Tip: 1. To search the note, press CTRL-F keys in combination 2. To navigate the note, use the links.

We want to hear from you! Click here

Gateway Cloning Technology

TABLE OF CONTENT PRODUCT DESCRIPTION SHIPPING CONDITIONS STORAGE CONDITIONS STABILITY QC SPECIFICATIONS PROTOCOL & APPLICATION NOTES Gateway Donor Vectors Gateway Entry Vectors Gateway Destination Vectors Gateway Vector Conversion cassettes Sequences of the Att Sites The BP Recombination Reaction PCR product recombination into the DONOR vector Amount of DNA to be used in a BP reaction The BP Clonase and reaction conditions Information on pEXP7-Tet The LR Recombination Reaction The LR Clonase and reaction conditions Information on pENTR-gus Primers for sequencing Entry Clones Sequencing the shRNA from pENTR/U6 or pENTR/H1/TO Primers for sequencing Expression Clones ALTERNATE PRODUCTS & COMPATIBILITY PRODUCT DOCUMENTATION REFERENCES PRODUCT NAME & CATALOG NUMBER COMPONENTS Enzymes needed Competent E. coli Donor vectors Entry vectors Destination vectors ASSOCIATED PRODUCTS

PRODUCT DESCRIPTION (back to Table of Contents) How Gateway Technology Works Gateway Technology uses lambda phage-based site-specific recombination instead of restriction endonuclease and ligase to insert a gene of interest into an expression vector. The DNA recombination sequences (attL, attR, attB, and attP) and the Clonase enzyme mixtures (i.e. LR or BP Clonase) mediate the lambda recombination reactions. General Gateway Cloning Recombination Notes The Gateway Cloning Technology takes advantage of the well-characterized bacteriophage lambda-based site-specific recombination instead of restriction enzymes and ligase. The power of the Gateway Cloning Technology is that genes cloned into Entry vectors can be subcloned in parallel into one or more Destination Vectors in a simple, 60-minute reaction. Moreover, a high percentage (> 95%) of the colonies obtained carry the Expression Clone in the desired orientation and reading frame. Illegitimate recombination does not occur since Gateway Cloning does not operate by homologous recombination and recombination with genomic sequence is predicted to be a rare event. The nomenclature for the att sites used by Invitrogen is consistent with the lambda nomenclature. The only deviations are in the attB1 or attB2 sites since these are mutant versions of the attB site that do not exist in lambda. The recombination sites used in Gateway Cloning are not wild-type sites. Several point mutations were engineered into the wild type att sites to generate novel specificities. For example attB1 only recombines with attP1 and not with wild type attP or attP2. As these sites differ by only a few nucleotides, the specificities of the att sites for the paring partners is extremely high. There are certain limitations with regards to Gateway Cloning, both imposed by biology. The gene-of-interest will always be connected to att sites, either attL (100 bp) in an Entry clone, or attB (25 bp) in Expression clones. Therefore it needs to be decided initially whether elements such as eukaryotic or prokaryotic translation signals, or a 3' stop codon need to be included before proceeding with the generation of the Entry clone. It is best to construct two Entry Clones; one with the stop codon after the coding sequence for N-terminal fusions, and one without the stop codon for C-terminal fusions. The exact minimum size limit that can be used in a Gateway reaction is not known. There will be a minimal size limit, probably constrained by the topology of the recombination reaction. Early data suggests that 100 bps between the att sites may be sufficient. Recombination Enzymes involved in the Gateway recombination reactions Lambda recombination is catalyzed by a mixture of enzymes that bind to specific sequences (att sites), bring together the target sites, cleave them, and covalently attach the DNA. The Clonase enzyme mixtures utilize a combination of the bacteriophage Integrase (Int) and Excisionase (Xis) proteins and E. coli Integration Host Factor (IHF) proteins. Int: Has type I topoisomerase activity. Cuts and reseals the att sites via covalent Int-DNA intermediate Binds specifically to 2 different families of DNA sequences: 1. core: CAACTTNNT 2. arm: C/AAGTCACTAT Required for both excision (LR reaction) and integration (BP reaction) of phage Xis Required for excision (LR) but not integration (BP) of phage. Inhibits integration (BP) at physiological conditions Relatively stable in vitro but rapidly degraded in cells Promotes efficient LR recombination in presence of Int and IHF No enzymatic function but rather sequence-specific cooperative binding to adjacent sites in the P arm thus introducing sharp bend in the DNA. Also associated with cooperative interactions with DNA-bound Int . IHF E. coli-derived protein as opposed to phage-derived (Xis & Int) Essential for both excision and integration (LR and BP reactions respectively) Heterodimer composed of alpha and beta subunits Similar to other type II DNA binding proteins such as histones

No known enzymatic function but it binds to and bends DNA at specific sites SHIPPING CONDITIONS (back to Table of Contents) Gateway Donor, Entry, and Destination vectors are shipped in a supercoiled and lyophilized format with a few exceptions. The pENTR-Gus positive control is supplied supercoiled in TE buffer whereas pEXP7-tet is supplied linearized in TE buffer. The Yeast two-hybrid vectors, pDEST22 and pDEST32 are supplied as linearized vectors in TE buffer. The adenoviral destination vectors are shipped supercoiled in TE buffer. All lyophilized vectors are shipped at room temperature and all the vectors in solution are shipped on dry ice. The competent E. coli, and enzymes are shipped on dry ice. STORAGE CONDITIONS (back to Table of Contents) Store all Gateway vectors at 20oC. BP and LR enzyme mix must be stored at 80o C. 5X BP or LR Reaction buffer and the Proteinase K solution can be stored at 80oC or 20oC. BP Clonase II and LR Clonase II enzyme mixes can be stored at 20oC or 80oC. STABILITY (back to Table of Contents) All reagents are guaranteed stable for 6 months when properly stored. Both BP, and LR Clonase enzyme mixes are stable for at least 6 month from date of purchase. When used in a reaction, the mix is first thawed on ice for two minutes, mixed gently by tapping or vortexed very briefly. After taking the desired aliquot out, the mix should be returned to 80oC promptly. The enzyme mix retains 50% activity after 15 cycles of freeze-thaw. It is also stable (100 % activity) overnight at 4oC or one week at 20oC. It is not recommended to aliquot the mix since this can lead to loss of activity. Proteinase K is stable for 12 months at 4C as a powder and up to 2 weeks at room temperature as a powder or solution. QC SPECIFICATIONS (back to Table of Contents) Gateway Vector Conversion cassettes: The cassettes functionally tested with the ccdB assay as part of the QC procedure. Gateway BP Clonase Enzyme Mix: Functionally tested in a 1 hour recombination reaction followed by gel electrophoresis analysis and a transformation assay. All pDONR vectors: A BP cloning reaction, and the ccdB assay is done as part of the QC procedure. pENTR D-TOPO Vector: TOPO Cloning with pENTR/D-TOPO and a directional test PCR product must yield the following results when tested using the control conditions listed in the manual: (1) pENTR/D-TOPO and directional PCR product ligation: cloning efficiency must be > 85% as based on colony counts from plus insert plates and vector only plates. (2) Directional PCR to confirm directional cloning of product: > 36 out of 40 transformants analyzed from plus insert plates must contain the test PCR product cloned in the correct orientation. PROTOCOL AND APPLICATION NOTES (back to Table of Contents) Gateway Donor Vectors

Gateway Entry Vectors Gateway Destination Vectors Gateway Vector Conversion cassettes Sequences of the Att Sites The BP Recombination Reaction PCR product recombination into the DONOR vector Amount of DNA to be used in a BP reaction The BP Clonase and reaction conditions Information on pEXP7-Tet The LR Recombination Reaction The LR Clonase and reaction conditions Information on pENTR-gus Primers for sequencing Entry Clones Sequencing the shRNA from pENTR/U6 or pENTR/H1/TO Primers for sequencing Expression Clones Gateway Donor Vectors (back to Table of Contents) (back to Protocol and Application Notes) Inserts can be released from all pDONR vectors with BsrG1, which cuts in both attL sites and whose recognition sequence is TGTACA. An exception is pDONR P4/P1R that is part of the MultiSite Gateway System and has an attL4 site whose sequence is different from attL1 and attL2. Donor vectors contain two transcription termination sequences (rrnB T1 and T2) upstream from attP1. This prevents transcription of genes cloned into pDONR vectors from other vector-encoded promoters thereby reducing possible toxic effects. The minimum insert successfully cloned into a pDONR vector in-house was 70bp and largest was 12 Kb. Although, successful cloning of small inserts from 50-200 bp is sequence dependent. Although pDONR201 and pDONR207 contain a pUC ori, they replicate less efficiently resulting in lower plasmid yields. In contrast pDONR221 acts as a high-copy number plasmid typically yielding 0.5 - 1.0 mg of DNA per liter. Gateway Entry Vectors (back to Table of Contents) (back to Protocol and Application Notes) Inserts can be released from all pENTR vectors with BsrG1, which cuts in both the attL sites and whose recognition sequence is TGTACA. The Entry vectors 1A, 2B, 3C, 4, 11 contain the same vector backbone (outside the attL sites) and differ only in the sequences and cloning sites provided between the attL sites. They contain a modified pUC origin of replication and are low- to mid-copy number plasmids. In terms of DNA yield, these vectors are more like those with pBR322 ori. All Entry vectors contain two transcription termination sequences (rrnB T1 and T2) upstream from attL1. This prevents read-through transcription from other vector-encoded promoters, thereby reducing possible toxic effects. The Shine-Dalgarno sequence in pENTR/SD/D-TOPO does not adversely affect mammalian expression when used in an appropriate mammalian DEST vector. Hence this vector may be substituted for pENTR/D-TOPO. When cloning into any of the Directional TOPO Entry vectors it is recommended to use molar ratios of 0.5-2:1 of insert: vector. Too much PCR product will inhibit the cloning reaction; hence the PCR product may need to be diluted 10 fold before cloning. Use 1-5ng of a 1 Kb product or 5-10ng of a 2 Kb product. When cloning into pENTR/U6 or pENTR/H1/TO, the two synthesized DNA oligos do not need phosphate groups at the 5 end since both these vectors have the 5 phosphate groups. The pCR8/GW/TOPO entry vector uses spectinomycin for selection; hence the entry clone generated can be used with any destination vector. Most destination vectors are ampicillin-resistant, but there may be some that are kanamycin or zeocin-resistant. pCR8/GW/TOPO vector can be used to TA clone a PCR product amplified with any Taq DNA polymerase or Invitrogens Platinum Taq DNA polymerase High Fidelity (catalog #11304-011). Gateway Destination Vectors

(back to Table of Contents) (back to Protocol and Application Notes) Inserts can be released from all DEST vectors with BsrG1, which cuts in both attB sites and whose recognition sequence is TGTACA. All the destination vectors have a pUC ori (for prokaryotic), SV40 ori (for mammalian), and 2 ori (for yeast). When propagating pDONR, pENTR, and pDEST vectors with the ccdB gene, the E. coli can be grown at 30oC to prevent random deletions of the gene. If this happens, the amount of background colonies will increase since the selection method has been eliminated. It is recommended to verify the functionality of the ccdB gene by propagating the Gateway vectors using selection on 20-30 ug/ml chloramphenicol plates. Restriction enzymes used to linearize Destination vectors Linearized Destination Vector can be obtained by cleaving at a restriction site within the region of the GATEWAY Cassette, taking care to avoid the ccdB gene. All Destination Vectors from Invitrogen used to be provided linearized in this manner. Although Invitrogen previously recommend using a linearized destination vector for more efficient recombination, further testing at Invitrogen has found that linearization is NOT required to obtain optimal results for downstream application. Vector pDEST 14 pDEST 15 pDEST 17 pDEST 8 pDEST 10 pDEST 20 pDEST 12.2 pDEST 22 pDEST 26 pDEST 27 pDEST 32 pET-DEST42 pT-Rex-DEST30 pT-Rex-DEST31 pcDNA-DEST40 pcDNA-DEST47 pMT-DEST48 pYES-DEST52 pBAD-DEST49 pEF-DEST51 pcDNA-DEST53 Restriction Enzyme Used to Linearize It Mlu I BssH II BssH II Mlu I Mlu I EcoR I Mlu I BssH II EcoR I EcoR I BssH II NcoI EcoRI EcoRI EcoRI EcoRI EcoRI EcoRI EcoRI EcoRI EcoRI

Gateway Vector Conversion cassettes (back to Table of Contents) (back to Protocol and Application Notes) All the Conversion cassettes are blunt-ended and 5-phosphorylated. Each reading frame cassette has a different unique restriction site between the chloramphenicol resistance and ccdB genes (Mlu I for the reading frame A cassette, Bgl II for the reading frame B cassette, and Xba I for the reading frame C cassette). The reading frame of the fusion protein domain must be in frame with the core region of the attR1 site for an N-terminal fusion (e.g. the six As are translated into two lysine codons). For a C-terminal fusion protein, translation through the core region of the attR2 site should be in frame with TAC-AAA-, encoding -Tyr-Lys-. For native proteins, any of the three Gateway Cassettes may be used since there will be no translation through the att sites. Therefore reading frame issues through the att sites are not relevant.

For sequencing from within an attR1 region the GW3 priming site primer can be used. The primer sequence is 5-TTA ATA TAT TGA TAT TTA TAT CAT TTT ACG-3. The primer anneals about 30 bp downstream of the 5 end of the attR1 site. When sequencing, as long as the attR sites are intact, a restriction enzyme with a site very close to attR sites can be used to linearize the Gateway-converted vector. Sequences of the Att Sites (back to Table of Contents) (back to Protocol and Application Notes) Of the 4-att sites, attP is the most complex and attB is the simplest. The prophage sites attL and attR are hybrids of attP and attB. Contribution of attL to attP is in blue. Contribution of attR to attP is in green. Contribution of attL and attR to attB is in yellow. attL1: 100bp attL2: 100bp attR1: 125 bp attR2: 125 bp attP1: 233 bp CAAATAATGA TTTTATTTTG A CTG ATA GTG ACC TGT TCG TTG CAA CAA ATT GAT AAG CAA TGC TTT TTT ATA ATG CCA ACT TTG TAC AAA AAA GCA GGC T AC CCA GCT TTC TTG TAC AAA GTT GGC ATT ATA AGA AAG CAT TGC TTA TCA ATT TGT TGC AAC GAA CAG GTC ACT ATC AGT CAA AAT AAA ATC ATT ATT TG ACA AGT TTG TAC AAA AAA GCT GAA CGA GAA ACG TAA AAT G ATA TAA ATA TCA ATA TAT TAA ATT AGA TTT TGCATAAAAA ACAGACTACA TAATACTGTA AAACACAACA TATCCAGTCA CTATG CAT AGT GAC TGG ATA TGT TGT GTT TTA CAG TAT TAT GTA GTC TGT TTT TTA TGC AAA ATC TAA TTT AAT ATA TTG ATA TTT ATA TCA TTT TAC GTT TCT CGT TCA GCT TTC TTG TAC AAA GTG GT CAAATAATGA TT TTA TTT TGA CTG ATA GTG ACC TGT TCG TTG CAA CAA ATT GAT GAG CAA TGC TTT TTT ATA ATG CCA ACT TTG TAC AAA AAA GCT GAA CGA GAA ACG TAA AAT GAT ATA AAT ATC AAT ATA TTA AAT TAG ATT TTG CAT AAA AAA CAG ACT ACA TAA TAC TGT AAA ACA CAA CAT ATC CAG TCA CTA TGA ATC AAC TAC TTA GAT GGT ATT AGT GAC CTG TA TA CAG GTC ACT AAT ACC ATC TAA GTA GTT GAT TCA TAG TGA CTG GAT ATG TTG TGT TTT ACA GTA TTA TGT AGT CTG TTT TTT ATG CAA AAT CTA ATT TAA TAT ATT GAT ATT TAT ATC ATT TTA CGT TTC TCG TTC AGC TTT CTT GTA CAA AGT TGG CAT TAT AAG AAA GCA TTG CTT ATC AAT TTG TTG CAA CGA ACA GGT CAC TAT CAG TCA AAA TAA AATCAT TAT TTG ACA AGT TTG TAC AAA AAA GCA GGC T AC CCA GCT TTC TTG TAC AAA GTG GT Note: Not all att sequences are conserved in every vector; att sites have been modified in various vectors to increase efficiency, minimize secondary structure, etc. Thus, an attB1 site in one vector may not be identical to an attB1 site in another vector (but we still call them both attB1 sites). Only the 21-bp consensus sequence between all att sites is crucial for recombination. For attB1 the essential sequence is: 5- CNNNTTTGTACAAAAAANNNG. For attB2 the essential sequence is: 5- CNNNTTTCTTGTACAAANNNG. Changes to other base pairs do not affect recombination.

attP2: 233 bp

attB1 attB2

The attB amino acid sequence does not interfere with transcription or translation. No effect of the attB sites on expression levels in E. coli, insect and mammalian cells have been observed. Simpson et al. EMBO Reports 11(31): 287-292, 2000 demonstrated that GFP fusions localized to the proper intracellular compartment. The proteins contained the attB1 or attB2 sequences. It is believed that there may be certain mutation-prone hotspots within the attL sites that happen in E.coli. However some of these hotspots do not interfere with the recombination reaction nor do they cause a shift in the reading frame of the GOI if recombined into a N-terminal tagged destination vector. It is not known why these hotspots occur; when it does, it does not get transferred into the destination vector but remains within the backbone of the Entry clone. An article that describes the specificity of att sites is Sasaki et al. J. Biotechnol. 2004; 107(3):233-43. Evidence for high specificity and efficiency of multiple recombination signals in mixed DNA cloning by the Multisite Gateway system.

Schematic of the creation of attB sites after LR recombination

Contribution of attR to attB is in green. Contribution of attL to attB is in blue. Integrase (Int) produces a seven-base staggered cut during the recombination reactions indicated by the arrows in the figure. There are 8 amino acids (letters above triplet codons) contributed by the attB site, which get added to the 5 or 3 end of the gene of interest depending on the location of the fusion tag in the destination vector. The BP Recombination Reaction (back to Table of Contents) (back to Protocol and Application Notes) Recombination reaction between an Expression Clone or PCR product (containing a gene flanked by attB1 and attB2 sites) and pDONR (containing attP1 and attP2 sites) to generate an Entry clone that now contains the gene of interest flanked by attL1 and attL2 sites. Our studies have shown that the BP recombination reaction is approximately 5-10 fold more efficient than a ligation reaction to clone a piece of DNA. Approximately 5-10% of the starting material is converted into product during a BP reaction. The largest PCR fragment cloned in-house is 10 Kb (see Table below). In theory a much larger fragment can be cloned. A Gateway Cloning reaction is essentially swapping one fragment out of a plasmid and replacing it with another where the reaction cannot discriminate between the "vector" and the "insert". Gateway reactions have been performed in-house, using a Destination Vector that was approximately 130 Kb, so in theory large inserts of that size can be transferred via Gateway technology. High-efficiency cloning of large genes using pDONR donor vector PCR products (0.26 Kb to 10.1 Kb) were cloned into the pDONR donor vector. Random colonies were selected and screened for the presence of insert and orientation. The range of PCR fragments demonstrated >90% cloning. Size (Kb) 0.26 1.0 1.4 3.4 4.6 6.9 PCR DNA (fmol) 15 38 15 38 15 38 15 38 15 38 15 38 PCR DNA (ng) 3 7.5 10 25 14 35 34 85 46 115 69 173 Colonies/ml Transformation* 1223 2815 507 1447 271 683 478 976 190 195 30 (235) 54 (463) Correct clones/Total clones examined 10/10# 49/50 48/50 9/10# 10/10# 47/50

10.1

* pUC+ 108 CFU/ml After overnight incubation # DNA mini-prep analysis

7.5 37.5

50.5 252.5

16 (112) 42 (201)

15/16

PCR product recombination into the pDONR vector (back to Table of Contents) (back to Protocol and Application Notes) The best place to include a protease cleavage site or any other N-term tag is between the attB1 sequence and the first gene specific codon (in most cases, ATG). An example of adding a TEV Protease site: 5'-ACA-AGT-TTG-TAC-AAA-AAA-GCA-GGC-TNN-GAA-AAC-CTG-TAT-TTT-CAG-GGC-ATG-forward gene specific sequence-3' The sequence as describe above would generate a protein with one additional amino acid (glycine) on the N-terminus after cleavage with TEV. An alternative would be to replace the ATG with the GGC codon. This would generate a protein with a glycine residue in place of the methionine residue after cleavage with TEV protease. For purity of the attB-containing primers, 50 nmol of standard purity oligos are adequate for most applications. For cloning smaller products, purifying the oligos by Cartridge or PAGE doesn't significantly increase colony output (not more than 2-3 fold). However, for cloning large PCR products (> 5kb), colony output can be increased if the oligos (when >65 bases) are further purified (i.e. Cartridge or PAGE). The oligos should be dissolved to a concentration of 2050 M. The 4-Gs at the 5 end of the attB primer sequences are necessary for the BP reaction and cannot be replaced by analogous sequences. It is believed that this stretch of Gs serve as a substrate in the BP reaction by allowing more of an area for protein binding; although this has not been directly demonstrated. Addition of more than 4Gs inhibits the BP recombination reaction due to the formation of an inhibitory secondary structure. The next two bases after the G cannot be AA, AG or GA since this would form a stop codon. Typically the attB sequences on PCR primers are not a problem during PCR amplification. Hence there is no need to change the PCR reaction conditions when primers have the attB sequence compared to reactions using gene specific primers alone. It is recommended that the attB-PCR product be cleaned up with a PEG precipitation step. This removes PCR buffer, unincorporated dNTPs, and primer dimers. Small primer-dimers clone very efficiently and decrease the number of correct clones whereas leftover PCR buffer may inhibit the BP reaction. One-Step Adapter PCR method for HTP Gateway cloning: For detailed protocol see Quest 1.2; pg 53-55. One can add the att B adaptors by using the 4 primers all in one tube. The best ratio of the first gene specific and the second attB primers is 1:10. The protocol is: Template DNA 50ng 10x Pfxb amplification buffer 1ul 10x PCRx enhancer solution 1ul Gene specific primers 2 pmol each attB primers 20 pmol each Platinum Pfx 1unit Total volume 10ul PCR product can be used in BP reaction without any purification, and around 90% clones were converted Gateway entry clones. Amount of DNA to be used in a BP reaction (back to Table of Contents) (back to Protocol and Application Notes) For the most efficient reaction, it is best to not have attB sites in molar excess of attP sites. For a 20 l reaction, 300 ng (no more than 500 ng) of the donor vector is recommended. Using too much of the donor vector in the reaction tube will inhibit the BP reaction and also result in intact donor vector being co-transformed with the Entry Clones. This will reduce the amount of colonies on the plate by killing the transformed E. coli due the presence of the ccdB gene. For PCR products > 4 Kb, the number of colonies obtained per fmol of PCR DNA added decreases with increasing size. Thus for larger PCR products it is recommended to increase the amount of DNA to at least 100 fmol of PCR product per

20 l reaction, and using incubations longer than one hour (i.e. 6 hours or overnight). The largest PCR-amplified DNA cloned in-house was 10.1 Kb. The standard BP Reaction uses 300 ng of pDONR Vector and 30-300 ng attB-flanked PCR product or Expression Clone for 1 hour at 25oC. Longer incubation times of up to 24 h can be used to convert a higher percentage of starting attB-DNA to product. Longer incubations are recommended for PCR products 5 Kb; however in these cases the number of colonies will be decreased . Increasing the incubation to 4-6 h will typically increase colony output 2-3 fold and 16-24 h will typically increase colony output 5-10 fold (Focus 18.1: pg 27). The BP Clonase and reaction conditions (back to Table of Contents) (back to Protocol and Application Notes) The BP clonase mix contains Int (Integrase), and IHF (Integration Host Factor). BP Clonase II contains enzymes and buffer in a single mix to enable convenient ten-microliter reaction set up with fewer pipetting steps whereas the original BP Clonase requires addition of enzyme and buffer. If Proteinase K is not added after the BP reaction, there could be a 10-fold decrease in efficiency. The one-tube protocol with the new BP, and LR Clonase II Enzyme mix is slightly different from the original one-tube protocol since the enzymes and buffer are in same enzyme mix. Refer to the Gateway Technology with Clonase II manual. Information on pEXP7-Tet (back to Table of Contents) (back to Protocol and Application Notes) This is the positive control for the BP recombination reaction, which permits a tet-resistance cassette (1.4 kb) to be cloned into the donor vector. It is an approximately 5.76 Kb linearized plasmid DNA that has a 1.4 kb segment containing attB sites flanking the tet-resistance gene and its promoter. The LR Recombination Reaction (back to Table of Contents) (back to Protocol and Application Notes) Recombination reaction between an Entry clone (containing a gene flanked by attL1 and attL2 sites) and a DEST vector (containing attR1 and attR2 sites) to generate an Expression clone that now contains the gene of interest flanked by attB1 and attB2 sites. The recombination requires the LR Clonase Enzyme. Up to 30% of the starting material is converted to product during an LR reaction. The possibility of generating PCR products with attL sites on either side of the product will work in theory. However the attL sites are > 100 bases and hence very long PCR primers will need to be ordered. The oligos would probably have greater propensity towards secondary structure, synthesis failure, etc. Hence such a strategy to generate an Expression clone is not recommended. Biologically an optimal LR reaction substrate is supercoiled attL with linear attR sites since helical density of the DNA is important in lambda recombination. However, the LR reaction is a more effective reaction than the BP reaction it enables the reaction to be done in a less than favorable condition and still achieves an acceptable amount of colonies. Hence both the Entry clone and the destination vector can be present as supercoiled during the LR reaction. This will result in 2-5 fold less colonies than if the LR reaction was done with a supercoiled Entry clone and linear DEST vector. The LR Clonase and reaction conditions (back to Table of Contents) (back to Protocol and Application Notes) LR clonase mix contains lambda recombination proteins Int (Integrase), Xis (Excisionase), and IHF (Integration Host Factor). The addition of Proteinase K is not necessary when doing an LR reaction. A typical LR reaction with Proteinase K treatment yields about 35000 to 150000 colonies per 20 l reaction. Without the Proteinase K treatment there is an approximate 10-fold reduction.

The success of the LR recombination reaction is very dependent on the molar ratio of the Entry clone and DEST vector. If the ratio is not equimolar, the co-integrate may react with the DEST vector and Entry clone resulting in a higher background. Do not use too much DNA during transformation of E. coli after the LR reaction because the Entry clone (even if is Kanamycin-resistant) may outgrow the DEST expression clone. The expression clone is usually in a pBR322-based ori, which has a lower copy number for expression whereas the Entry clone has the high copy pUC ori. Information on pENTR-gus (back to Table of Contents) (back to Protocol and Application Notes) This is the positive control for the LR recombination reaction. The Gus protein has 603 amino acids; MW: 68.4 kDa. Gus refers to beta-Glucuronidase, a protein that can be detected either with a fluorescent or blue substrate in the cells. An LR reaction with pENTR-gus and a destination vector typically yields hundreds of colonies. The Gus gene has a ShineDalgarno and Kozak sequence in frame with the attL1 site so this gene can be expressed either as native or fusion protein in prokaryotic and eukaryotic cells. Primers for sequencing Entry Clones: (back to Table of Contents) (back to Protocol and Application Notes) Clones derived from pDONR201, and pDONR207 Sequence SeqL-A (proximal to attL1) 5TCGCGTTAACGCTAGCATGGATCTC3 (reads about 60 bp of vector sequence) SeqL-B (proximal to attL2) 5GTAACATCAGAGATTTTGAGACAC3 (reads about 60 bp of vector sequence) M13 Forward (-20): 5GTAAAACGACGGCCAG-3 M13 Reverse: 5-CAGGAAACAGCTATGAC-3 SeqL-C (proximal to attL1) 5GGATAACCGTATTACCGCTAG3 (reads about 300 bp of vector sequence) Modified GW1 Forward primer: 5GTTGCAACAAATTGATAAGCAATGC3 (reads about 81 bp of vector sequence) SeqL-B (proximal to attL2) 5GTAACATCAGAGATTTTGAGACAC3 (reads about 70 bp of vector sequence) SeqL-D (proximal to attL2) 5TCTTGTGCAATGTAACATCAG3 (reads about 90 bp of vector sequence) SeqL-E (proximal to attL2) 5GTTGAATATGGCTCATAACAC3 (reads about 170 bp of vector sequence) GW1 Forward: 5-GTTGCAACAAATTGATGAGCAATGC-3 (This primer can anneal to attL1 sites except from pENTR1a, 2b, 3c, 4, and 11) GW2 Reverse: 5- GTTGCAACAAATTGATGAGCAATTA-3 (This primer can only be used for pCR8/GW/TOPO since the TA in bold is unique to this vector) M13 Forward (-20): 5GTAAAACGACGGCCAG-3 M13 Reverse: 5-CAGGAAACAGCTATGAC-3 U6 Forward: 5GGACTATCATATGCTTACCG3 M13 Reverse: 5CAGGAAACAGCTATGAC3 Sequencing the shRNA from pENTR/U6 or pENTR/H1/TO (back to Table of Contents) (back to Protocol and Application Notes)

pDONR221 Entry Vectors pENTR1a, 2b, 3c, 4, and 11

pCR8/GW/TOPO

pENTR/D-TOPO pENTR/U6

10

The hairpin sequences are inverted repeats that form structures during sequencing. A drop in the sequencing signal has been observed when entering the hairpin. Suggestions: 1. Include more template and primer in the reaction (up to double the recommended amounts). 2. Longer hairpins or those with higher GC content tend to be more difficult to sequence. In situations like this it may help to add up to 5-10% DMSO in the reaction. 3. Try different sequencing reaction enhancers; for example those which are used on high GC content 4. Use high quality template DNA; we use either Invitrogen's SNAP midiprep (Cat # K191001) or PureLink HQ miniprep (Cat # K210001) kits to purify the DNA. 5. Work with the sequencing facility to get the right electronic file output. In our experience we often see a drop-off in signal sequence after the start of the shRNA sequence (from either direction). There is often clear sequence there but because the file output is calibrated to the stronger signals at the beginning of the read, the rest of the shRNA sequence is compressed on the vertical axis. If the output is recalibrated to enhance the signals from the end of the shRNA, there may be very good sequence information there (the signals from the beginning of the shRNA end up off the chart, so it may require two different files to read the entire sequence). Hence the problem may not be bad sequence, but rather that there are two distinct signal levels present, which cannot both be displayed in the same file. 6. If no other solution is possible, re-design the shRNAs to be more sequencing-friendly without a significant impact on their potency. This strategy works well but should be a last resort, as it requires ordering new insert oligos. It can be achieved in 2 ways: Make 2-3 well-spaced base changes in the sense strand sequence. Changing an A to a G or a C to a T will break up the inverted repeat in the DNA and will allow G:U basepairing in the shRNA. The shRNA will still form a hairpin and the antisense strand will still perfectly match the target sequence. A good reference that describes this strategy is Paddison et al. (2002). Genes Dev. 16(8): 948-58. Change the loop to include a restriction enzyme site. Digest and purify the template at that site prior to sequencing (e.g. on a PCR cleanup column such as the PureLink PCR purification kit; K310001) then use forward and reverse primer reactions for each template. When the two parts of the shRNA-inverted repeat are released from each other, the sequence data obtained is very good right up to the restriction cleavage site. Primers for sequencing Expression Clones (back to Table of Contents) (back to Protocol and Application Notes) Clones derived from pDEST14 and pDEST17 pET-DEST42, pcDNA-DEST47, pcDNADEST53, pcDNA-DEST40, pEF-DEST51 pYES-DEST52 pDEST8 and pDEST10 pMT-DEST48 pDEST 26 pT-REx-DEST30, pT-REx-DEST31 pDEST15, pDEST20, pDEST 27 pEF-DEST51 Sequence ACG ATG CGT CCG GCG TAG AGG AT TAA TAC GAC TCA CTA TAG GG (Cat# N56002) AAT ATA CCT CTA TAC TTT AAC GTC GTT CTA GTG GTT GGC TAC GTA TA (Note: This primer binds before the polyhedrin promoter. For analyzing recombinant bacmid, this primer along with a 3 gene specific primer can be used) CAT CTC AGT GCA ACT AAA TGA ACC GTC AGA TCG CCT GGA GA CGC AAA TGG GCG GTA GGC GTG GTG ATC ATG TAA CCC ATC CTG AC TCA AGC CTC AGA CAG TGG TTC

Sequencing the Destination vector after insertion of the Gateway Vector Conversion cassettes: For cycle sequencing, it is best if the attR sites are on separate DNA fragments. DNA can digested to give two fragments, each carrying one attR site. One of the restriction enzymes that can be used is AlwN I that cuts once in the cassette upstream of the ccdB gene and usually cuts one or more times in the vector backbone. It does not matter if more than two fragments are generated, as long as attR1 and attR2 are on separate DNA fragments. Following

11

digestion, phenol extract, ethanol precipitate, and resuspend the DNA to ~200 ng/ul. Use 2.5 l in a 20 l Big Dye sequencing reaction. PRODUCT DOCUMENTATION (back to Table of Contents) Brochures COA Manuals Vector Data COMPONENTS Gateway Clonase Enzymes (back to Table of Contents) (back to Components) Name Gateway BP Clonase Enzyme Mix BP clonase II enzyme mix (pre-mixed ready-to-use solution of clonase and reaction buffer) Gateway LR Clonase Enzyme Mix Gateway LR Clonase Plus Enzyme Mix LR Clonase II Enzyme Mix (pre-mixed ready-to-use solution of clonase and reaction buffer) Competent E. coli (back to Table of Contents) (back to Components) Name One Shot ccdB Survival T1 Phage-Resistant Cells Donor vectors (back to Table of Contents) (back to Components) Name pDONR201 pDONR221 pDONR/Zeo pDONR P2R-P3 pDONR P4-P1R Features Kanamycin resistant Kanamycin resistant Zeocin resistant Part of the MultiSite gateway 3-fragment vector construction kit. Part of the MultiSite gateway 3-fragment vector construction kit. Catalog Number 11798014 12536017 12535035 12537023 12537023 Size 10 x 50 ul Catalog Number C751003 Size 20 rxns 100 rxns 20 rxns 100 rxns 20 rxns 100 rxns 20 rxns 20 rxns 100 rxns Catalog Number 11789013 11789021 11789020 11789100 11791019 11791043 12538013 11791020 11791100 Cell lines FAQ MSDS Citations Licensing Newsletters

12

pDONR 222

Part of the CloneMiner cDNA library construction kit. Kanamycin resistant. Components

18249029

Name Gateway PCR Cloning system with pDONR221 vector Gateway PCR Cloning system with pDONR/Zeo vector Gateway PCR Cloning System with clonase II and pDONR221 vector Gateway PCR Cloning System with clonase II and pDONR/Zeo vector Entry vectors (back to Table of Contents) (back to Components) Name pENTR 1A pENTR 2B pENTR 3C pENTR 4 pENTR 11 pENTR/U6 pENTR/H1/TO pENTR221 pENTR/GeneBLAzer pCR8/GW/TOPO pENTR 5 TOPO pENTR/D-TOPO pENTR/SD/D-TOPO pENTR/TEV/D-TOPO

Catalog Number 12535019 12535027 12535029 12535037

BP Clonase, BP Clonase Rxn Buffer, pDONR221 Vector , pEXP7-tet Positive Control, LE DH5cells, M13 primers. BP Clonase, BP Clonase Rxn Buffer, pDONR/Zeo Vector , pEXP7-tet Positive Control, LE DH5cells, M13 primers, Zeocin BP clonase II, pDONR221, M13 sequencing primers, OneShot OmniMAX 2-T1 competent cells. BP clonase II, pDONR/Zeo, M13 sequencing primers, OneShot OmniMAX 2-T1 competent cells.

Features N- and C-terminal fusions in E. coli or eukaryotic cells N- and C-terminal fusions in E. coli or eukaryotic cells N- and C-terminal fusions in E. coli or eukaryotic cells N- or C-terminal fusions in E. coli. Native in eukaryotic cells Native expression in E. coli or eukaryotic cells. RNAi studies using Lentiviral expression. Inducible RNAi studies using Lentiviral expression Vector containing Ultimate ORF clone Entry vector for the GeneBLAzer system TA cloning vector, Spectinomycin selection Entry vector for 5 element in the MultiSite Gateway system Directional TOPO entry vector Directional TOPO entry vector with gene 10, and Shine-Dalgarno sequence Directional TOPO entry vector with 5 TEV protease cleavage site

Catalog Number 11813011 11816014 11817012 11818010 11819018 K494500 K492000 HORF01/MORF01 12578118 K250020/ K252020 K59120 K240020 K242020 K252520

Destination vectors (back to Table of Contents) (back to Components) Cell-free Expression

13

Name Expressway Plus In Vitro Protein Synthesis System Expressway Plus Expression System with Lumio Technology pEXP1-DEST pEXP2-DEST pEXP3-DEST Prokaryotic Expression Name E. coli Expression System pET104.1-DEST. pET-DEST42 pDEST14 pDEST15 pDEST17 pDEST24 pET160-DEST pET161-DEST pET160/GW/D-TOPO pET161/GW/D-TOPO pBAD-DEST49

Features No vector (K990010), pEXP1-DEST (K990020), or pEXP2-DEST (K990030) No vector (K990060) or pEXP3-DEST (K990070) N-terminal 6xHis, Xpress epitope, EK cleavage C-terminal V5-6xHis tag N-terminal lumio, 6xHis tag, TEV,

Catalog Number K990010/ K990020/ K990030 K990060/ K990070 V96001 V96002 V96003

Features Includes pDEST14, pDEST15, pDEST17, pDEST24, DH5a, BL21-AI, LR clonase T7/lac promoter, N-term BioEase tag for in vivo biotinylation, EK cleavage T7/lac promoter, C-term V5-6xHis. T7 promoter, no tag T7 promoter, N-terminal GST T7 promoter, N-terminal 6xHis T7 promoter, C-term GST T7/lac promoter N-terminal Lumio, 6xHis, TEV site T7/lac promoter, C-term Lumio, 6xHis T7/lac promoter, N-term Lumio, 6xHis, TEV site T7/lac promoter, C-term Lumio, 6xHis N-term Thioredoxin, C-term V5-6xHis, araBAD promoter

Catalog Number 11824026 K10401 12276010 11801016 11802014 11803012 12216016 12583035 12583043 K16001 K16101 12283016

Yeast Expression Name pYES2-DEST52 pDEST22* pDEST32*

Features GAL1 promoter, C-term V5-6xHis Prey vector with the Gal4 AD in the ProQuest two-hybrid system Bait vector with the Gal4 BD in the ProQuest two-hybrid system

Catalog Number 12286019 10835031 10835031

Insect Expression Name Baculovirus Expression System with GATEWAY Technology pDEST 8

Features Baculovirus pDEST 8, 10, 20 set, LR Clonase Enzyme Mix, pENTR-GUS Library Efficiency DH5 cells Polyhedrin promoter, Native expression

Catalog Number 11827011

11804010

14

pDEST 10 pDEST 20 BaculoDirect N-Term linear DNA BaculoDirect C-Term linear DNA BaculoDirect Secreted linear DNA pMT-DEST48 pMT/BioEase-DEST pIB/V5-His-DEST

Polyhedrin promoter, N-terminal 6X his Polyhedrin promoter, N-terminal GST Polyhedrin promoter, N-term 6xHis-V5, TEV site Polyhedrin promoter, C-term V5-6xHis Polyhedrin promoter, N-term honeybee melittin (HBM) secretion signal, 6xHis-V5, TEV site DES Metallothionein (MT) promoter, C-term V5-6xHis DES N-term BioEase tag for in vivo biotinylation, MT promoter, EK site, OpIE2 promoter, C-term V5-6xHis, non-viral stable insect expression

11806015 11807013 12562054/ 12562062 12562013/ 12562039 12562021/ 12562047 12282018 V414020 12550018

Mammalian Expression Name pcDNA3.1/nV5-DEST pcDNA3.2-DEST pcDNA6.2/V5-DEST pcDNA6.2/GFP-DEST pcDNA6/BioEaseDEST pcDNA-DEST40 pcDNA-DEST47 pcDNA-DEST53 pDEST26 pDEST27 pT-REx-DEST30 pT-REx-DEST31 pEF-DEST51 pEF5/FRT/V5-dest Mammalian Expression System with Gateway pcDNA6.2/GW-V5/DTOPO

Features CMV promoter, N-terminal V5, Geneticin selection CMV promoter, C-terminal V5, Geneticin selection CMV promoter, C-terminal V5, Blasticidin selection (Tag-on-demand technology) CMV promoter, C-terminal GFP, Blasticidin selection (Tag-on-demand technology) CMV promoter, N-term BioEase tag, EK site CMV promoter, C-term V5-6xHis, Geneticin selection CMV promoter, C-term GFP, Geneticin selection CMV promoter, N-term GFP, Geneticin selection CMV promoter, N-terminal 6xHis, Geneticin selection CMV promoter, N-term GST, Geneticin selection CMV promoter, no tag, tetracycline inducible system CMV promoter, N-term 6xhis, tetracycline inducible system EF-1a promoter, C-term V5-6xHis, Geneticin selection Flp-In expression vector, EF-1a promoter, Vterm V5, Hygromycin selection With three destination vectors pcDNA3.2DEST, pDEST26, pDEST27 and Library Efficiency DH5a, LR clonase, pENTR-Gus, and Proteinase K. CMV promoter, C-term V5, Blasticidin selection

Catalog Number 12290010 12489019 12489027/ K42001 K41001 K98001 12274015 12281010 12288015 11809019 11812013 12301016 12302014 12285011 V602020 11826021

K246020

15

pcDNA3.2/GW-V5/DTOPO pcDNA6.2/nLumioDEST pcDNA6.2/cLumio DEST pcDNA6.2/cLumio DEST pcDNA6.2/cGeneBLAz er-DEST pcDNA6.2/nGeneBLAz er-DEST pcDNA6.2/cGeneBLAz er-GW/D-TOPO pcDNA6.2/nGeneBLAz er-GW/D-TOPO

CMV promoter, C-term V5, Geneticin selection CMV promoter, N-term Lumio, Blasticidin selection, Dual In-Cell Labeling kit CMV promoter, C-term Lumio, Blasticidin selection, Green In-Cell Labeling kit CMV promoter, C-term Lumio, Blasticidin selection, Red In-Cell Labeling kit. CMV promoter, C-term bla(M) tag, Blasticidin selection, in vitro or in vivo detection kit CMV promoter; N-term bla(M) tag; Blasticidin selection, in vitro or in vivo detection kit CMV promoter; C-term bla(M) tag; Blasticidin selection, in vitro or in vivo detection kit CMV promoter; N-term bla(M) tag; Blasticidin selection, in vitro or in vivo detection kit

K244020 12589032 12589016 12589024 12578043 in vivo 12578035 in vitro 12578068 in vivo 12578050 in vitro 12578084 in vivo 12578076 in vitro 12578100 in vivo 12578092 in vitro

Viral Expression Name pAd/CMV/V5-DEST pAd/PL-DEST pAd/BLOCK-iT/V5DEST pLenti 6/V5-DEST pLenti4/V5-Dest pLenti 6/UbC/V5DEST pLenti4/TO/V5-DEST pLenti 6/BLOCK-iTDEST pLenti 4/BLOCK-iTDEST pLenti6/R4R2/V5DEST

Features Adenoviral expression, CMV promoter, Cterm V5, TK polyA Adenoviral expression, promoter-less, no tags Adenoviral expression, promoter-less, use with pENTR/U6 or pENTR/H1/TO entry vectors. Lentiviral expression, CMV promoter, Cterm V5, Blasticidin selection Lentiviral expression, CMV promoter, Cterm V5, Zeocin selection Lentiviral expression, UbC promoter, C-term V5, Blasticidin selection Lentiviral expression, CMV/TO tetracyclineinducible promoter, C-term V5, Zeocin selection Lentiviral expression for RNAi studies, use with pENTR/U6 or pENTR/H1/TO entry vectors, C-term V5, Blasticidin selection Lentiviral expression for RNAi studies, use with pENTR/U6 or pENTR/H1/TO entry vectors, C-term V5, Zeocin selection Promoter-less lentiviral expression, use with pENTR5-TOPO, no tags, Blasticidin selection.

Catalog Number V49320/ K493000 V49420/ K4940-00 V49220 V49610/ K496000 V49810/ K498000 V49910/ K499010 K496700 K494300/ K494400 V48820 K591000/ K59110

Specialized vectors Name Gateway Vector Conversion system pDEST R4-R3

Features Reading frame A, B and C.1 with one-shot ccdB survival T1 cells Destination vector to be used in MultiSite Gateway system 16

Catalog Number 11828029 12537023

Gateway system pCMVSPORT6 Not I/Sal I cut pBLOCK-iT 3 DEST pBLOCK-iT 6 DEST pVAX200-DEST pSCREEN-iT/lacZDEST For mammalian library construction using Superscript Plasmid Promoter-less vector for RNAi studies, no tags, use with pENTR/U6 or pENTR/H1/TO, Geneticin selection Promoter-less vector for RNAi studies, no tags, use with pENTR/U6 or pENTR/H1/TO, Blasticidin selection CMV promoter, designed for vaccine research, Kanamycin selection in E. coli CMV promoter, N-terminal lacZ gene, reporter vector for screening RNAi 12209011 V48620 V48720 12727010/ 12727015/ 12727023 V47020/ K491500/ K491600

ASSOCIATED PRODUCTS (back to Table of Contents) Product One Shot OmniMAX 2-T1R Chemically Competent E. coli One Shot TOP10 Chemically Competent E. coli Library Efficiency DH5alpha Chemically Competent E. coli One Shot ccdB Survival T1R Chemically Competent E. coli S.N.A.P. MidiPrep Kit PureLink HQ Mini Plasmid Purification Kit PureLink PCR Purification Kit Ampicillin Kanamycin Sulfate Zeocin AccuPrime Pfx DNA Polymerase AccuPrime Pfx SuperMix Size 20 x 50 ul 20 x 50 ul 5 x 0.2 ml 10 x 50 ul 20 reactions 100 reactions 50 reactions 20 ml (10 mg/ml) 100 ml (10 mg/ml) 1g 5g 200 rxns 1000 rxns 200 rxns Catalog Number C854003 C404003 11782018 C751003 K191001 K210001 K310001 11593019 15160054 R25001 R25005 12344024 12344032 12344040

Need more help? Please email us by clicking here.

17