THE JOURNAL OF BIOLOGICAL CHEMISTRY
13907–13917, 2000
© 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
Identification of a Homeodomain Binding Element in the Bone
Sialoprotein Gene Promoter That Is Required for Its
Osteoblast-selective Expression*
Received for publication, June 21, 1999, and in revised form, February 14, 2000
M. Douglas Benson‡, Jeffrey L. Bargeon§, Guozhi Xiao§, Peedikayil E. Thomas§, Ahn Kim§,
Yingqi Cui§, and Renny T. Franceschi‡§¶
From the ‡Department of Biological Chemistry, School of Medicine and the §Department of Periodontics, Prevention, and
Geriatrics, School of Dentistry, University of Michigan, Ann Arbor, Michigan 48109-1078
Bone sialoprotein is a 70-kDa extracellular matrix
component that is intimately associated with biominer-
alization, yet the cis-acting elements of the Bsp gene
that restrict its expression to mineralizing cells remain
uncharacterized. To identify such elements, we ana-
lyzed a 2472-base pair fragment of the murine promoter
that directs osteoblast-selective expression of a lucifer-
ase reporter gene and found that the region between
–338 and –178 relative to the transcriptional start is
crucial for its osteoblast-selective activity. We identified
an element within this region that binds a protein com-
plex in the nuclear extracts of osteoblastic cells and is
required for its transcriptional activity. Introduction of
a mutation that disrupts a homeodomain binding site
within this sequence eliminates both its in vitro binding
and nearly all of the osteoblastic-selective activity of the
2472-base pair promoter. We further found that the Dlx5
homeoprotein, which is able to regulate the osteoblast-
specific osteocalcin promoter, can bind this element and
stimulate its enhancer activity when overexpressed in
COS7 cells. These data represent the first description of
an osteoblast-specific element within the bone sialopro-
tein promoter and demonstrate its regulation by a mem-
ber of a family of factors known to be involved in
skeletogenesis.
Bone sialoprotein (BSP)1 is a 70-kDa extracellular matrix
component that is selectively produced by mineralizing cell
types in a pattern that correlates with the onset of mineral
formation in vivo. This expression pattern, combined with ev-
idence that BSP binds collagen (1) and can nucleate hydroxy-
apatite formation in vitro (2), has led to the widely held theory
that BSP plays a central role in biomineralization. In osteo-
blasts, which produce the vast majority of BSP, expression is
further restricted to those cells that have secreted, and are
actively mineralizing, a type I collagen matrix (3). Thus, BSP is
one of the primary markers of the terminally differentiated
* This work was supported by National Institutes of Health Grants
DE12211 and DE 11723, General Clinical Research Center Grant M01-
RR00042, and Michigan Multipurpose Arthritis Center Grant AR
20557. The costs of publication of this article were defrayed in part by
the payment of page charges. This article must therefore be hereby
marked “advertisement” in accordance with 18 U.S.C. Section 1734
solely to indicate this fact.
¶ To whom correspondence should be addressed: Dept. of Periodon-
tics, Prevention, and Geriatrics, School of Dentistry, University of
Michigan, 1011 N. University Ave., Ann Arbor, MI 48109-1078. Tel.:
734-763-7381; Fax: 734-763-5503; E-mail: rennyf@umich.edu.
1
The abbreviations used are: BSP, bone sialoprotein; bp, base pair(s);
kb, kilobase(s); OSE, osteoblast-specific element; PCR, polymerase
chain reaction; ␤-gal, ␤-galactosidase.
This paper is available on line at http://www.jbc.org
Vol. 275, No. 18, Issue of May 5, pp.
Printed in U.S.A.
osteoblast, and, as such, a study of its expression is important
to our understanding of the transcriptional mechanisms that
mediate osteoblast differentiation.
Extensive studies of the osteocalcin gene 2, which encodes
another osteoblast-specific protein, have revealed that its os-
teoblast-selective expression is dependent on binding sites for
the Cbfa1 transcription factor in its promoter (named osteo-
blast-specific element 2 (OSE2)) (4). Furthermore, Cbfa1,
which itself exhibits bone-restricted expression, has since been
shown to be required for osteoblast development in general, as
Cbfa1 –/– mice lack functional osteoblasts (5). This finding
prompted speculation that this factor may control the tran-
scription of other osteoblast-related genes by binding similar
OSE2 sites in their promoters. However, we recently investi-
gated the contribution of two putative Cbfa1 binding sites to
the activity of a 2.5-kb fragment of the murine Bsp promoter
that exhibits osteoblast-selective expression. We found that
neither site exhibited significant enhancer activity nor contrib-
uted to the activity of the 2.5-kb Bsp promoter, suggesting that
other cis-acting elements must be responsible for its osteoblast-
selective expression (6). Although at first this result seems
surprising, it is, perhaps, less so when we consider that BSP
and osteocalcin are associated with different biochemical func-
tions in vivo. That is, whereas BSP is associated with mineral
formation, osteocalcin appears to play a role in bone resorption
and turnover (7, 8). Thus, it is reasonable to expect that these
two genes, while both markers of the differentiated osteoblast,
may be differently regulated.
In addition to Cbf/runt sites, a number of other known en-
hancer sequences have been described within the Bsp pro-
moter, but little progress has been made toward identification
of the elements necessary for its osteoblastic-selective expres-
sion. Sodek and co-workers (9 –11) have characterized elements
within the rat promoter that mediate the actions of vitamin-D,
glucocorticoids, and transforming growth factor-␤, and Yang
and Gerstenfeld (12) reported that parathyroid hormone-re-
sponsive elements in the avian Bsp promoter are also tran-
scriptionally active. However, none of these elements has been
shown to confer tissue specificity. Kerr et al. (13) described a
binding site for Ying Yang 1, a factor implicated in the tran-
scriptional initiation of some TATA-less promoters, within in-
tron 1 of the rat gene, which displayed higher levels of en-
hancer activity in UMR 106-01 osteosarcoma cells than in
fibroblasts. However, since this sequence is not conserved in
the corresponding region of either the human or mouse genes,
and no intronic sequence is found in the –2472/⫹41 murine
promoter, this element is clearly not essential for osteoblast-
specific expression.
Because efforts to link the tissue specificity of the Bsp pro-
moter to a variety of known transcription factor binding se-
13907
13908 Osteoblast Specificity of the Mouse Bsp Promoter
quences have so far been unsuccessful, we took the alternate
approach of conducting a systematic study of the 2472-bp pro-
moter to identify osteoblast-specific elements. As we report
here, this study has revealed that a homeodomain binding site
in the proximal promoter is required for the tissue-specific
expression of the murine Bsp gene. Furthermore, this site is
positively regulated by the Dlx5 homeoprotein, which is known
to play an important role in skeletogenesis.
EXPERIMENTAL PROCEDURES
Cell Culture and Transfections—The following cell lines were used
for these studies: The isolation of preosteoblastic clone 4 cells from the
parent MC3T3-E1 line (14) was described by Xiao et al. (15). UMR
106-01 cells (16) were a gift from Dr. Ronald Midura (Cleveland Clinic,
Cleveland, OH). C2C12 mouse myoblasts (17) were a gift from Dr.
Daniel Goldman (University of Michigan, Ann Arbor, MI). ROS 17/2.8
osteosarcoma cells (18), were provided by Dr. Laurie McCauley (Uni-
versity of Michigan School of Dentistry). The 3T3-L1 preadipocyte (19),
F9 teratocarcinoma (20), and S194 myeloma cell lines were purchased
from the American Type Culture Collection (Manassas, VA). Mainte-
nance conditions for these cell lines were previously described (6). COS7
monkey kidney cells (21) were the gift of Dr. Fred Askari (University of
Michigan) and were maintained in Dulbecco’s modified Eagle’s medium
with 10% fetal bovine serum and 1% penicillin/streptomycin. C2C12
cells were induced to differentiate into myotubes by switching to 2%
horse serum for 6 days. An adipose phenotype of lipid accumulation was
induced in 3T3-L1 cells by growth in 30% fetal bovine serum for 6 days
(19). F9 cells were induced to differentiate into endoderm by the addi-
tion of 0.1 ␮M retinoic acid and 1.0 mM dibutyryl cyclic AMP for 6 days
(20). Clone 4 differentiation was accomplished by the addition of 50 ␮g/ml
ascorbic acid to the medium for 6 days to induce matrix synthesis and
subsequent expression of osteoblast-related genes, including osteocalcin
and BSP (22). Media were changed every 2 days during treatment.
All adherent cell lines were plated in 35-mm dishes at a density of
25 ⫻ 104 cells/cm2 and transfected with the appropriate firefly lucifer-
ase reporter construct plus pRL-SV40 Renilla luciferase vector (Pro-
mega Corp., Madison, WI) for normalization of transfection, using Li-
pofectAMINE (Life Technologies, Inc.) as described previously (6). Cells
were switched to the appropriate differentiation media and grown for 6
days, except for COS7 cells, which were additionally transfected with
100 ng of either pcDNA3-Dlx5 or pCMV5-␤-gal expression plasmid and
harvested 48 after transfection. S194 myeloma cells were transfected by
electroporation as described elsewhere (6). They were then transferred
to growth medium for 48 h before harvesting. Luciferase expression in
the cell lysates was assayed using the Dual Luciferase Reporter kit
(Promega) and a Monolight 2010 luminometer (PharMingen, San Di-
ego, CA). All transfection experiments were performed in triplicate at
least three times. Values shown are the means ⫾ standard deviations of
triplicate samples from representative experiments.
To produce Dlx5-containing or control COS7 nuclear extracts for gel
shift experiments, cells were plated at the same density as above, but in
150-mm dishes, and transfected with either pcDNA3-Dlx5, or pCMV5-
␤-gal plasmid (see below). The cells were harvested after 48 h, and
nuclear extracts were prepared as described below.
DNA Constructs—Construction of pmBSP2472 was described previ-
ously (6). This vector, renamed p2472, contains the region of the murine
Bsp gene from –2472 to ⫹41 ligated upstream of a firefly luciferase
reporter gene in pGL3Basic (Promega). The 5⬘-deletion constructs p705,
p338, p178, and p49 were created by ExoIII digestion of p2472 linear-
ized with KpnI and MluI using the Erase-a-Base kit (Promega) accord-
ing to the manufacturer’s instructions. The p49BSP luciferase reporter
vector was constructed by ligating a double-stranded, synthetic oligo-
nucleotide containing the sequence of the basal murine Bsp promoter
from – 49 to ⫹41 into the BglII and HindIII sites of pGL3Basic. The
p34OG2 vector containing a fragment of the osteocalcin gene 2 pro-
moter from –34 to ⫹1 was created in a similar fashion, as described
previously (6). This fragment has previously been shown to direct high
levels of matrix-induced transcription in MC3T3-E1 cells when posi-
tioned downstream of a bone-specific enhancer. Double-stranded oligo-
nucleotides containing wild type and mutant A, B, and C elements from
the Bsp promoter (see Table I) were synthesized by the University of
Michigan Core Facilities. They were then self-ligated and inserted into
the BglII site of both p49BSP and p34OG2 in order to compare the
enhancer activities of the Bsp sites with those of the minimal promoters
alone. A, B, or C element sequences were deleted from the 705-base pair
promoter to create p705⌬A, p705⌬B, and p705⌬C as follows: primer
pGL3(–), which anneals to the antisense strand of the vector immedi-
ately 3⬘ of the pGL3Basic multiple cloning site, was used in conjunction
with BglII linker primers –253(⫹), –226(⫹), and –180(⫹) to amplify
three different length fragments by the polymerase chain reaction
(PCR) using Taq polymerase (Applied Biosystems, Foster City, CA).
These fragments were ligated into the BglII and HindIII sites of
pGL3Basic. Primers –279(–), A(–), and B(–) were then used with primer
pGL3(⫹), a KpnI linker primer that anneals to the antisense strand of
the plasmid upstream of the multiple cloning site, to create PCR frag-
ments representing the upstream segments of the final constructs.
These fragments were blunted with Klenow, digested with KpnI, and
ligated into the KpnI and SmaI sites of the plasmids, which already
harbored the downstream PCR fragments described. The resulting Bsp
reporter constructs are missing 26, 30, and 50 bp of Bsp sequence for A,
B, and C deletions, respectively, which is replaced with cloning site
sequence for net total deletions of 8, 13, and 33 bp. These constructs are
graphically depicted in Fig. 5A. The sequences of the primers used in
their construction are given in Table I. These internal deletion con-
structs were transfected into clone 4 and UMR 106-01 cells under the
conditions described above in order to assess the effect on promoter
activity of deletion of these elements in the context of the 705 base pair
Bsp promoter. To create the probe plasmid pBSPfp1, harboring the
insert used as a probe in our footprinting studies, we used linker
primers –369(⫹) and –165(–) (see Table I) to PCR amplify a Bsp pro-
moter fragment, which we then ligated into the BamHI and EcoRI sites
of pBluescript SK(⫹) (Stratagene, La Jolla, CA). Creation of
p2472mut3, containing the 2472-bp Bsp promoter with a 2-bp mutation
in the C element sequence, was accomplished as follows: primers
Cmut3SD(⫹) and (–) (Table I) were used with Stratagene’s Quick-
Change site-directed mutagenesis kit according to the manufacturer’s
instructions to introduce the desired mutation into p2472. An EcoRV/
XhoI fragment containing Bsp promoter sequence from –1016 to ⫹41
was then isolated from the mutagenized plasmid and ligated into the
corresponding position in the unmutagenized p2472 plasmid. This
strategy was used so that the resultant construct contained a much
shorter length of in vitro polymerized sequence that would have to
undergo confirmatory sequencing. The sequences of all in vitro synthe-
sized constructs were confirmed by dideoxy sequencing using a Seque-
nase 2.0 kit (Amersham Pharmacia Biotech). The pcDNA3-Dlx5 expres-
sion plasmid was the generous gift of Dr. Dwight Towler (Merck, Inc.,
West Point, PA) and contains a sequence that encodes a FLAG epitope
tag 5⬘ to codon 2 of a murine Dlx5 cDNA, resulting in the production of
an N-terminal “FLAG-tagged” protein (23). pCMV5-␤-gal was created
by ligating a bacterial lacZ cDNA from pRSV␤-gal (a gift from Dr.
Daniel Wechsler, University of Michigan) into the EcoRI site of pCMV5
(Sigma).
Northern Analysis—Total RNA from cells subjected to differentia-
tion treatments as described above was isolated by the method of
Chomczynski and Sacchi (24). 10 ␮g aliquots were fractionated on 1%
agarose-formaldehyde gels and blotted to nylon membranes as de-
scribed previously (25). The mouse BSP cDNA insert used as probe was
isolated from a plasmid obtained from Dr. Marion Young (NIDCR,
National Institutes of Health) (26). The Dlx5 cDNA was obtained from
Dr. Steven Harris (University of Texas Health Center at San Antonio,
San Antonio, TX). Both were labeled with [␣-32P]dCTP using a random
primer kit (Roche Molecular Biochemicals), and incubated with the
membranes in a Bellco Autoblot hybridization oven as described previ-
ously (27). The washed membranes were then exposed to Kodak X-omat
AR film at –70 °C.
DNase I Footprinting Assays—Nuclear extracts were prepared after
the method of Dignam et al. (28) from cells grown under differentiation
conditions. Additionally, nuclei from ascorbic acid-treated clone 4 cells
were isolated from the collagenous matrix by treatment with 2 mg/ml
collagenase A (Sigma) and 0.25% trypsin (Life Technologies, Inc.) for 1 h
followed by exhaustive rinsing in cold phosphate-buffered saline before
continuing with the extraction of nuclear proteins. Footprinting assays
were performed as follows: 5 ␮g of probe plasmid was digested with
either BamHI (to label the positive strand) or EcoRI (to label the
negative strand). The cut linearized plasmid was then treated with calf
intestinal alkaline phosphatase, labeled with [␥-32P]ATP using T4
polynucleotide kinase, and digested with either EcoRI or BamHI. The
released insert was then purified from a 5% acrylamide gel, and its
activity was quantitated with a scintillation counter. 15,000 cpm of
these probes and 0, 25, 50, or 75 ␮g of nuclear extract were incubated
for 20 min at room temperature in a 100-␮l reaction volume containing
25 mM Tris-HCl, pH 8.0, 50 mM KCl, 6.25 mM MgCl2, 0.5 mM EDTA, 0.5
mM dithiothreitol, and 10% glycerol, with 5 ␮g of poly(dI䡠dC). An equal
volume of a 2.5 mM CaCl2, 5 mM MgCl2 solution was added, and the
 Osteoblast Specificity of the Mouse Bsp Promoter
reactions were digested with 1.2 units of RNase free DNase I (Promega)
for 60 s at room temperature. Digestion was stopped by the addition of
180 ␮l of stop solution (200 mM NaCl, 30 mM EDTA, 1% SDS, and 100
␮g/ml yeast tRNA), followed by extraction with phenol/chloroform/
isoamyl alcohol (25:24:1) equilibrated with TEB (10 mM Tris, pH 8.0, 1
mM EDTA, and 15 mM ␤-mercaptoethanol). The samples were precipi-
tated with 1 ml of ethanol, rinsed twice with 70% ethanol, dried, and
resuspended in 5 ␮l of loading buffer (95% formamide, 20 mM EDTA,
0.05% bromphenol blue, 0.05% xylene cyanol). After heating for 5 min at
95 °C, the samples were then electrophoresed on a sequencing gel of 8%
acrylamide (19:1 with bis-acrylamide) in 1⫻ TBE at 60 W. The gels
were dried and exposed to Kodak BioMax film at ⫺70 °C. In order to
determine positions of the protected nucleotides in these assays, the
samples were run alongside aliquots of the same probes subjected to
chemical sequencing reactions after the method of Maxam and Gilbert
(29).
Gel Mobility Shift Assays—Gel shift probe was made by labeling 1.5
pmol of double-stranded C oligonucleotide (shown in Table I) with
[␥-32P]ATP and T4 kinase; filling in with Klenow, cold G, A, and T
nucleotides, and [␣-32P]dCTP; and purifying the labeled oligo on a 5%
acrylamide gel. Gel mobility shift assays were performed by incubation
at 4 °C for 30 min of 5 ␮g of nuclear extract with approximately 5 fmol
of probe in a 15-␮l reaction containing 2 ␮l of poly(dI䡠dC) in the same
binding buffer that was used in the footprinting assays described above.
For experiments including antibody, samples were then incubated for
an additional 30 min with either 4 ␮g of anti-FLAG M2 monoclonal
antibody (Stratagene) or IgG as control (Life Technologies) and, in some
cases, 100 ng of FLAG peptide (Sigma). The shifted complexes were
then electrophoresed on 5% acrylamide gels in 1⫻ TGE (50 mM Tris-
HCl, pH 8.5, 380 mM glycine, 2 mM EDTA, 0.2 mM ␤-mercaptoethanol)
for 120 min at 170 V in a 4 °C cold room. Gels were dried and exposed
to BioMax film.
RESULTS
Osteoblast-selective Expression of the 2.5-kb Bsp Promot-
er—In order to identify tissue-specific elements in the BSP
promoter, we employed a construct containing bases –2472 to
⫹41 of the murine gene driving expression of a luciferase
reporter gene. Our decision to focus on this region was based on
previous work which demonstrated that this construct was able
to direct 5–10-fold higher levels of expression in osteoblastic
cells than in nonbone cell lines (6), indicating that this frag-
ment of the promoter likely contains sequence elements neces-
sary to direct tissue-specific BSP expression. This finding is in
agreement with data reported by Chen et al. (30), which
showed mineralized tissue-restricted expression of a similar
region of the rat BSP promoter in transgenic mice. As a prelude
to a detailed analysis of the sequence elements responsible for
this selective expression, a more thorough characterization of
the expression of this reporter construct was performed in
various osteoblastic cell lines to determine whether its regula-
tion pattern parallels that of the endogenous BSP message.
The murine MC3T3-E1 preosteoblastic cell line produces
high levels of bone-related proteins, including BSP, in response
to induction of collagen matrix synthesis by ascorbic acid (31).
For our studies, we employed a subclone, clone 4, which gives
higher levels of bone marker transcription than the more het-
erogeneous parent cell line (15). Upon transfection with the
p2472 construct, and treatment with ascorbic acid over a 7-day
time course, clone 4 cells showed a significant induction in
reporter activity— up to 40-fold over that in nontreated cells by
day 7—that paralleled the increase in endogenous BSP mes-
sage (Fig. 1, A and B). By way of comparison, ROS 17/2.8
osteosarcoma cells, which express high levels of osteocalcin but
not of BSP (Fig. 1C), exhibited only 20% of the luciferase
activity seen in clone 4 cells when transfected with the p2472
construct, comparable to those seen in C2C12 myoblasts and
3T3-L1 preadipocytes, two mesenchymal cell lines that do not
express BSP (Fig. 1D). However, UMR 106-01 osteosarcoma
cells, which constitutively express high levels of BSP (16),
showed levels of expression of the transfected construct that
13909
are comparable to those in clone 4 cells (Fig. 2). Thus, the
2472-bp murine Bsp promoter is expressed at high levels only
in cells that produce BSP and in a pattern that mirrors that of
the endogenous message.
Isolation of a Region Necessary for Osteoblast Selectivity by
5⬘-Deletion Analysis—We created a series of 5⬘-deletions of the
2472-bp promoter construct in order to isolate regions of the
fragment responsible for its osteoblast selective expression.
These deletions were transfected into osteoblastic cell lines
(MC3T3-E1 and UMR 106-01) and nonbone cells (C2C12 myo-
blasts, 3T3-L1 preadipocytes, F9 teratocarcinoma, and S194
lymphocytes) and grown under conditions that induced differ-
entiation appropriate for each cell type (osteoblast, muscle,
adipose, endoderm, and B lymphocyte, respectively; see under
“Experimental Procedures”). The object of these treatments
was to approximate a panel of different tissue types in cell
culture so as to examine the tissue selectivity of the transfected
Bsp promoter constructs. The results of these transfections,
shown in Fig. 2, revealed three major features. (i) Deletion of
the promoter sequence from –2472 to –178 caused no change in
activity in the nonbone cell lines, whereas further deletion to
– 49 resulted in a drastic loss of activity in all cell lines. This
likely means that the region from – 49 to –178 contains se-
quences required for basal, non-tissue-specific transcription.
(ii) Deletion from –2472 to –338 reduced promoter activity in
clone 4 cells by approximately 60% but caused only a slight
drop in UMR 106-01 cells. This segment may contain regula-
tory sequences that are required for high level transcription in
the MC3T3-E1 cell line but not in the tumor-derived UMR line.
(iii) Deletion of sequences from –338 to –178 resulted in a loss
of over half of the remaining activity in both clone 4 and UMR
lines. This represents the most severe drop in activity to that
point and brings the activity in these cells down to that seen in
the nonosteoblastic cell lines, indicating that the region from
–338 to –178 most likely contains elements crucial to the bone-
selective expression of the promoter. Interestingly, we noted
the presence of a sequence similar to the OSE1 site, described
by Ducy and Karsenty (4) and Schinke and Karsenty (32) as
important to the tissue-specific expression of osteocalcin, at
–566 (TTACATCA). However, because deletion of the region
containing this sequence resulted in only a relatively small
decrease in activity in clone 4 cells and none in UMR cells, and
because this deletion did not abolish tissue specificity, it was
not considered further.
DNase I footprint analysis was employed to determine which
bases in the –338 to –178 region contacted protein complexes in
the nuclear extracts of osteoblastic cells. Preincubation of a
probe containing promoter sequence from –390 to –165 with
increasing amounts of UMR nuclear extract resulted in the
protection of three regions (Fig. 3A) on both the sense strand
(lanes 2– 4) and the corresponding antisense strand (lanes
6 – 8). The same pattern was seen when nuclear extracts from
ascorbic acid-treated clone 4 cells were used (not shown). To-
gether, these three regions, named A, B, and C, were found
between –278 and –187 and are represented graphically in Fig.
3B. When compared with their corresponding sequences in the
rat and human Bsp promoters (Fig. 3C), the A, B, and C
elements show a high degree of sequence conservation, consist-
ent with a potentially crucial role in regulating transcription.
Both the A and B regions are AT rich and do not contain any
recognizable transcription factor binding sites. The C element,
however, contains a consensus binding site for engrailed-1 (33,
34), marking it as a potential binding site for a wide range of
homeodomain-containing factors.
To determine whether these three elements were able to
function as transcriptional enhancers, we synthesized A, B,
13910 Osteoblast Specificity of the Mouse Bsp Promoter
FIG. 1. Osteoblast-selective activity of the 2472-bp Bsp pro-
moter. A, time course of Bsp promoter induction. MC3T3-E1 clone 4
cells were transfected with p2472 and grown for up to 6 days with (A) or
without (C) ascorbic acid. Cells were harvested at the times indicated
and assayed for firefly and Renilla luciferase activities. B, induction of
endogenous BSP mRNA in MC3T3-E1 cells. Total RNA from clone 4
cells, grown with or without ascorbic acid and harvested at the times
shown, was subjected to Northern blot analysis with a labeled BSP
cDNA. C, cell line specificity of BSP mRNA expression. Northern analysis
FIG. 2. 5ⴕ-Deletion analysis of the Bsp promoter. ExoIII deletion
of the p2472 construct yielded the set of 5⬘-deletions of the murine Bsp
promoter shown. These deletion constructs were transfected into clone
4, UMR 106-01, C2C12, 3T3-L1, F9, and S194 cells and grown under
differentiation conditions. Firefly luciferase activities were assayed and
normalized to Renilla luciferase and are shown as a percentage of the
activity of the full-length construct in clone 4 cells.
and C double-stranded oligonucleotides containing the se-
quences shown in Fig. 3C (see also Table I) and subcloned
multimers of them, in both orientations, into a firefly luciferase
reporter plasmid upstream of a minimal – 49/⫹41 Bsp promoter
fragment. When transfected into both the clone 4 and UMR cell
lines, only the C element construct exhibited elevated reporter
activity relative to the minimal promoter alone (Fig. 4A, com-
pare rows 1, 4, and 7), with levels approximately 3-fold higher
in clone 4 cells and 2-fold higher in UMR. The same pattern
was observed when the three elements were placed into a
similar vector containing a 34-bp minimal promoter from the
murine osteocalcin gene 2, which has been shown to be en-
hanced by multimers of the bone-specific OSE2 element (4, 6).
In this case, however, the C element displayed a 2–3-fold stim-
ulation in both osteoblastic cell lines when placed in the for-
ward orientation (Fig. 4B, row 4) and a 10 –13-fold stimulation
when in the reverse orientation (row 7). This apparent orien-
tation dependence may result from the presence of one more
copy of the C element in the reverse construct (five) than in the
forward construct (four). To assess the transcriptional contri-
butions of these elements in the context of the native promoter,
we then created three reporter constructs from which either
the A, B, or C element had been deleted from the –705-bp Bsp
promoter and compared their activities to that of the wild type
–705-bp construct when transfected into both clone 4 and UMR
cell lines. The construction of these internal deletion mutants
(named p705⌬A, ⌬B, and ⌬C) is diagrammed in Fig. 5A. The
705-bp promoter was chosen as the template for these deletions
because it contains enough promoter sequence to exhibit osteo-
blast specificity but is short enough to make confirmatory se-
quencing of the resultant PCR-produced fragments feasible. As
is shown in Fig. 5B, deletion of the A element did not effect
promoter activity in clone 4 cells, and although deletion of the
B element reduced promoter activity by approximately 35% in
UMR cells, it did not affect activity in clone 4 cells. Because the
B element also failed to show enhancer activity when placed in
front of a minimal promoter (Fig. 4), it was not considered
was conducted on RNA from MC3T3-E1 clone 4, ROS17/2.8, C2C12, and
3T3-L1 cells grown for 6 days under differentiating conditions. D, cell
line specificity of Bsp promoter activity. Clone 4, ROS17/2.8, C2C12,
and 3T3-L1 cells were transfected with p2472 and grown for 6 days
under the same conditions as in D. Firefly luciferase activities were
normalized to Renilla luciferase activities and are shown as a percent-
age of the clone 4 ascorbate-treated sample.
 Osteoblast Specificity of the Mouse Bsp Promoter 13911

FIG. 3. DNase I footprint analysis of

the –338 to –178 promoter region. A, a
construct containing the murine Bsp pro-
moter from –338 to –178 was linearized
with EcoRI (to label the (⫹) strand) or
BamHI (for the (–) strand), end-labeled
with 32P, and incubated with the indi-
cated amount of UMR nuclear extract be-
fore digestion with DNase I. Digested
products were run on a sequencing gel
and compared with digested probe with-
out extract. The three regions that were
protected on both strands are named A, B,
and C and are indicated by brackets. The
base pair numbering of the ends of each
protected region is also shown. Asterisks
mark bands that were intensified due to
the creation of DNase I hypersensitivity
caused by the adjacent bound proteins. B,
shown is the region of the Bsp promoter
from –290 to –181 with the bases pro-
tected from DNase I digestion in A
marked by brackets (only the (⫹) strand
sequence is shown for simplicity). Brack-
ets above the base sequence denote the
protected bases on the (⫹) strand in A,
whereas those below the sequence denote
the corresponding protected bases on the
(–) strand. C, sequence conservation of A,
B, and C sequences. Brackets mark the
sequences of the A, B, and C oligonucleo-
tides that contain the protected bases in-
dicated in B. The base pair numbers in
the promoter sequence corresponding to
the ends of each oligonucleotide are
shown above the brackets. Shown below
each are the homologous regions of the rat
and human Bsp promoters for sequence
comparison. A consensus binding site for
the engrailed-1 homeodomain protein was
found in region C and is boxed.

further. In contrast to the A and B deletions, however, deletion
of the C element from the 705-bp promoter caused a major loss
of transcriptional activity in both cell types. And, in fact, this
deletion accounted for the entire 60% drop in activity seen upon
removal of the entire region from –338 to –178 in these cell
lines (compare Figs. 2 and 5B). The results from these deletion
transfections are in agreement with the data from the multim-
erized oligonucleotide experiments described above, and, taken
together, these two complementary studies indicate that the C
element is likely the only one of the three that is important for
promoter activity in osteoblastic cells. Thus, we chose to focus
our further investigations on this sequence element.
Identification of a Homeodomain Binding Site in the C Ele-
ment that is Necessary for Osteoblast-selective Bsp Promoter
Activity—Gel mobility shift assays of nuclear extracts from
UMR and clone 4 cells with radiolabeled double-stranded C
oligonucleotide as probe yielded a complex array of bands (Fig.
6, lane 2). All but one of these species (bands 1–5) could be
competed for, to varying degrees, by the addition of 50 –100-fold
molar excess of unlabeled C oligonucleotide (Fig. 6, lanes 3 and
4) but not by the addition of a heterologous oligonucleotide
containing the proximal OSE2 site from the Og2 promoter (4)
(data not shown), indicating that this element is able to specif-
ically bind a protein complex in the nuclear extracts of these
osteoblastic cells. We synthesized a series of mutated C oligo-
nucleotides to determine which bases in the C element were
essential for protein binding. These contained the same se-
quence as the wild type C oligonucleotide shown in Table I,
with the exception of a 2-base pair change in each. The identity
of the mutated bases in each, and their effects on the binding of
13912 Osteoblast Specificity of the Mouse Bsp Promoter
TABLE I
Oligonucleotides used in this study
Oligo name Sequence

A GATCCTTTGCTATTTATTTTATTTGAA
GAAAACGATAAATAAAATAAACTTCTAG
B GATCCAGTATATTATTATATATATTCA
GTCATATAATAATATATATAAGTCTAG
Ca GATCCTCCTCACCCTTCAATTAAATCCCACAA
GAGGAGTGGGAAGTTAATTTAGGGTGTTCTAG
⫺369(⫹) TATGAATTCACTTTAGACCCCATGCAGTG
⫺253(⫹) TATGGATCCGCAGTATATTATTATATATATTCAGAACTC
⫺226(⫹) TATGGATCCCTCTAACTACCATCTTCTCC
⫺180(⫹) TATGGATCCCAAGCCTCTTGGCAGAAGG
⫺279(⫺) GATCGACTTAAGCATTTAAGCTTTC
⫺165(⫺) TATGGATCCCAAGAGGCTTGCATTGTGG
pGL3(⫹) TATGGTACCTGCCAGAACATTTCTCTATCG
pGL3(⫺) ATGCCAAGCTTACTTAGATCG
Cmut3SDb CCATCTTCTCCTCACCCTTCCCTTAAATCCCACAATGCAAG
GGTAGAAGAGGAGTGGGAAGGGAATTTAGGGTGTTACGTTC
a
The sequences of the C mutant oligonucleotides used in this study are the same as those of the wild type shown here except for the two base
pair changes shown in Fig. 6A.
b
The two base pairs that differ from the wild type BSP sequence are shown in boldface.

FIG. 4. Enhancer activity of A, B,

and C elements. A, A, B, and C double-
stranded oligonucleotides were ligated
into multimers and inserted immediately
upstream of a 49-bp minimal Bsp pro-
moter driving luciferase expression in the
p49BSP vector. Constructs containing
oligonucleotides oriented in either the for-
ward (F) or reverse (R) direction were
transfected into clone 4 and UMR cells.
Cells were harvested after 6 days and as-
sayed for luciferase activity (clone 4 cells
were treated with ascorbic acid). Values
shown are fold induction of each construct
over that of the insertless p49BSP vector
(row 1). Each arrow represents one copy
of a double-stranded oligonucleotide. The
open box represents the Bsp promoter
from – 49 to ⫹41. B, multimers of A, B,
and C oligonucleotides were also ligated
into the p34OG2 vector, which is the same
as the p49BSP vector described above, ex-
cept that the osteocalcin gene 2 promoter
from –34 to ⫹1 is substituted for the – 49/
⫹41 Bsp fragment. The resulting con-
structs were transfected into clone 4 and
UMR cells as in A.

the C probe when used as competitors in gel shift assays, are ognizable transcription factor binding site in the C sequence.
shown in Fig. 6. We chose a series of mutations that spanned Addition of a 50 –100-fold molar excess of unlabeled mutant 1
the consensus homeodomain site because this is the only rec- or mutant 6 oligonucleotides (Fig. 6, lanes 5, 6, 15, and 16)
 Osteoblast Specificity of the Mouse Bsp Promoter 13913

FIG. 5. Effect of A, B, or C internal

deletions on the activity of the p705
construct. A, different combinations of
primers (represented as arrows) were
used with p705 as a template to create
PCR fragments containing sequences ei-
ther upstream or downstream of the de-
sired deletion, as described under “Exper-
imental Procedures.” These fragments
were ligated into pGL3Basic to create the
p705⌬A, p705⌬B, and p705⌬C constructs
represented here. The hatched bar repre-
sents Bsp promoter sequence. The open
bar is pGL3 sequence. Dashed lines indi-
cate the sequences that are deleted from
the final constructs. The end points of the
deleted promoter sequences are shown
relative to the start of transcription above
each construct. B, the deletion constructs
shown in A, as well as the complete p705,
were transfected into clone 4 and UMR
cells. Their activities are shown as per-
centages of p705 activity in each cell line.

showed that these mutants were able to compete for protein
binding nearly as well as the wild type C probe. Mutants 2–5,
however, were unable to compete with the wild type sequence.
Taken together, these assays show that disruption of the ho-
meodomain binding sequence, TCAATTAA, abolishes the abil-
ity of the C element to bind protein complexes in the nuclei of
osteoblastic cells.
To test whether this sequence requirement for in vitro bind-
ing also applied to the enhancer activity of the C element, the
ability of the mutant oligonucleotide 3 (Cmut3) to stimulate
transcription of the – 49/⫹41 Bsp minimal promoter was com-
pared with that of the wild type C element described above. As
expected, a construct containing three copies of the wild type
sequence gave up to 3-fold higher activity in osteoblastic cells
than the minimal promoter alone (Fig. 7A, row 2), but the
mutant construct, which differed from the wild type by only 2
bp, showed no such stimulation. To assess the contribution of
the homeodomain binding site to the osteoblast specificity of
the Bsp promoter, we introduced the same 2 bp mutation, by
site-directed mutagenesis using primers Cmut3SD(⫹) and (–)
(see Table I), into the full-length 2472-bp promoter construct.
Results from the transfection of this mutated construct into
bone and nonbone cell lines are shown in Fig. 7B. The relative
normalized activities of the wild type 2472-bp construct in
these lines were the same as those shown in Fig. 2. However, in
Fig. 7B, we have set the activity of the full-length construct at
100% in each cell line and expressed the activities of the site
mutant and deleted constructs as a percentage of that in order
to clearly illustrate the drop caused by the 2-bp change. Al-
though the mutation had no effect on the activity of the pro-
moter in nonosteoblastic cells, it abolished 60% of the promoter
activity in the osteoblastic clone 4 and UMR cells, causing a
drop nearly equivalent to the deletion of the entire sequence
between –2472 and –178. Thus, the disruption of the homeodo-
main binding site resulted in the ablation of almost all of the
osteoblast selective activity of the 2472-bp Bsp promoter.
Dlx5 Regulation of the C Element Homeodomain Site—We
further characterized the activity of this element by examining
13914 Osteoblast Specificity of the Mouse Bsp Promoter
FIG. 6. Interaction of the C element with osteoblast nuclear
proteins requires an intact homeodomain binding motif. A series
of six double-stranded mutant C oligonucleotides was synthesized to
span the entire homeodomain binding motif. Each oligonucleotide con-
tains a 2-bp mutation (as denoted by the brackets) in, or adjacent to, the
homeodomain consensus binding sequence. Although the corresponding
mutations were made in the (–) strand, only the (⫹) strand is shown.
The sequences of all mutants are identical to that of the wild type C
oligonucleotide shown in Table I except for these 2-bp changes. Gel
mobility shift assays were conducted with either UMR or clone 4 nu-
clear extract as described under “Experimental Procedures.” Lane 1
contains no extract. Lane 2 contains extract but no cold competitor. The
remaining lanes contain binding reactions (with extract) incubated
with a 50- or 100-fold molar excess (increasing amounts indicated by the
triangles) of unlabeled wild type (w.t.) C oligo or the mutant C oligo
indicated. The six shifted species observed are numbered 1– 6 in order
from lowest to highest mobility.
its ability to be directly regulated by the Dlx5 homeoprotein, a
member of the Dlx family of Drosophila distalless homologues.
We chose this factor as the most likely known candidate for the
C element-binding protein because it has been shown to be
expressed on bone and to be able to regulate the osteoblast-
specific osteocalcin promoter (23, 35). Additionally, homozy-
gous knockout of the Dlx5 gene produces mice with severe
skeletal deformities, implying a crucial role in skeletogenesis
(36). As represented in Fig. 8A, Dlx5 mRNA is expressed only
in those cell lines that also produce BSP, thus qualifying it as
a possible regulator of Bsp transcription. Furthermore, overex-
pression of Dlx5 in COS7 cells (a highly transfectable, Dlx5-
and BSP-null background) stimulated the activity of the C
element-driven minimal Bsp promoter construct 6-fold over
cells transfected with a ␤-galactosidase control vector, but only
if the homeodomain site was left intact (Fig. 8B, compare C w.t.
and Cmut3 constructs).
Finally, gel shift assays performed with nuclear extract pre-
pared from COS cells overexpressing Dlx5 demonstrated the
sequence-specific binding of Dlx5 to the C element. These ex-
periments produced two major shifted species (Fig. 8C, lane 6),
the upper one of which (asterisk) was competed by the addition
of a 50-, 100-, or 200-fold excess of unlabeled wild type C
oligonucleotide (lanes 7–9) but not by the addition of Cmut3
oligonucleotide (lanes 10 –12). Thus, this complex is dependent
on the intact homeodomain site for binding. The lower species
was competed by both wild type and mutant C oligos and was
also found in control nuclear extracts made from COS7 cells
transfected with a ␤-galactosidase expression vector (Fig. 8C,
lanes 2– 4). Therefore, it does not represent homeodomain site-
specific binding. To confirm that the specifically shifted species
observed was the result of Dlx5 binding, we repeated the gel
shift assay with a monoclonal antibody (M2) recognizing a
FLAG epitope tag built into the overexpressed Dlx5. This an-
tibody blocked the appearance of the specific species while
having no effect on the lower, nonspecific band (Fig. 8C, lane
13). Furthermore, this blocking action was counteracted by the
addition of FLAG peptide to compete for antibody binding,
indicating that the protein complex observed contains Dlx5
(Fig. 8C, lane 14). Addition of M2 antibody had no effect in
binding reactions with ␤-gal control extract (Fig. 8C, lane 5).
Together, these experiments show that the Dlx5 gene is ex-
pressed in our osteoblastic cell lines, and that the Dlx5 homeo-
protein is able to bind the Bsp C element and stimulate its
transcriptional activity.
DISCUSSION
Of the known bone extracellular matrix constituents, bone
sialoprotein is, perhaps, the most intimately associated with
the primary function of the differentiated osteoblast, namely
the mineralization of a collagenous matrix, yet little is known
about the cis-acting elements that restrict its expression to the
mineralizing osteoblast. We previously reported the isolation of
a 2472-bp fragment of the murine Bsp promoter that is able to
direct osteoblastic-selective expression of a luciferase cDNA
under growth conditions which are known to support osteoblast
differentiation in cell culture (6). Here we describe the results
of a systematic study to identify sequences within this frag-
ment that may direct this tissue-specific expression.
We found that the –2472/⫹41 base pair Bsp promoter, in
addition to its preferential expression in osteoblastic versus
nonosteoblastic cell lines, was induced by collagen matrix pro-
duction in parallel with the endogenous BSP message. This
up-regulation in response to matrix interaction is indicative of
genes whose expression is associated with osteoblast differen-
tiation and provides further evidence that the 2472-bp pro-
moter contains the requisite information to appropriately reg-
ulate Bsp transcription during the differentiation process (37).
Deletion of sequence from –2472 to –705 caused a marked drop
in promoter activity in clone 4 cells, but not in UMR 106-01
cells, which constitutively produce BSP. One possible explana-
tion for this observation is that this region contains sequences
that are necessary for the normal matrix-stimulated induction
of BSP but that are inactive in osteosarcoma cells which are
free from the matrix requirement. It will be interesting to
identify the cis-acting elements in this region of the Bsp pro-
moter that are responsible for the differences in reporter ex-
pression between these two osteoblastic cell lines. Character-
ization of such elements may yield additional information on
the matrix-induced signaling pathways that are active in
osteoblasts.
This present study, however, focuses on the isolation of se-
quences that are important for promoter activity in osteoblastic
versus nonbone cells, as these are likely to be the elements that
confer bone specificity. We identified one such element, a con-
sensus homeodomain binding site, between –199 and –192
(TCAATTAA). Disruption of this sequence caused a 60% drop
in transcriptional activity only in the osteoblastic cells and
accounted for almost all of the difference in activity between
the bone and nonbone cell lines used in this study. To our
knowledge, this is the first description of an osteoblast-specific
 Osteoblast Specificity of the Mouse Bsp Promoter 13915

FIG. 7. Comparison of enhancer ac-

tivities of wild type and mutant C el-
ement sequences. A, a trimer of the
Cmut3 double-stranded oligonucleotide
was inserted into the p49BSP vector in
the forward orientation (row 2), and its
transcriptional activity in clone 4 and
UMR cells was compared with that of the
construct containing the wild type C ele-
ment (row 3). Values shown are fold in-
duction of each construct over that of the
insertless p49BSP vector (row 1). B, the
2-bp mutation corresponding to that in
the Cmut3 oligonucleotide was intro-
duced into p2472 by site-directed mu-
tagenesis using primers Cmut3SD(⫹) and
(–) (see Table I). The resulting p2472mut3
construct was transfected into clone 4,
UMR, C2C12, 3T3-L1, and F9 cells, and
its transcriptional activity was compared
with that of the wild type p2472, as well
as the p178 (which lacks A, B, and C
elements) and p49 (minimal promoter)
deletion constructs. Normalized lucifer-
ase activities are shown as a percentage
of the wild type p2472 (p2472 w.t.) con-
struct activity, with the p2472 w.t. activ-
ity set at 100% in each cell line in order to
emphasize the percentage of drop attrib-
uted to the mutation in each cell type.
Normalized luciferase activities of the
wild type promoter in osteoblastic and
nonosteoblastic cell lines were similar to
results shown in Fig. 2.

transcriptional element within the bone sialoprotein gene
promoter.
There is a large body of genetic evidence implicating home-
odomain proteins in the development of mineralized tissues,
particularly with respect to members of the Dlx and Msx fam-
ilies, which are known to be expressed in tissues that give rise
to skeletal structures, and mutations in which result in the
display of severe skeletal phenotypes. For example, mice con-
taining mutations in Msx1 show craniofacial abnormalities
that include cleft palate and absence of specific teeth (38), while
mice expressing a mutated Msx2 transgene exhibit the symp-
toms of craniosynostosis, a disease characterized by premature
closure of the cranial sutures (39). Furthermore, both Dlx1 and
Dlx2 knockout mice display abnormal formation of the skull
bones derived from the first and second branchial arches (40,
41), while mice deficient in both factors show additional defects
in dentition (42). In addition, in a recent study by Acampora et
al. (36), Dlx5 –/– mice were shown to have the most severe
phenotype of all the known Dlx knockouts, displaying not only
cranial and mandibular malformations, but defects in long
bone development as well.
At the molecular level, Towler and colleagues (43) reported
that Msx2 is able to bind in vitro to a homeodomain binding site
between – 84 and –92 in the rat osteocalcin promoter (ACTA-
ATTGG) and that forced overexpression of Msx2 inhibited ex-
pression in MC3T3-E1 cells of a 199-base pair promoter frag-
ment containing this site. More recently, Newberry et al. (23)
reported that overexpression of Dlx5 was able to reverse this
inhibition through heterodimerization with Msx2, further sup-
porting the theory that these two families of homeoproteins are
capable of influencing the transcription of an osteoblast-spe-
cific gene. Our finding that Dlx5 can bind the Bsp C element
and stimulate its activity is not only consistent with this the-
ory, but extends it in that it represents the first example of
direct activation of an osteoblastic-specific cis-acting element
by a Dlx factor.
Two other studies which also describe positive regulation
through an osteoblast-selective homeodomain binding element
in vivo were performed by two independent groups on the
murine and rat ␣1(I) collagen gene promoters. Taken together,
these studies found that a homeodomain binding site (TTA-
ATTA), which is conserved in the human, rat, and murine
promoters, was required for osteoblastic-selective activity in
transgenic mice and that this site bound in vitro to a complex
found only in osteoblastic cells. Furthermore, both in vitro
binding and transcriptional activity were lost if the homeodo-
main consensus sequence was mutated (44, 45).
Our discovery of an osteoblastic-specific homeodomain bind-
ing site in the Bsp promoter that is similar to the one shown to
direct expression of ␣1(I) collagen may provide new insight into
13916 Osteoblast Specificity of the Mouse Bsp Promoter

FIG. 8. Transcriptional activation

and in vitro binding of the C element
by Dlx5. A, correlation of Dlx5 and BSP
expression. RNA was isolated from
MC3T3-E1 clone 4, UMR 106-01, C2C12,
F9, and COS7 cells grown for 6 days un-
der differentiating conditions as described
under “Experimental Procedures” (except
COS cells, which were grown for 48 h) and
assayed for Dlx5 and BSP expression by
Northern analysis. Hybridization with a
probe for 18 S rRNA was performed to con-
firm equal loading of all lanes. B, the vec-
tors shown in Fig. 7A, containing either the
C wild type (C wt) or Cmut3 sequences
upstream of the 49 Bsp minimal promoter,
were each transfected into COS7 cells with
either the pcDNA3Dlx5 or pCMV5-␤-gal
expression vector and assayed for lucifer-
ase reporter activity after 48 h. Values
shown are fold stimulation of Renilla nor-
malized firefly luciferase activities of
Dlx5 transfected samples over those of
␤-galactosidase-transfected samples for
each construct. C, binding of Dlx5 to the C
element. 5 ␮g per binding reaction of nu-
clear extract from COS7 cells transfected
with either pCMV5-␤-gal expression plas-
mid (lanes 2–5) or pcDNA3-Dlx5 plasmid
(lanes 6 –16) was subjected to gel mobility
shift analysis with the wild type C oligo-
nucleotide. Lane 1 contains no extract.
50-, 100-, and 200-fold molar excesses of
wild type C oligo (lanes 7–9) or Cmut3
oligo (lanes 10 –12) were used as unla-
beled competitors. A 200-fold excess of ei-
ther wild type or mutant C oligo was used
in lanes 3 and 4, respectively. The species
that represents homeodomain site-spe-
cific binding to the probe in lanes 6 –16 is
marked with an asterisk. A faster migrat-
ing band that is not homeodomain site-
specific appears in both ␤-gal and Dlx5
reactions and is competed by both wild
type and mutant sequences. M2 mono-
clonal anti-FLAG epitope antibody (lane
13), but not control IgG (lane 15), added to
the binding reaction blocked formation of
the specific species. Addition of an ap-
proximately 100-fold molar excess of
FLAG peptide reversed this blockage
(lanes 14 and 16). Antibody addition to a
␤-gal control extract binding reaction
(lane 5) had no effect.

the mechanism of osteoblast gene expression. If it is true, as is
widely held, that BSP plays a crucial role in the nucleation of
mineral formation in the collagenous matrix of bone, then it is
plausible to speculate that the col1␣(I) and Bsp promoters are
coordinately regulated by a shared set of osteoblast-specific
transcription factors. Given the new data reported here, it is
possible that one such factor may be a homeodomain protein
complex that binds to both collagen and Bsp promoters, ena-
bling their transcription in osteoblasts, and thus coordinating
both the deposition and mineralization of the collagenous ma-
 Osteoblast Specificity of the Mouse Bsp Promoter
trix. Such a complex, in conjunction with other factors such as
Cbfa1, might function as a central determinant of osteoblast
differentiation. Our data, combined with the recent description
of the Dlx5 knockout mice mentioned above, strongly support a
role for Dlx5 as one such determinant. However, in considering
this scenario, it is important to recognize that the results we
present here, as well as the aforementioned osteocalcin pro-
moter studies, merely demonstrate that Dlx5, or a related
homeoprotein, may regulate osteoblast-specific transcription in
vivo; they do not positively identify Dlx5, or any other known
factor, as such a regulator. Furthermore, the apparently im-
precise DNA binding specificities of homeoproteins in vitro
prohibits their identification merely by examination of the se-
quences to which they bind in individual promoters. Our ongo-
ing studies are aimed at identifying the factor that binds the
newly characterized osteoblast-specific element in the Bsp pro-
moter and at elucidating its role in the expression of the osteo-
blast phenotype.
REFERENCES
1. Fujisawa, R., Nodasaka, Y., and Kuboki, Y. (1995) Calcif. Tissue Int. 56,
140 –144
2. Goldberg, H. A., Warner, K. J., Stillman, M. J., and Hunter, G. K. (1996)
Connect Tissue Res. 35, 385–392
3. Chen, J., Shapiro, H. S., and Sodek, J. (1992) J. Bone Miner. Res. 7, 987–997
4. Ducy, P., and Karsenty, G. (1995) Mol. Cell. Biol. 15, 1858 –1869
5. Komori, T., Yagi, H., Nomura, S., Yamaguchi, A., Sasaki, K., Deguchi, K.,
Shimizu, Y., Bronson, R. T., Gao, Y. H., Inada, M., Sato, M., Okamoto, R.,
Kitamura, Y., Yoshiki, S., and Kishimoto, T. (1997) Cell 89, 755–764
6. Benson, M. D., Aubin, J. E., Xiao, G., Thomas, P. E., and Franceschi, R. T.
(1999) J. Bone Miner. Res. 14, 396 – 405
7. Ducy, P., Desbois, C., Boyce, B., Pinero, G., Story, B., Dunstan, C., Smith, E.,
Bonadio, J., Goldstein, S., Gundberg, C., Bradley, A., and Karsenty, G.
(1996) Nature 382, 448 – 452
8. Defranco, D. J., Lian, J. B., and Glowacki, J. (1992) Endocrinology 131,
114 –121
9. Kim, R. H., Li, J. J., Ogata, Y., Yamauchi, M., Freedman, L. P., and Sodek, J.
(1996) Biochem. J. 318, 219 –226
10. Ogata, Y., Niisato, N., Furuyama, S., Cheifetz, S., Kim, R. H., Sugiya, H., and
Sodek, J. (1997) J. Cell. Biochem. 65, 501–512
11. Ogata, Y., Yamauchi, M., Kim, R. H., Li, J. J., Freedman, L. P., and Sodek, J.
(1995) Eur J Biochem 230, 183–192
12. Yang, R., and Gerstenfeld, L. C. (1996) J. Biol. Chem. 271, 29839 –29846
13. Kerr, J. M., Hiscock, D. R., Grzesik, W., Robey, P. G., and Young, M. F. (1997)
Calcif. Tissue Int. 60, 276 –282
14. Sudo, H., Kodama, H.-A., Amagai, Y., Yamamoto, S., and Kasai, S. (1983)
J. Cell Biol. 96, 191–198
13917
15. Xiao, G., Cui, Y., Ducy, P., Karsenty, G., and Franceschi, R. T. (1997) Mol.
Endocrinol. 11, 1103–1113
16. Midura, R. J., McQuillan, D. J., Benham, K. J., Fisher, L. W., and Hascall,
V. C. (1990) J. Biol. Chem. 265, 5285–5291
17. Yaffe, D., and Saxel, O. (1977) Nature 270, 725–727
18. Majeska, R. J., Rodan, S. B., and Rodan, G. A. (1980) Endocrinology 107,
1494 –1503
19. Green, H., and Meuth, M. (1974) Cell 3, 127–133
20. Strickland, S., and Mahdavi, V. (1978) Cell 15, 393– 403
21. Gluzman, Y. (1981) Cell 23, 175–182
22. Franceschi, R. T., Iyer, B. S., Parikh, U. K., and Pineron, G. J. (1992) J. Bone
Miner. Res. 7, S218
23. Newberry, E. P., Latifi, T., and Towler, D. A. (1998) Biochemistry 37,
16360 –16368
24. Chomczynski, P., and Sacchi, N. (1987) Analytical Biochemistry 162, 156 –159
25. Thomas, P. S. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 5201–5205
26. Young, M. F., Ibaraki, K., Kerr, J. M., Lyu, M. S., and Kozak, C. A. (1994)
Mamm. Genome 5, 108 –111
27. Franceschi, R. T., Iyer, B. S., and Cui, Y. (1994) J. Bone Miner. Res. 9, 843– 854
28. Dignam, J. D., Martin, P. L., Shastry, S., and Roeder, R. G. (1983) Methods
Enzymol. 101, 582–598
29. Maxam, A. M., and Gilbert, W. (1977) Proc. Natl. Acad. Sci. U. S. A. 74,
560 –564
30. Chen, J., Thomas, H. F., Jin, H., Jiang, H., and Sodek, J. (1996) J. Bone Miner.
Res. 11, 654 – 664
31. Franceschi, R. T., and Iyer, B. S. (1992) J. Bone Miner. Res. 7, 235–246
32. Schinke, T., and Karsenty, G. (1999) J. Biol. Chem. 274, 30182–30189
33. Ohkuma, Y., Horikoshi, M., Roeder, R. G., and Desplan, C. (1990) Proc. Natl.
Acad. Sci. U. S. A. 87, 2289 –2293
34. Catron, K. M., Iler, N., and Abate, C. (1993) Mol. Cell. Biol. 13, 2354 –2365
35. Ryoo, H. M., Hoffmann, H. M., Beumer, T., Frenkel, B., Towler, D. A., Stein,
G. S., Stein, J. L., van Wijnen, A. J., and Lian, J. B. (1997) Mol. Endocrinol.
11, 1681–1694
36. Acampora, D., Merlo, G. R., Paleari, L., Zerega, B., Postiglione, M. P., Mantero,
S., Bober, E., Barbieri, O., Simeone, A., and Levi, G. (1999) Development
126, 3795–3809
37. Franceschi, R. T. (1999) Crit. Rev. Oral Biol. Med. 10, 40 –57
38. Satokata, I., and Maas, R. (1994) Nat. Genet. 6, 348 –356
39. Liu, Y. H., Kundu, R., Wu, L., Luo, W., Ignelzi, M. A., Jr., Snead, M. L., and
Maxson, R. E., Jr. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 6137– 6141
40. Qiu, M., Bulfone, A., Martinez, S., Meneses, J. J., Shimamura, K., Pedersen,
R. A., and Rubenstein, J. L. (1995) Genes Dev. 9, 2523–2538
41. Qiu, M., Bulfone, A., Ghattas, I., Meneses, J. J., Christensen, L., Sharpe, P. T.,
Presley, R., Pedersen, R. A., and Rubenstein, J. L. (1997) Dev. Biol. 185,
165–184
42. Thomas, B. L., Tucker, A. S., Qui, M., Ferguson, C. A., Hardcastle, Z.,
Rubenstein, J. L., and Sharpe, P. T. (1997) Development 124, 4811– 4818
43. Towler, D. A., Rutledge, S. J., and Rodan, G. A. (1994) Mol. Endocrinol 8,
1484 –1493
44. Bedalov, A., Salvatori, R., Dodig, M., Kronenberg, M. S., Kapural, B.,
Bogdanovic, Z., Kream, B. E., Woody, C. O., Clark, S. H., Mack, K., Rowe,
D. W., and Lichtler, A. C. (1995) J. Bone Miner. Res. 10, 1443–1451
45. Rossert, J. A., Chen, S. S., Eberspaecher, H., Smith, C. N., and de Crombrugghe,
B. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 1027–1031