that single-molecule measurements on DNA can help to give a better understanding of the general principles of both polymer physics and DNA function and its interactions with enzymes and drug molecules.4-6 In a single-molecule experiment, force can be applied to DNA in different topologigal arrangements. When the molecule is stretched along its molecular axis, the double strand is split into two single strands at forces above 65 pN.4,5 In this study, we unzipped the double strand by pulling on the 5 and 3 ends of the two different strands of the molecule. Different groups have investigated the forces needed to unzip double-stranded DNA (dsDNA). In those studies, DNA molecules with thousands of base pairs and contour lengths of several micrometers were used.7-11 The authors showed that unzipping forces are closely correlated to the base composition of the DNA, and the resulting force pattern was described quantitatively by an equilibrium thermodynamic model.7 However, in these experiments, the sensitivity to sequence variations was limited to about 100 bases because of the thermal fluctuations in the micrometer-long polymeric linker arms connecting the double strand to the force probe. In the present study, we report unzipping experiments on shorter DNA molecules with artificial and natural sequences. We show that sequence-specific force variations can be measured with a sequence resolution of 10 base pairs using atomic force microscopy. Complementary molecules of single-stranded DNA oligomers (90 to 120 bases) were chemically coupled to the tip of an AFM cantilever and a substrate by their 5 and 3 ends, respectively, following different protocols. Aminoterminated ssDNA oligomers were coupled to aldehyde* Corresponding author. E-mail: matthias.rief@physik.uni-muenchen.de. 10.1021/nl034049p CCC: $25.00 Published on Web 03/25/2003 2003 American Chemical Society

functionalized microscope slides (Xenobind, Greiner BioOne, Frickenhausen, Germany) by incubating a 10 M solution for 10 to 20 min at ambient temperature. The remaining aldehyde groups were then saturated with ethanolamine, and the Schiff base was reduced with a solution of 0.5 mM NaBH4 in a mixture of H2O/EtOH (4:1). Thiolfunctionalized oligonucleotides were coupled to gold-coated cantilevers and substrates by incubating with a 10 M solution of unprotected SH-terminated oligomers. After a reaction time of 20 to 120 min, a larger volume of mercaptohexanol solution (1 M in H2O) was added and allowed to react overnight to saturate the gold surfaces with hydrophilic groups. This passivation of the surface was found to be essential because unsaturated gold tips cause strong nonspecific adhesion of molecules from the sample. (See also refs 6 and 12.) Hydrophobic surfaces resulted in strong adhesion forces, which inhibited measurements of force curves for small extensions because of the snapping out of contact of the cantilever. All gold surfaces were cleaned in a mixture of H2O/H2O2/NH4OH (5:1:1) at 60 to 80 C for 15 min immediately before the coupling reactions. Alternatively, coupling of SH-terminated oligomers was performed via heterofunctional poly(ethylene glycol) linkers (PEG) following the protocols of Grandbois13 and Strunz.14 The different coupling strategies resulted in comparable results. The measurements were performed in PBS buffer (pH 7.4, Sigma, Deisenhofen, Germany) containing 0.05% Tween 20. The experiment is sketched in Figure 1. As the tip approaches the surface, the complementary single strands on the tip and the surface are brought into close contact. When a double strand has formed, retracting the tip from the sample then opens this double strand in a zipperlike fashion. In the experiments, we measure the force needed to separate the two strands as a function of the extension (i.e., the distance between the tip and the sample). Following the thermodynamic equilibrium model developed by Bockelmann et al.,7,8 the whole system is described as an ensemble

Figure 1. Complementary DNA oligonucleotides are chemically attached to an AFM tip and a glass surface. As the tip is brought in contact with the surface a double strand forms, which can subsequently be unfolded upon retraction of the tip.

of cantilever spring, ssDNA linker arms, and the doublestranded part of the molecule. For this system, the force vs distance characteristics can be calculated by a full enumeration of the partition function, assuming average basepairing free energies of 3.2kBT and 5.2kBT for each AT and GC base pair, respectively.15 Figure 2a shows the calculated theoretical force versus distance curves for a dsDNA molecule with repeating blocks of 10 pure GC and 10 pure AT base pairs ([G10A10G10A10G10A10G10A10G10] [C10T10C10T10C10T10C10T10C10],16 red) and for a dsDNA molecule in which one mismatched base was included in the guanine blocks (blue). The simulation predicts that the difference between the AT and the GC blocks should result in a variation of the unzipping force of approximately 5 to 10 pN with a period of about 20 to 25 nm. Furthermore, the difference between the two molecules of only one mismatched base pair should also be detectable in the force versus distance unzipping curves. According to the equilib-

rium thermodynamic model, the sequence sensitivity of this technique is limited by the thermal fluctuations of the linking ssDNA parts between the probe and the dsDNA to be unfolded. Figure 2b shows a simulation of the unzipping curve for a 1500-base-pairs-long molecule with an alternating G10A10 sequence. It can clearly be seen that the force fluctuation decreases drastically with increasing tip-sample separation as the unzipped parts of the dsDNA now effectively increase the length the ssDNA linkers (cf. ref 17). This suggests that the simulated effects could in principle be detected in a single-molecule AFM experiment. Practically, another limiting factor is given by the thermal fluctuations of the cantilever spring, which are about 5 pN RMS for the softest commercially available cantilevers (Biolevers, Olympus) at the typical bandwidth of an AFM experiment. In our experiments, the resolution was improved beyond this value by reducing the measurement bandwidth and averaging 20 to 200 data points for each data point shown. However, the simulations show that detectable effects can be expected only for experiments under optimized noise conditions and in the regime of short extensions. The result of an experiment using complementary ssDNA molecules with alternating blocks of 10 pure GC and 10 pure AT base pairs is shown in Figure 3. The stretching curves (red) clearly show a periodic variation in force of about 5 to 10 pN and a period of about 20 to 25 nm. At smaller extensions, the curves show additional rupture events that are most likely caused by the interactions of other molecules between the tip and the surface. However, at greater extensions, the observed data is in very good agreement with the theoretically expected force pattern (green curve in Figure 3). Furthermore, the force curves upon relaxation (blue curves) are almost identical to the extension traces. The reversibility of the force spectrum is a clear indication that the responsible process is an equilibrium process on the time scale of the experiment. This also justifies the use of an equilibrium thermodynamic model, which is the basis for the simulation of the experimental curves. As can be seen from the data, the observed effects are still well above the

Figure 2. (a) Simulation of the unzipping force for an alternating A10G10 sequence with perfectly matched base pairs (red) and with a single base pair mismatch of A10G5 XG4 (blue). (b) For longer molecules, the increasing length of the flexible linker causes a decrease in the variation of the unzipping force and therefore limits the possible sequence resolution.
494 Nano Lett., Vol. 3, No. 4, 2003

Figure 3. Force vs distance curves upon unzipping a dsDNA molecule with repetitive blocks of pure AT and pure GC base pairs ([dG10dA10dG10dA10dG10dA10dG10dA10dG10][dC10dT10dC10dT10dC10 dT10dC10dT10dC10] and (a) a simulated curve (green). The force modulation is in good agreement with the calculated profiles and can clearly be resolved on the scale of 10 base pairs. (b) Two consecutive curves obtained for the same molecule show that the unzipping process is fully reversible on the time scale of the experiment.

Figure 4. Force vs distance curve upon unzipping a dsDNA molecule with an alternating sequence of 20 pure AT and 20 pure GC base pairs ([dG20dA20dG20dA20dG20]([dC20dT20dC20dT20dC20]) and a simulated curve (green). The force upon unzipping the molecule varies because of the different stability of the AT and GC base pairs. The oscillation in force seen in the data corresponds well to the force vs distance profile calculated from the equilibrium thermodynamic model.

Figure 5. Unzipping of a 90-base-pair-long dsDNA with a sequence from the lambda phage genome. The graph shows a superposition of eight curves (red), the average of these curves (dark blue), and a simulated curve (light green). The observed force variation is in good agreement with the calculated curve and can clearly be correlated to the sequence on a scale of about 10 base pairs.

noise level. Figure 4 shows the unzipping curve of a dsDNA molecule with a series of blocks with 20 pure GC and 20 pure AT base pairs ([G20A20G20A20G20][C20T20C20T20C20],18 red curve) and a simulated curve (green). The data show force variations with a period of about 40 nm, again in good agreement with the results of the simulation. Because of their modular sequence composition, all of the above-mentioned molecules may also recombine into conformations other than simple double strands when the tip is in contact with the sample. However, at large extensions, double strands are the only geometrically conceivable conformation. To clarify this point, additional experiments were conducted with DNA molecules of a naturally occurring sequence, which cannot form stable multiple strands. A suitable sequence of 90 bases was selected from the genome of phage lambda.19 The base composition consists of roughly 6 regions, each about 10 to 20 bases in length, that are rich in AT or GC content. These molecules cannot form stable hairpins; however, there is the possibility that two identical molecules on the tip or on the surface may hybridize over a length of up to nine bases. The simulation of the unzipping process for these molecules
Nano Lett., Vol. 3, No. 4, 2003

shows a characteristic variation in force with a period of about 25 nm (green curve in Figure 5). Because these measurements are at the limit of todays AFM force resolution, the absolute number of curves measured with a clear force pattern over the whole range of extension was small. In many curves in which an interaction could be measured up to extensions of more than 100 nm, we found additional rupture events at smaller extensions. Figure 5 (red curves) shows the superposition of different stretching curves taken for different samples. Each curve shows the interaction force over the range between 45 and 100 nm. (No offset was subtracted in the x direction.) The blue curve shows the average of various unzipping curves. Although the measured data is close to the thermal noise limit, a force variation of about 5 pN can be observed, in good agreement with the simulated curve. Our results show that the DNA base composition can be discriminated in the unzipping force signal with a resolution of about 10 base pairs in both synthetic and naturally occurring sequences. The observed forces showed variations between 10 and 25 pN. The force pattern was characteristic
495

for each sequence and in good agreement with the force spectra calculated from the equilibrium thermodynamic model. For the molecules with the synthetic repetitive sequences, the yield of curves in which full hybridization was observed was quite small. This is probably due to the ability of these molecules to hybridize into incomplete double strands and the possible interconnection of more than two single strands. In all experiments, there is also the chance that molecules bind to the surfaces nonspecifically, which might also compromise or inhibit the full hybridization of the molecules. Experiments with polyelectrolytes have shown that the nonelectrostatic contribution to desorption forces is in the range of 30 pN.20,21 To minimize these nonspecific effects, all surfaces were chemically passivated with hydrophilic groups. Control experiments with noncomplementary oligonucleotides on the tip and the sample showed almost no interactions. In very rare cases, interaction forces of about 20 pN were seen only in the extension range below 15 nm. Taking into account the geometrical arangement of the experiment, desorption could occur only for extensions smaller than the length of one single strand. Interactions other than the unzipping of double strands can therefore be excluded for all curves with greater extension. The sequence sensitivity reported in this paper is significantly better than in all previous experiments and was achieved by using shorter molecules. Further unzipping experiments on DNA molecules with one mismatched base in the guanine block are currently being conducted in our laboratory. At present, the noise and drift limits of force detection do not yet allow for a reliable and reproducible detection of single nucleotide polymorphisms. However, these limitations are not fundamental and will at least partially be overcome with the development of softer and more drift-stable cantilevers.22 Acknowledgment. This work was funded by the Deutsche Forschungsgemeinschaft and the Bayerische Forschungsstiftung. References
(1) Clausen-Schaumann, H.; Seitz, M.; Krautbauer, R.; Gaub, H. E. Curr. Opin. Chem. Biol. 2000, 4, 524-530. (2) Merkel, R. Phys. Rep. 2001, 346, 343-385.

(3) Best, R. B.; Clarke, J. Chem. Commun. (Cambridge) 2002, 183-92. (4) Bustamante, C.; Smith, S. B.; Liphardt, J.; Smith, D. Curr. Opin. Struct. Biol. 2000, 10, 279-285. (5) Williams, M. C.; Rouzina, I. Curr. Opin. Struct. Biol. 2002, 12, 330336. (6) Krautbauer, R.; Fischerlander, S.; Allen, S.; Gaub, H. E. Single Molecules 2002, 2-3, 97-103. (7) Bockelmann, U.; Essevaz-Roulet, B.; Heslot, F. Phys. ReV. Lett. 1997, 79, 4489-4492. (8) Essevaz-Roulet, B.; Bockelmann, U.; Heslot, F. Proc. Natl. Acad. Sci. U.S.A. 1997, 94, 11935-11940. (9) Bockelmann, U.; Essevaz-Roulet, B.; Heslot, F. Phys. ReV. E 1998, 58, 2386-2394. (10) Rief, M.; Clausen-Schaumann, H.; Gaub, H. E. Nat. Struct. Biol. 1999, 6, 346-349. (11) Bockelmann, U.; Thomen, P.; Essevaz-Roulet, B.; Viasnoff, V.; Heslot, F. Biophys. J. 2002, 82, 1537-1553. (12) Demers, L. M.; Ostblom, M.; Zhang, H.; Jang, N.-H.; Liedberg, B.; Mirkin, C. A. J. Am. Chem. Soc. 2002, 124, 11248-11249. (13) Grandbois, M.; Beyer, M.; Rief, M.; Clausen-Schaumann, H.; Gaub, H. E. Science (Washington, D.C.) 1999, 283, 1727-1730. (14) Strunz, T.; Oroszlan, K.; Schafer, R.; Guntherodt, H.-J. Proc. Natl. Acad. Sci. U.S.A. 1999, 96, 11277-11282. (15) Breslauer, K. J.; Frank, R.; Blocker, H.; Marky, L. A. Proc. Natl. Acad. Sci. U.S.A. 1986, 83, 3746-3750. (16) The sequences of the ssDNA oligomers with blocks of 10 identical basepairs are 5-SH-(ACATGCCTCC GAAGGATTAT TGGTTTGAGT GGGGGGGGGG AAAAAAAAAA GGGGGGGGGG AAAAAAAAAAGGGGGGGGGGAAAAAAAAAAGGGGGGGGGG AAAAAAAAAA GGGGGGGGGG)-3 and 5-(CCCCCCCCCC TTTTTTTTTT CCCCCCCCCC TTTTTTTTTT CCCCCCCCCC TTTTTTTTTT CCCCCCCCCC TTTTTTTTTT CCCCCCCCCC TGAGTTTGGT TATTAGGAAG CCTCCGTACA)-NH2-3 or -SH3. In each oligomer, a 30-base noncomplementary sequence was appended to the ends as an additional spacer in order to minimize surface effects in the measurements. (17) Thompson, R. E.; Siggia, E. D. Europhys. Lett. 1995, 31, 335-340. (18) The exact sequences are 5-SH- (GCATCAGTC G20 A20 G20 A20 G10)-3 and 5-(C10 T20 C20 T20 C20 AGCTAGGCAG)-NH2-3 or -SH-3. (19) The sequences of the complementary ssDNA oligomers taken from the lambda phage genome are 5-SH-(GCATTTATCA TCTCCATAAAACAAAACCCGCCGTAGCGAGTTCAGATAAAATAAATCCCC GCGAGTGCGA GGATTGTTAT GTAATATTGG)-3 and 5(CCAATATTAC ATAACAATCC TCGCACTCGC GGGGATTTAT TTTATCTGAA CTCGCTACGG CGGGTTTTGT TTTATGGAGA TGATAAATGC TTTTT)-NH2-3. (20) Hugel, T.; Grosholz, M.; Clausen-Schaumann, H.; Pfau, A.; Gaub, H.; Seitz, M. Macromolecules 2001, 34, 1039-1047. (21) Hugel, T.; Seitz, M. Macromol. Rapid Commun. 2001, 22, 9891016. (22) Viani, M. B.; Schaffer, T. E.; Chand, A.; Rief, M.; Gaub, H. E.; Hansma, P. K. J. Appl. Phys. 1999, 86, 2258-2262.

NL034049P

496

Nano Lett., Vol. 3, No. 4, 2003