Full Paper Presented in Agrobiodiversity in Malaysia II :

New Species of Tiger-Milk Mushroom in Malaysia, Named as Lignosus tigerus

1

Tan Chon Seng, 2Ng Szu Ting and 2Lo Foong Peng

Strategic Research Centre, MARDI, P.O. Box 12301, 50774 Kuala Lumpur. (E-mail: cstan@mardi.gov.my ) Ligno Biotech Sdn Bhd, Tmn Ind Balakong Jaya 2, 43300 Balakong Jaya (E-mail: lignosus@yahoo.com )

ABSTRACT There are two different species of Lignosus found in Malaysia. Both species are not geographically-specific but widely spread across the country. Beside the well known species called Lignosus rhinocerus (Tiger Milk mushroom), the other species was found to be a new species which has not been identified worldwide before. We named the newly identified species as Lignosus tigerus, to reflect its relationship to Tiger-Milk Mushroom folklore story as it grow at the spot underground where the mother tiger drop its milk while feeding cubs. Morphological and phylogenetical analyses confirmed that this newly identified Lignosus species is a new taxon. The unique morphological characteristic of this new species is it has a pore size of 1-2 pores per mm, which is even bigger than the pore size of Lignosus sacer (3-4 pores per mm). The molecular phylogenetic study has also revealed that Lignosus tigerus is a new taxon which is genetically closely related to Lignosus sacer rather than Lignosus rhinocerus. The ITS sequence of Lignosus tigerus was found to share 94.0% identity to Lignosus sacer ITS sequence and 72.1% identity to Lignosus rhinoceros. INTRODUCTION The genus Lignosus consists of five species: L. rhinocerus, L. dimiticus, L. goetzii, L. sacer (Ryvarden, 1972; Ryvarden, 1975) and L. ekombitii (Douanla-Meli and Langer, 2003). Species of Lignosus is unique as a polypore as its fruiting body consists of a cap on a central stem and grows from a sclerotium in the ground, rather than from a wood as is the case with most polypores (Ryvarden L. 1991). These species have been reported to be found in the tropics and subtropics; primarily Africa, Southeast Asia and Australia. Among these species, only L. rhinocerus was reported to be found in Malaysia. L. rhinocerus is also known as Tiger Milk Mushroom (local Malay named it as Cendawan susu rimau or Cendawan susu harimau) in Malaysia. L. rhinocerus is an endangered fungus species and is one of the most important traditional medicinal mushrooms used in Malaysia. The sclerotia of L. rhinocerus have been used by local communities as a traditional medicine to treat asthma, cough, fever, cancer, liver-related illnesses, gastric ulcer, wound healing and as a health tonic to improve immunity and maintain general health (Chang and Lee, 2004). The scientific information on the genus Lignosus is scarce, and the taxonomic classification of this genus has been primarily based on morphological characteristics, such as the shapes, forms and size of caps, gills and sclerotia. However morphological characteristics alone are often inadequate for mycologists to make reliable and conclusive classification (Alexopoulos et al.; 1996, Hibbett and Donoghue, 1995). Molecular systematic has been shown to be a valuable tool in modern fungal taxonomy (Mitchell et al., 1995). The internal transcribed spacer (ITS) regions of ribosomal DNA, including both ITS1 and ITS2 regions, have been used extensively

for species-level classification, phylogenetic analyses and environmental sampling for a variety of organisms including fungi, plants, and animals (Campbell et al., 1993; Downie et al., 2000; OBrien et al., 2005). Basidiomycetes rRNA, like other fungal rRNAs, are generally composed of 5S, 5.8S, 18S small subunits (SSU) and a 25S~28S large subunit (LSU). Since rRNA structural genes are generally known to be well conserved at the genus or species levels, most molecular phylogenetic studies have been focused on the internal transcribed spacer (ITS) regions located between rRNA structural genes in the rDNA cistron (Chen et al., 2004; Kim and Lee, 2000; Lee et al., 2000; Park et al., 2004). In our effort to study the phylogenetic relationship among Tiger Milk Mushroom samples collected from various locations throughout the country. Few hundred samples were collected. When those samples were identified and found that its can categorized under two different Lignosus species. One is the well known species L. rhinocerus; and the other species was found to be a new species. Both species are not geographically-specific but widely spread across the country. In this study, morphological and phylogenetical analysis has confirmed that the newly identified Lignosus species is a new taxon. MATERIALS AND METHODS Biological Materials Few hundred Lignosus specimens were obtained from three different geographical locations in Malaysia (Cameron Highlands, Hulu Langat and Gerik). The specimens were identified according to morphological and anatomical characters described by Ryvarden (1991). In order to have reference sample in this study, two herbarium specimens, Lignosus rhinocerus and Lignosus sacer were obtained from Prof Dr. Ryvardens herbarium collection (Ryvarden, 1975). DNA Extraction The clean internal tissue of 3 each of different Lignosus sp. sclerotia was used for DNA extraction. The total DNA of 50mg sample was extracted in 500l buffer containing 100mM Tris-HCl (pH8.0), 50mM EDTA, 500mM NaCl, and 0.5% sarkosyl. After grinding into fine particles, the mixture was heated at 65C for 30 min. The mixture was extracted once with phenol:chloroform:isoamylalcohol (25:24:1). DNA in the supernatant was then precipitated by one volume of isopropanol. The precipitated DNA was washed once with ethanol, dried and finally resuspended in 200l TE80 buffer. PCR Amplification The entire ITS region (ITS-1, 5.8S rRNA, and ITS-2) was PCR amplified using primers ITS5 (5-AAGTAAAAGTCGTAACAAGG) and ITS4 (5-TCCTCCGCTTATTGATATGC) according to the conserved region for most fungi (White et al. 1990). The PCR reaction mixture consisted of 25mM Tris-HCl (pH8.8), 50mM KCl, 4.0mM MgCl2, 0.2mM of each dNTP, 25 pmol of each primers, 100 ng of sample DNA and 1 unit of Taq DNA polymerase at a total volume of 25 l. The program used for PCR amplification was as follows: initial denaturing at 94C for 5 min, followed by 25 cycles of (94C for 45 sec, 45C for 45 sec, 72C 1 min), and final extension at 72C for 5 min. The amplified PCR product was analyzed by agarose gel electrophoresis. DNA Sequencing and Analysis The amplified PCR product was purified from agarose gel using glass-milk matrix (Fermentas, USA) according to manufacturers protocol. The purified PCR product was then cloned into
89349955.doc 2

pGEM-T Easy vector (Promega, USA), and was transformed into Escherichia coli JM109 by standard protocol. Four PCR positive colonies were identified and the plasmids were isolated. After verification by EcoRI restriction digestion, the plasmids were subjected to commercial DNA sequencing service (ABI) using M13 Forward and M13 Reverse as sequencing primers. Forward and reverse sequences of each clone were manually edited and combined into a single consensus sequence. The ITS region sequences obtained were compared and analyzed by multiple sequence alignment using MEGA 4.1 (Tamura et. al., 2007). RESULTS & DISCUSSION Morphology In this study, few hundred of Tiger Milk Mushroom specimens were collected from three locations (Cameron Highlands, Hulu Langat and Gerik) in Malaysia and further identified according to morphological and anatomical characters described by Ryvarden (1991). Two groups of Lignosus species were identified based on the difference of its pore size at mushroom cap. L. rhinocerus was confirmed having 6-8 pores per mm, but the new species was found to have an obvious distinguishing characteristic with bigger pore size, 1-2 pores per mm (Fig. 1). The pore size of this newly identified species is even bigger than L. sacer (3-4 pores per mm) which has the biggest pore size among Lignosus species (Fig. 2). We, therefore, consider this species as new taxon and named as L. Tigerus, to reflect its relationship to Tiger-Milk Mushroom folklore story as it grow at the spot underground where the mother tiger drop its milk while feeding cubs. The morphological description of the new species named as L. tigerus is described below :

FRUITBODY solitary, centrally stipitate, stem arising from well developed sclerotium. Pileus orbicular, plane to saucer-shaped, few cm in diameter, pileus surface hazel to snuff brown; STIPE more or less centrally attached, arising from sclerotium, up to 8 cm long, 10-15 mm in diameter, light brown and finely velvety tomentose, formed from densely intertwined hyphae, with a thick pure white cortex, enlarged at the base forming a sclerotium; SCLEROTIUM irregular, round to somewhat elongated, covered exteriorly with a thick and dark grey (sometime reddish) cortex, the contents are of intertwined hyphae embedding innumerable large starch grains,white in colour, dense and solid; PORE SURFACE tubes 1-2.5 mm long, sometimes in 2 more or less distinct layers, free, sharply delimited round the edge of the dilated stem-apex, separated from the stem by a rim of 1-2 mm wide, white to light cream with a narrow brown sterile margin, pore variable, angular, slightly radially elongated or irregular, 1-2 pores per mm.

89349955.doc

Figure 1. The microscopic observation of L. tigerus pore surface. The distinctive characteristic of L. tigerus with bigger pore size, 1-2 pores per mm.

L. tigerus

L. sacer

Figure 2. The macro morphological comparison between L. tigerus and L. sacer. The pore size of L. tigerus (1-2 pores per mm) is distinctively bigger than L. sacer pore size (3-4 pores per mm).

ITS Length Polymorphism and Phylogenetic Analysis In addition to L. rhinocerus and L. tigerus, L. sacer sample was also been included in the phylogenetic analysis. Sequencing of the ITS region generated complete sequences for ITS 1, the 5.8S rRNA gene, and ITS 2 and provided partial sequences for the 18S and 26S rRNA genes. Fig 3 shows the rRNA ITS region sequence of L. tigerus. The DNA sequence data revealed that the length of the ITS1-5.8S-ITS2 region for the Lignosus species studied range from 554 to 591 bp (Table 1). There was a considerable variation in lengths, with a 37 bp difference between the shortest (L. tigerus) and the longest (L. rhinocerus). The overall length of the 5.8S region of all Lignosus species examined in this study was 159 bp. However, the 5.8S rRNA gene sequence had minimal impact on the overall comparison since there is little interspecies variation in this subunit. The size of the ITS1 spacer region for these three Lignosus species ranged from 192 to 209 bp, and the corresponding size for the ITS2 spacer region ranged from 203 to 223 bp.

89349955.doc

GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTA ACGAGTTTTGAAATGGGTTGTAGCTGGCCGTCCAGGCATGTGCACGCCCTGCT CATCCACTCTACACCTGTGCACTCACTGTGGGTTATGGGCAGCGTCGCCTCCG TGCGGCGTTGGCTGGGCCTGCGTTTTTACTACAAACCACTGTCAGTATCGGAA TGTCGTGTGTTGCGATGTTAACGCAAACAATGTACAACTTTCAGCAACGGATCT CTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATT GCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATT CCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTGCAGATTTTTGC TGCAGGCTTGGACTTGGAGGCCCCTTTGCCGGTTCTAGTCAGTCGGCTCCTCT TAAACGCATTAGCCTGTGTCCTTGCGGATCGGCCCCTCGGTGTGATAAAACAT GTCTACGCCGGCGACCGTGAAGCGTTTTTGGGCTGGCTTCTCAACCGTCTCGC TGAAGACAGCTTTGATATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTT AAGCATATCAATAAGCGGAGGA Figure 3. The L. tigerus rRNA ITS region sequence. The sequence is shown beginning with partial sequence of 15S rRNA (in Italic bold), ITS1 (in red), 5.8S rRNA gene (in bold), ITS2(in blue) and partial 28S rRNA region (in italic bold). Table 1. The ITS sequence length for the Lignosus species examined and the ITS sequence GenBank accession number. Length (base pair) Lignosus Species L. rhinocerus L. sacer L. tigerus Total 591 564 554 ITS1 209 195 192 5.8S 159 159 159 ITS2 223 210 203 GenBank Accession No. FJ380871 & FJ899143 GU001674 & GU001675 -

Sequence polymorphisms of the ITS region enabled the identification of species-specific alleles for closely related Lignosus species. The species could be easily differentiated on the basis of nucleotide base alternations by reference to either the ITS1 or ITS2 sequence. The identified sequence diversity among ITS generated in this study was useful in the differentiation of the closely related Lignosus species, particularly those that featured almost identical phenotypes. Based on the present results, the ITS sequence has provided a reliable means not only to rapidly identify known Lignosus species, but also facilitate the discovery of the potentially new Lignosus species, L. tigerus. Sequence similarity between the three Lignosus species ITS DNA sequences was compared using CLUSTERW, MEGA 4.1. The result revealed that ITS sequence of L. tigerus shared higher identity with L. sacer sequence (96%). Fig. 4 shows the phylogram of the neighbourjoining tree obtained by MEGA 4.1 analyses of the ITS sequences of Lignosus species. The phylogenetic tree generated showed that L. tigerus and L. sacer were clustered together. This result has indicated that the new taxon is a sister taxon of L. sacer and L. rhinocerus, and exhibited the closest genetic relationship with L. sacer. The phylogenetic tree constructed
89349955.doc 5

based on the ITS region was highly resolved and consistent with what has been observed by morphological characteristics. Thus the molecular data significantly discriminated the taxa, prior defined morphological characteristics, showing the existence of a consistency between the phenotypic descriptors and the genetic ones. Hence further verify that the newly identified Lignosus species (L. tigerus) is a new species of Lignosus genus.

Figure 4. The Phylogram of the neighbour-joining tree generated by mega 4.1 analyses of the ITS sequences of Lignosus species

CONCLUSION Morphological and phylogenetical analysis has confirmed that the newly identified species is a new Lignosus species, and we have named it as L. tigerus. The morphological unique characteristic of this species is it has a pore size of 1-2 pores per mm, which is even bigger than the pore size of Lignosus sacer (3-4 pores per mm). The molecular phylogenetic study has also revealed that it is genetically closely related to Lignosus sacer. ACKNOWLEDGEMENT The authors would like to acknowledge the kindness of Prof. Dr. Leif Ryvarden from Norway, for providing his herbarium collection of Lignosus sp. to be used as specimens for DNA identification. REFERENCES Alexopoulos CJ, Mims CW, Blackwell M. (1996). Introductory mycology. 4th ed. New York: John Wiley & Sons, Inc. p 868. Campbell B.C., Steffen-Campbell, JD., Werren, J.H. (1993). Phylogeny of the Nasonia species complex (Hymenoptera: Pteromalidae) inferred from an internal transcribed spacer (ITS2) and 28S rDNA sequences. Ins Mol Biol, 2:225237 Chang, Y.S. and Lee, S.S. (2004). Utilisation of macrofungi species in Malaysia. Fungal Diversity 15: 15-22.

89349955.doc

Chen, Y.Q., B. Hu, F. Xu, W. Zhang, H. Zhou, and L.H. Qu. (2004). Genetic variation of Cordyceps sinensis, a fruit-body-producing entomopathogenic species from different geographical regions in China. FEMS Microbiol. Lett. 230, 153-158. Douanla-Meli, C.; Langer, E. (2003). A new species of Lignosus (Polyporaceae) from Cameroon. Mycotaxon 86: 389-394 Downie SR, Katz-Downie DS, Spalik K. (2000). A phylogeny of Apiaceae tribe Scandiceae: evidence from nuclear ribosomal DNA internal transcribed spacer sequences. Am J Bot, 87:7695 Hibbett, D.S., Donoghue, M.J. (1995). Progress toward a phylogenetic classification of the Polyporaceae through parsimony analysis of mitochondrial ribosomal DNA sequences. Can J Bot 73 (Suppl 1): S853S861. Kim, K.S. and Y.S. Lee. (2000). Rapid accurate species-specific detection of Phytophthora infestans through analysis of ITS regions in its rDNA. J. Microbiol. Biotechnol. 10, 652655. Lee, Y.M., Y.K. Choi, and B.R. Min. (2000). PCR-RFLP and sequence analysis of the rDNA ITS region in the Fusarium spp. J. Microbiol. 38, 66-73. Liew, E. C. Y., Maclean, D. J. & Irwin, J. A. G. (1998). Specific PCR based detection of Phytophtora medicaginis using the intergenic spacer region of ribosomal DNA. Mycological Research 102: 7380. Mitchell JI, Roberts PJ, Moss ST. (1995). Sequence or structure ? : a short review on the application of nucleic acid sequence information to fungal taxonomy. Mycologist, 9:67 75. OBrien HE, Parrent JL, Jackson JA, Moncalvo J-M, Vilgalys R. (2005). Fungal community analysis by large-scale sequencing of environmental samples. App Environ Microbiol, 71:55445550 Park, H.G., H.G. Go, S.H. Kim, and W.M. Park. (2004). Molecular identification of Asian isolates of medicinal mushroom Hericum erinaceum by phylogenetic analysis of nuclear ITS rDNA. J. Microbiol. Biotechnol. 14: 816-821. Ryvarden L. (1991). Genera of polypores: nomenclature and taxonomy. Syn Fungi, 5:1363. Ryvarden, L. (1972). A critical checklist of the Polyporaceae in tropical East Africa. Norwegian Journal of Botany 19: 229-238 Ryvarden, L. (1975) Studies in the Aphyllophorales of Africa 3. Three new polypores from Zare Bulletin du Jardin Botanique National de Belgique 45: 197-203 Tamura, K., Dudley J, Nei, M & Kumar, S. (2007). MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24:1596-1599. (Publication PDF at http://www.kumarlab.net/publications) White, T. J., T. Bruns, S. Lee, and J. W. Taylor. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications (Innis, M.A., D. H. Gelfand, J. J. Sninsky, and T. J. White, ed.) p. 315322. Academic Press, Inc., New York.

89349955.doc