Biology problem paper specimen

Please note that this is a specimen paper and you have been given eight specimen questions to work through. This version contains the questions with specimen answers. One the actual paper there will be four questions, one each for Ecology, Genetics, Cell and Organismal Biology and Molecular biology and biochemistry. The examination paper will be 3 hours in duration and you will be expected to answer two questions from the four offered. Each question will have a short summary at the beginning of the paper.

ECOLOGY 1
This problem concerns root growth in grasses. How it can be measured, how it differs between species and how it is affected by the presence and patchiness of nutrients and organisms in the soil.

ECOLOGY 2
This question requires you to analyse data from field surveys of butterflies in grassland and woodland sites. You examine whether different types of butterfly species differ in their abundance between habitats. You are asked to critically evaluate the methods used by the student in their surveys, and to suggest new field work.

GENETICS 1
This question is about genetic mapping in bacteria (which has been incredibly important in the development of molecular biology) using conjugation, in which the circular chromosome of the donor cell is broken at a fixed point and transferred as a linear piece of DNA to a recipient.

GENETICS 2
This problem asks if the difference between alleles of a mutant locus is significant and if so, what might be the molecular explanation. Mutational changes in the DNA sequences another mutant locus are shown and molecular explanations for their effect are required.

CELL AND ORGANISMAL BIOLOGY 1

Investigating the characteristics of the eWnt secreted signaling molecule. Analysis and manipulation of DNA plasmid constructs coding for eWnt protein. Analyzing the properties the eWnt protein and the eWnt gene promoter in vitro and in vivo.

CELL AND ORGANISMAL BIOLOGY 2

This question concerns the use of oxygen by diving mammals. The first part of the question is to investigate the relation between metabolic rate and size, and how this may be influenced by their diving habits. The second part of the question concerns the use of oxygen by human divers.

Biology problem paper specimen

MOLECULAR BIOLOGY AND BIOCHEMISTRY 1

Loss of function mutations were generated on plasmids and investigated using yeast cultures. Measurements were made so that the effect of the mutations could be determined and hypotheses devised to explain the observations.

MOLECULAR BIOLOGY AND BIOCHEMISTRY 2

Overexpression of protein at different temperatures: this problem concerns the synthesis of a specific protein in a bacterial expression system. It deals with analysis of bacterial growth, and characterisation of the product by gel chromatography.

Biology problem paper specimen

ECOLOGY 1
This problem concerns root growth in grasses. How it can be measured, how it differs between species and how it is affected by the presence and patchiness of nutrients and organisms in the soil. STUDY 1 An ecology student interested in how five different grass species produced roots in an organic nutrient patch (milled Lolium perenne shoot material) added to soil grew plants from seed in microcosm units (dimensions 150 mm x 400 mm x 3 mm see Figure). The organic material was added as a 20 mm band across the microcosm 200 mm below the soil surface. The remainder of the microcosm was filled with soil. Seeds were planted 5 mm below the soil surface (see Figure).

Microcosms were placed in a growth cabinet under constant conditions of light, humidity and water. After 42 days the student harvested the plants. Roots from the organic patch were separated from the rest and their root length measured after which these roots were dried at 70oC to obtain their dry weight (D.W.). Root length and dry weights of the remaining roots were then recorded. These values were added to those from the organic patch band to obtain the length and dry weight of the entire root system (Table 1). Table 1. Root length (m) and root D.W. (mg) for the five grass species in the organic patch band and for the total root system. Plant Species Root length in organic patch band (m) 3.569 2.528 1.707 3.451 3.125 Total root length (m) 12.0 15.3 12.1 12.7 15.0 Root D.W. in organic patch band (mg) 22.0 15.3 8.1 12.2 13.0 Total root D.W. (mg) 2030 1870 1030 1670 1720

Lolium perenne Festuca arundinacea Poa pratensis Dactylis glomerata Phleum pratense

Biology problem paper specimen

The student wished to calculate the root length density (RLD) which is the length of roots per unit volume of soil (cm cm-3) and specific root length (SRL) which is the root length per unit root dry weight (cm mg-1). For each of the five plant species calculate: a) The root length density (RLD; cm cm-3) in the organic patch band. (3 marks) b) The specific root length (SRL; cm mg-1) in the organic patch band. (4 marks) Please show all your calculations. Answers: 1. i) RLD in patch zone Volume Organic Patch occupies = 0.3 x 2 x 15 = 9 cm3 Thus RLD = RL in Table 1 /100 to get cm then / 9 cm3 for RLD in patch L. perenne = 356.9/9 = 39.7 cm cm-3 F. arundinacea = 252.8/9 = 28.1 cm cm-3 P. pratensis = 170.7/9 = 19.0 cm cm-3 D. glomerata = 345.1/9 = 38.3 cm cm-3 P. pratense = 312.5/9 = 34.7 cm cm-3 (3 marks) 1. ii) SRL (Nb: Convert RL to cm) L. perenne = 356.9/22.0 = 16.2 cm mg-1 F. arundinacea = 252.8/15.3 = 16.5 cm mg-1 P. pratensis = 170.7/8.1 = 21.1 cm mg-1 D. glomerata = 345.1/12.2 = 28.3 cm mg-1 P. pratense = 312.5/13.0 = 24.0 cm mg-1

(4 marks)

STUDY 2 Using the same microcosm units the student then investigated how Lolium perenne plants captured nitrogen (N) from a range of organic substrates of varying carbon:nitrogen (C:N) ratio (Note: only one organic substrate was added to each microcosm). After 55 days the L. perenne plants were removed from the microcosm and the total shoot dry weight (D.W.) root dry D.W., and the percentage nitrogen (N) of the dried shoot and root material recorded (Table 2). Table 2. Total shoot D.W., root D.W. and N content (expressed as a %) of the shoots and roots of the Lolium perenne plants grown in the presence of each of the organic substrates added as discrete patches to the Lolium perennes root system. Organic Substrate Added Shoot material Root material Urea Amino acid mixture Algal cell material C:N Ratio of substrate 21:1 52:1 0.4:1 3.2:1 3.1:1 Total Shoot D.W. (g) 1.4864 1.0614 3.8441 3.2354 3.7447 N in Shoots (%) 1.32 1.09 1.48 1.25 1.09 Total Root D.W. (g) 0.7758 0.6022 1.3321 1.2543 1.1979 N in Roots (%) 1.01 0.85 0.89 0.87 0.84

Biology problem paper specimen

From the data in Table 2 c) Calculate the total plant N content (as mg N) for the Lolium perenne plants grown in the presence of each of the organic substrates. Please show all your calculations and tabulate your answers. (7 marks) d) Calculate the root weight ratio (RWR: root weight per unit total plant weight) for the plants grown with each of the organic substrates. (4 marks) Answer: (7 marks) Organic Substrate Added Shoot material Root material Urea Amino acid mixture Algal cell material

Total Shoot N content (mg N) (1.4864 x [1.32/100]) x 1000 = 19.62 (1.0614 x [1.09/100]) x 1000 = 11.57 (3.8441 x [1.48/100]) x 1000 = 56.89 (3.2354 x [1.25/100]) x 1000 = 40.44 (3.7447 x [1.09/100]) x 1000 = 40.82

Total Root N content (mg N) (0.7758 x [1.01/100]) x 1000 = 7.84 (0.6022 x [0.85/100]) x 1000 = 5.12 (1.3321 x [0.89/100]) x 1000 = 11.86 (1.2543 x [0.87/100]) x 1000 = 10.91 (1.1979 x [0.84/100]) x 1000 = 10.06

Total Plant N content (mg N) 19.62 + 7.84 = 27.46 11.57 + 5.12 = 16.69 56.89 + 11.86 = 68.75 40.44 + 10.91 = 51.35 40.82 + 10.06 = 50.88

2ii) Root weight ratio (RWR): (4 marks) RWR = root DW/ Total Plant DW (NB: No units) Shoot material = RWR = 0.7758/2.2622 = 0.34 Root material = RWR = 0.6022/1.6636 = 0.36 Urea = RWR = 1.3321/5.1762 = 0.26 Amino acid mixture = RWR = 1.2543/4.4897 = 0.28 Algal cell material = RWR = 1.1979/4.9426 = 0.24 As the organic substrates were labelled with the stable isotope of nitrogen (15N) it was possible to follow the fate of the N originally added in the organic substrates in the different plant-soil-microbe pools (see Table 3). Table 3.Percentage (%) of organic substrate N detected in plants, microbes and soil at the end of the 55 days experimental period.
Organic Substrate added C:N Ratio of substrate N from the organic substrate in the L. perenne plants (%) Total substrate N lost from the system (%) N from the organic substrate in the microbial biomass (%) Residual substrate N remaining in soil (%)

Shoot material Root material Urea Amino acid mixture Algal cell material

21:1 52:1 0.4:1 3.2:1 3.1:1

11 8 55 54 36

12 8 40 37 44

15 16 5 9 10

62 68 0 0 10

Biology problem paper specimen

e) The amount of N that the Lolium perenne plants captured from the organic patches varied widely. Using the information in Table 3 describe in words what factors controlled the amount of N that the plants captured from these organic substrates. (2 marks) Answer: (2 marks) Main points are the C:N ratio of the substrate and the physical & chemical complexity of the substrates. The higher C:N ratio patches take longer to decompose as: less N per unit C thus the micro-organisms require additional N for decomposition. residual substrate values higher showing these patches still being decomposed. micro-organisms control decomposition hence have turned over and released N for the plants in the simple patches but N values lower in complex patches as bugs still decomposing them. Physical/chemical complexity: C:N ratio of the amino acid mixture and algal cell wall material is similar yet plants captured more N from the amino acid substrate as it is both physically and chemically less complex than that of algal cell material thus would decompose and release N more rapidly. STUDY 3 In a field study close inspection of experimental plots suggested that the presence of litter was associated with the presence of faecal pellets produced from microarthropods (small soil animals). To test this hypothesis, a grid of 10 x 50 contiguous area samples, each 25 cm2 was marked out. The presence or absence of litter and faecal pellets was recorded for each sample. Of the 500 samples examined, litter was present in 325, faecal pellets in 144 and both litter and faecal pellets were present in 112. f) (13 marks) Show by conducting a statistical analysis how you would test the hypothesis that there is an association between litter and faecal pellets. Please show all your calculations including significance level, degrees of freedom and state the nature of the association if there is one. 2 2 x 2 table (7 marks) Litter Present Faecal Pellets Present Observed Expected Faecal Pellets Absent Observed Expected Calculation of 2 112 93.60 (325 x 144)/500 213 231.40 (325 x 356)/500 325 Litter Absent 32 50.40 (175 x 144)/500 143 124.60 (175 x 356)/500 175 144

356 500

Biology problem paper specimen

2 = (O E)2 / E 2 = (112-93.60)2/93.60 + (32-50.40)2/50.40 + (213-231.40)2/231.40 + (143124.60)2/124.60 = 3.62 + 6.72 + 1.46 + 2.72 (4 marks)

= 14.52 with one degree of freedom giving P < 0.001 which indicates a highly significant association between litter presence and faecal pellets, with the association being positive [as (ad) exceeds (bc)]. (2 marks).

Biology problem paper specimen

ECOLOGY 2
This question requires you to analyse data from field surveys of butterflies in grassland and woodland sites. You examine whether different types of butterfly species differ in their abundance between habitats. You are asked to critically evaluate the methods used by the student in their surveys, and to suggest new field work. An ecology PhD student is investigating changes in the abundance of butterflies in Britain. In the first year of the PhD studies, the student collates existing data on butterfly abundance from four sites in Yorkshire. These data were collected by other researchers using standardised methods. The survey method involves an observer walking along a transect at a steady pace counting all butterflies seen. Surveys are carried out only in sunny weather when the temperature is above 17oC. Transects vary in length but are always 5m wide (i.e. butterflies are recorded 2.5m either side of the observer). Transects were in two different habitats; sites 1 and 2 were in woodland, and sites 3 and 4 in grassland. Table 1 shows data collected from the two woodland sites in 2005. Table 1. The total numbers of butterflies seen along two transects in woodland sites in Yorkshire in 2005. The two transects were surveyed by a different person but on the same day (20th July). The length of each transect is shown. The eight species that develop through several generations per year are marked with an asterisk (all other species develop through a single generation per year). Species Species A* Species B* Species C Species D* Species E* Species F* Species G* Species H* Species I* Species J Species K Species L Species M Species N Site 1 5.6 km 7 3 12 49 47 39 2 1 3 1 14 2 46 6 Site 2 4.3 km 8 16 6 17 62 53 5 0 6 0 9 2 19 4

1) The student is interested in investigating differences in butterfly abundance among sites. A) They decide to calculate the density per hectare (ha) of each species of butterfly at each site. Table 2 below gives these density values for each species at the two grassland sites, as well as the mean density for this habitat. In a similar way, calculate

Biology problem paper specimen

density per hectare (ha) of each species for the two woodland sites and mean density for the woodland habitat. You should tabulate your answers. (4 marks) What might the student conclude about the relative distributions and abundances of the butterfly species in the two habitats? (5 marks) Table 2. The density per hectare (ha) of each species of butterfly at two grassland sites, and the mean butterfly density in the grassland habitat. Species Site 3 density 22.44 27.32 .49 2.93 3.41 22.44 13.17 27.32 19.02 .98 .49 .00 1.46 10.24 Site 4 density 20.00 25.95 .00 1.08 4.86 32.97 24.86 28.11 34.59 1.62 1.08 .00 3.24 17.30 Mean density in grassland 21.22 26.64 .25 2.01 4.14 27.71 19.02 27.72 26.81 1.30 .79 .00 2.35 13.77

Species A Species B Species C Species D Species E Species F Species G Species H Species I Species J Species K Species L Species M Species N

Transect 1 =2.80 ha Transect 2 =2.15 ha

speciesA speciesB speciesC speciesD speciesE speciesF speciesG speciesH speciesI speciesJ speciesK speciesL speciesM speciesN

Site1 density 2.50 1.07 4.29 17.50 16.79 13.93 .71 .36 1.07 .36 5.00 .71 16.43 2.14

Site2 density 3.72 7.44 2.79 7.91 28.84 24.65 2.33 .00 2.79 .00 4.19 .93 8.84 1.86

Woodland mean 3.11 4.26 3.54 12.70 22.81 19.29 1.52 .18 1.93 .18 4.59 .82 12.63 2.00

Biology problem paper specimen

A good answer would show that the data in Table 2 and the table of woodland means had been correctly interpreted. For example, there are apparently higher abundances of species in the grassland habitat compared with woodland. Species I has the highest density at any site (site 4). Species H has the highest density in grassland but the lowest density in woodland in other words, abundances do not seem to be positively associated between habitats. Some species show much higher abundances in one habitat than the other i.e. there is a suggestion of habitat specialisation 2) The student then decides to investigate differences in the ecologies of the species. The student was aware that the species differ in the number of generations they develop through each year. In Table 1 above, species that develop through several generations per year (multivoltine species) are marked with an asterisk, all other species develop through a single generation per year (univoltine). The student calculated the mean density of each species across all sites and then carried out a statistical test to determine whether multivoltine species have higher mean densities than univoltine species. The SPSS output from this test is shown below.
Group Statistics Std. Error Mean 1.36130 1.65777

TOT

GENS univoltine multivoltine

N 6 8

Mean 3.5181 13.8151

Std. Deviation 3.33450 4.68888

Independent Samples Test Levene's Test for Equality of Variances

t-test for Equality of Means 95% Confidence Interval of the Difference Lower Upper -15.21353 -14.97114 -5.38048 -5.62287

F TOT Equal variances assumed Equal variances not assumed .022

Sig. .886

t -4.563 -4.800

df 12 11.990

Sig. (2-tailed) .001 .000

Mean Difference -10.2970 -10.2970

Std. Error Difference 2.25652 2.14508

What statistical test did the student carry out? Explain what did they found. (4 marks) Output shows that the student did a t-test comparing 6 univoltine species and 8 multivoltine species. There was a significant difference between these two groups (t = -4.56, 12 df, P = 0.001). Multivoltine species have significantly higher abundances. Do you think the student did the appropriate statistical test? Explain your answer. (3 marks) This is a parametric test and so the student should have tested for normality of data beforehand. Levenes test shows no significant difference in variances and so gives some support for a t-test. If the data were not normal, an alternative test for nonparametric data would be a Mann-Whitney test. 3) The student was concerned that all these analyses were based on data from a single transect at each site in July.

Biology problem paper specimen

A) How might this affect the findings? (5 marks) Grassland species apparently have higher density but this might be because the survey date was closer to their average peak flight period. Grassland species may comprise a greater proportion of summer-flying species. There may be more nectar flowers in grassland during July. Multivoltine species are apparently more likely to be grassland specialists this makes it difficult to separate the effects of these two aspects of the species ecology on density. Multivoltine species may achieve even higher densities than quoted if they develop through more generations later in the summer. This might show if the transects were to be repeated later in the year. Single transect location lacks spatial & temporal replication B) Describe a series of observations or a field experiment that you could carry out to test these ideas (5 marks) Carry out transects in both habitats throughout the spring to autumn flight periods. Determine timing of peak flight period for each species at the sites. Measure changes in flower abundance in the two sites over time. To get full marks you need to give details on sample sizes, types of data to be collected and how they would be analysed to test specific hypotheses. 4) The PhD student was particularly interested in changes in the abundance of one butterfly species and collected data from surveys at Site 1 over the past 15 years. The number of butterflies recorded on the transect each year is shown in Table 3. The number of larval host-plants at the site was recorded as the mean percentage cover of plants in 20 1m x 1m quadrats. Data for temperature and rainfall were obtained from a meteorological station nearby. Table 3. The Table shows changes at Site 1 in the total number of butterflies recorded on the transect and the abundance of their larval host-plants over time. year 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 Total number of butterflies recorded 0 0 1 0 0 1 3 5 7 11 18 27 42 45 55 49 %cover of larval hostplants 60.1 9.2 44.1 30.1 28.2 62.1 5.2 2.8 25.4 10.1 50.3 43.7 9.2 17.2 22.1 25.7

Biology problem paper specimen

The student decides to analyse their data by using stepwise multiple regression analysis to investigate whether host-plant abundance was affected by summer rainfall or temperature in either the current year of study, or in the previous year. The SPSS output from this analysis is shown below. Data for host-plant abundance were arcsinetransformed prior to analysis.
Model Summary Adjusted R Square .865 Std. Error of the Estimate .07839

Model 1

R R Square .935a .875

a. Predictors: (Constant), RAINFALL PREVIOUS

Coefficientsa Unstandardized Coefficients B Std. Error -8.05E-02 .044 3.712E-02 .004 Standardized Coefficients Beta .935

Model 1

(Constant) RAINFALL previous

t -1.837 9.543

Sig. .089 .000

a. Dependent Variable: ARCSIN PLANT COVER

b Excluded Variables

Model 1

Beta In RAINFALL current TEMP current TEMP previous -.102 -.068 .068
a

t -1.039 -.671 .673

Sig. .319 .515 .514

Partial Correlation -.287 -.190 .191

Collinearity Statistics Tolerance .985 .976 .985

a. Predictors in the Model: (Constant), RAINFALL PREVIOUS YEAR b. Dependent Variable: ARCSIN PLANT COVER

A) Are any of the factors significant in the analysis? If so, list the significant factors(s). (1 mark) Yes, rainfall previous year B) What is the value of the slope of the significant relationship? (1 mark) Slope = 0.0371 C) Why were data for plant cover arcsine transformed prior to analysis? (1 mark)

Biology problem paper specimen

Plant cover was scored as a percentage (i.e. a proportion). The variance of a proportion is a function of the mean. This is undesirable in statistical analyses. Arcsine transformation removes (or, at least, reduces) this dependence. D) Explain the R square (R2) value. (1 mark) The model explains 88% of the variation in the data set. E) Discuss the findings of this statistical analysis, and whether this was the most appropriate way to analyse the data. (3 marks) Plant cover is affected only by rainfall in previous year, not rainfall in current year. No relationship with any temperature data. The lag response of a year indicates the host plant may be an annual. The relationship with rainfall indicates the site is dry such that plants are water-limited. Data from consecutive years are unlikely to be independent (as assumption of the regression analysis), and so stepwise regression may not be the best approach. A timeseries analysis might be better.

Biology problem paper specimen

GENETICS 1
This question is about genetic mapping in bacteria (which has been incredibly important in the development of molecular biology) using conjugation, in which the circular chromosome of the donor cell is broken at a fixed point and transferred as a linear piece of DNA to a recipient. A. Interrupted mating is a technique that is used for long distance mapping of genes on the E. coli chromosome. A donor strain transfers its chromosome linearly from a fixed point on the circular genome into a recipient strain that usually contains multiple mutations. Samples are removed from the mating culture at various time points after mixing the two strains and transfer of the DNA is halted. This is called interruption of mating. The bacteria in the interrupted sample are plated out on various selective media that will kill the donor strain and that lack a single requirement of the recipient strain, so that one can determine if, at the time of interruption, the recipients have inherited a particular gene. For example if the donor was arg+ leu+ pro+ thr+ streptomycin sensitive and the recipient arg- leu- pro- thr- streptomycin resistant, one would plate out the interrupted mating mix on four selective media. The selective plate for arg+ recombinants would contain leucine, proline, threonine and streptomycin but no arginine. Note that for the gene to be inherited, not only does it have to be transferred to the recipient but it has to be recombined into the recipients chromosome. In an undergraduate class practical on interrupted mating, the donor was arg+ leu+ pro+ thr+ and the recipient arg- leu- pro- thr- . When the organiser ran through the procedure before the practical, he obtained some bizarre results, that he interpreted correctly to mean that none of the selective plates contained leucine. However there was no time to make the plates again, so he decided to go ahead with the experiment anyway. The times of entry he had expected if the plates had been correct, were pro+ at 10 minutes after mixing, leu+ at 18 minutes, thr+ at 20 minutes and arg+ at 30 minutes. 1) What times of entry for each gene would the class observe? (3 marks) pro+ 18 leu+18 thr+20 arg+30 If two genes enter more than 5 minutes apart they behave as though they are unlinked i.e. the recombination frequency (RF) between them is 50%. The RF between leu+ and thr+ is 30%. 2) Write down the percentage of a) leu+, b) thr+, c) arg+ colonies observed by the class at late times (e.g 60 minutes), taking as 100%, the number they should have observed if the plates had been correct. (2 marks) a)Leu+ 100 b) thr+70 c) arg+ 50 B. A bacterial geneticist investigating the rotary motor that drives the flagellae of E.coli, isolates a spontaneous non motile mutant in the donor strain used in part A, and attempts to map it using conjugation. This time the recipient strain is pro(10min) leu- (18min) thr- (20min) arg- (30min) ilv- (34)min aro- (48min). For this mapping she cannot use interrupted mating to give time of entry of non-motility because there is no easy way to select for it. So instead she uses recombination

Biology problem paper specimen

frequencies. She allows the donor and recipient strains to conjugate for two hours and then plates 0.1ml of serial tenfold dilutions of the mixture out on the six different types of selective plate (which this time are correctly made up) and counts the colonies that appear on the plates. She then calculates the number/ml of each type of recombinant in the original mating mix. The numbers she obtains are: pro+ leu+ thr+ arg+ ilv+ aro+ 6.0*107/ml 3.0*107/ml 2.9*107/ml 1.2*107/ml 9.4*106/ml 3.2*106/ml

3) Given that when counting bacterial colonies on plates there should be at least 50 and no more than 500, what dilutions of the mating mix should she have spread for each of the different recombinant types. (3 marks) In order from the top 105, 104, 104, 104, 104, 103 4) If the logarithm of the numbers of recombinants obtained are plotted on the y axis versus time of entry on the x axis a straight line is obtained. Comment on the relationship between time of entry and numbers of recombinants obtained. (4 marks) On log graph paper it is a straight line indicating exponential decay or a constant probability per unit time (or unit distance of transfer) that transfer of the genes will cease. Called spontaneous interruption of mating She then mapped the mutation that confers non-motility by laboriously picking 100 of each type of recombinant, growing them up and checking for mobility with a microscope. She obtains the following data. Recombinants pro+ leu+ thr+ arg+ ilv+ aro+ Number non-motile (out of 100) 9 16 19 60 70 50

From these data she concludes that the mutation conferring non-motility is exactly halfway between ilv+ and arg+. 5) Explain why there are fewer arg+ recombinants that are non-motile than ilv+ recombinants that are non-motile if the mutation is exactly equidistant from each. (4 marks) Not all the arg+ recombinants will have received the non-motility mutation while all the ilv+ ones will have so that with the same recombination frequency there will be less arg+mot- than ilv+mot-.

Biology problem paper specimen

Now that she has mapped the defective gene she looks for candidate genes of unknown function in that place on the published genome of E.coli. She finds a cluster of five Open Reading Frames that have been designated as probable genes, all oriented in the same direction. 6) What is an Open Reading Frame and what property/properties would indicate that one is likely to be a gene? (3 marks) An ORF is a sequence without stop codons. In bacteria the length is the most important property. Should be 100 or more. Other criteria would be a start codon and Shine Dalgarno sequence Close examination of the sequence containing the five ORFs suggests that it contains only a single promoter at the appropriate end and therefore that the five genes make up a single transcription unit or operon. The geneticist scans the sequence for restriction sites, chooses an enzyme that will not cleave within the sequence but does so at appropriate distances beyond the ends, and uses it to clone the fragment into a plasmid. Having assured herself by partial sequencing that she has the appropriate fragment she inserts it into the original non-motile strain and finds that the bacteria are now motile. 7) What does she conclude? (2 marks) That the plasmid contains the wild type version of the defective gene(s) and the wildtype genes are dominant to the defective ones To find out which gene(s) the mutation is located in she separately clones each gene present in the fragment into a suitable expression vector (i.e. one that allows high expression of a cloned gene on addition of a suitable inducer) and puts each of the new constructs into the original non-motile strain. After addition of inducer she finds that none of the individual genes confers motility on the strain. 8) What can she conclude about a) the function of the genes in the operon and b) about the effect of the mutation? (6 marks) a) That the original large 5 gene fragment contains more than one gene required for motility b) that the mutation inactivates more than one gene. 9) The mutant and wild-type operons are sequenced and the mutation turns out to be a single base insertion in the coding part of the first gene. Explain how such a mutation might cause the phenotype of the mutant. (6 marks) The mutation is a polar mutation. It inactivates genes in the same operon downstream of the mutation. The frame shift causes the ribosomes to terminate at a previously out-of-frame termination codon. This would leave the RNA polymerase to synthesise a section of RNA that is not covered by ribosomes. This in turn could lead to termination of transcription (the usual reason for polarity) or there might be a translational coupling effect where ribosomes must translate the first gene copied into the mRNA to allow the second gene copy to be translated and so on. It is thought

Biology problem paper specimen

that the ribosome translating the early gene copy unravels secondary structure in the message thus exposing the next translational start signal for binding by the same or a new ribosome. Another explanation might be that the mRNA is destabilised by having no ribosomes protecting it over a section of the first gene (between the out of frame stop and the beginning of the second gene) and this causes very rapid degradation of the mRNA for the last four genes. This is less likely than the first two explanations but is a plausible idea.

Biology problem paper specimen

GENETICS 2
This problem asks if the difference between alleles of a mutant locus is significant and if so, what might be the molecular explanation. Mutational changes in the DNA sequences another mutant locus are shown and molecular explanations for their effect are required. Question 1A In Drosophila, the recessive mutation hirsute (hir) causes scutellar bristle length to increase by approximately 200% There are 2 bristles per individual fly measured. n = number of bristles measured n 20 20 20 20 avg. bristle length (m) 89.29 178.35 118.5 123.25 standard deviation 22 41 31.5 24.6

wild type hir1/hir2 hir1/+ hir2/+

hir1/+ and hir2/+ have been included as controls. However the hir1/+ and hir2/+ heterozygotes appear to have longer bristles than wild type (wt). Calculate the standard errors (1 mark) s.e. wt hir/hir hir1 hir2 4.92 9.17 7.04 5.50

Estimate if the differences are likely to be significant between wild type and the hir heterozygotes (1 marks) and explain your reasoning (1 mark) With df= 38 for each test, the t value must be greater than t=2.04 (P=0.05) for there to be a 95% chance of the means being significantly different. A 95% chance of significant difference between wt and hir1/+ (t=3.39) and wt and hir2/+ (t=4.6) What are two possible genetic explanations for this result? (4 marks) Dominance or haploinsufficiency After molecular analysis, hir1and hir2alleles are found to be null alleles. Which genetic explanation does this information favour? Explain your reasoning. (4 marks) Haploinsuffuciency. Nulls produce no transcript or protein so cannot produce dominance, so insufficient gene product produces a phenotype

Biology problem paper specimen

Question 2 The sideparting (spar) gene has been cloned and a cDNA isolated (below). The cDNA encodes a short protein, the start ATG codon is in lower case and the stop TGA codon is in lower case. TATAAGCATCCGATCCAACCCGAACCGATCatgGCAACCACTCCACGCAGCGGCGGT AA GTTCGAGATCTGGGACACGGCTGGCCAGGAGCGGTACCACAGCTTAGCTCCCATGTA TT ATCGAGGAtgaGAAAATGAAGGAAAACGAAAACCACAAAAAAAAAAAGAAAACCAA A fragment of the genomic region of the spar gene in the spar1 mutant was sequenced. The underlined G was mutated to an A. By comparing the cDNA with the genomic sequence suggest what the molecular genetic consequence of such a mutation would be? (10 marks) In frame stop codon generating a truncated transcript. Either producing a truncated protein or transcript is degraded by nonsense mediated decay process.
TATAAGCATCCGATCCAACCCGAACCGATCATGGCAACCACTCCACGCAGCGGCGGTAAGTT CGA GATCTGGGACACGGCTGGCCAGGAGCGGTAAGTATCGCTGGATAGATCACCCAACTGAAAGC TTC ATCTGACATACTTATATTCGCTTTTGTAGGTACCACAGCTTAGCTCCCATGTATTATCGAGG ATG AGAAAATGAAGGAAAACGAAAACCACAAAAAAAAAAAGAAAACCAA

In the spar2 mutant stock the genomic region of the spar gene was sequenced. Three nucleotides were found to be missing (underlined). By aligning the cDNA sequence with the genomic sequence, suggest what type of molecular genetic defect the three missing nucleotides would generate (12 marks).
TATAAGCATCCGATCCAACCCGAACCGATCATGGCAACCACTCCACGCAGCGGCGGTAAGTT CGA GATCTGGGACACGGCTGGCCAGGAGCGGTAAGTATCGCTGGATAGATCACCCAACTGAAAGC TTC ATCTGACATACTTATATTCGCTTTTGTAGGTACCACAGCTTAGCTCCCATGTATTATCGAGG ATG AGAAAATGAAGGAAAACGAAAACCACAAAAAAAAAAAGAAAACCAA

The three nucleotide deletion results in removal of bases that constitute a splice acceptor sequence, generating a nonsense sequence that would produce either a

Biology problem paper specimen

scrambled protein, an early truncation, or reduced transcript due to nonsense mediated decay.

Biology problem paper specimen

CELL AND ORGANISMAL BIOLOGY 1

Investigating the characteristics of the eWnt secreted signaling molecule. Analysis and manipulation of DNA plasmid constructs coding for eWnt protein. Analyzing the properties the eWnt protein and the eWnt gene promoter in vitro and in vivo. Wnt proteins are secreted glycoprotein ligands. Binding of Wnt ligands to their cell surface receptors activates an intracellular signaling pathway which plays a critical role in regulating gene expression in the developing embryo. The downstream transcriptional effectors of the Wnt pathway are TCF/Lef transcription factors which bind sites matching the consensus ATCAAAG in the promoter regions of Wnt target genes. This problem paper investigates embryonic Wnt (eWnt); a novel member of the Wnt family of ligands that has been identified in the frog Xenopus tropicalis. The single large open reading frame (ORF) codes for a primary translation product of 40 Kd. A restriction enzyme map of the eWnt cDNA is shown in Figure 1. Experiments designed to look at the properties of the eWnt protein make use of the pTran vector. Figure 2 details the multiple cloning site region of the 3400 bp pTran vector. The restriction sites indicated are for enzymes which cut only once within the pTran vector. Sub-cloning the eWnt cDNA in an appropriate orientation into the BamHI site of pTran allows transcription of a synthetic mRNA coding for the full length eWnt protein using the T7 phage RNA polymerase promoter. Figure 1 Map of the eWnt cDNA

Figure 2

Multiple clones site region of pTran plasmid

Please show all relevant working and calculations. Question 1: (2 marks) How many amino acids are in the conceptual eWnt protein? 367 amino acids

Biology problem paper specimen

Question 2: (2 marks) The 1225 bp fragment containing the eWnt ORF is sub-cloned into the BamHI site of the 3400 bp pTran vector. The ligation reaction to sub-clone the eWnt ORF fragment into pTran requires a 3:1 molar ratio of insert DNA to vector DNA. 100 ng of pTran vector DNA is used in the ligation reaction. Assuming that the average base content in both vector and insert is the same, calculate the mass of insert DNA (in ng) which will be added to the reaction in order to give the 3:1 molar ratio of insert to vector DNA? 108 ng Question 3: (1 marks) A clone containing the ORF fragment in the correct orientation is identified. In order to produce a suitable transcription template the circular pTran-eWnt plasmid DNA must be linearised to enable the production of a run off RNA transcript. Which restriction enzyme must be used to produce the linear template required for the sythesis of a run off transcript containing the whole of the eWnt ORF and the poly adenylation signal sequence? NotI Question 4: ( 3 marks) The eWnt mRNA has been transcribed and purified. The purified product is contained in a final volume of 20 l. A 1/1000 dilution of the product has an OD 260 of 0.014. 40 g/ml RNA has an OD of 1. What is the total mass (in g) of the mRNA product? 11.2 g Question 5: (3 marks) A cell lysate based in vitro translation system is used to investigate the processing of the eWnt protein. The addition of synthetic eWnt mRNA to the cell lysate results in de novo translation of eWnt protein. This assay requires the use of 1 g of mRNA per reaction. What volume of your transcription product will you need to use for each translation reaction? 1.79 l Question 6: (5 marks) The sizes of translation products are analyzed by SDS-PAGE. As predicted the size of the primary translation product is about 40 Kd. Endoplasmic reticulum vesicles purified from canine pancreas when added to the in vitro translation reactions allow post-translational modification of secreted proteins. The addition of ER vesicles to the reactions leads to a shift in size of the product to 48 Kd. Why does this shift in size occur? Wnt proteins are secreted glycoproteins which will normally enter the secretory pathway by translocation into the ER. Once in the ER the protein can by glycosylated. Translation in the absence of ER vesicles gives the expected size of the unprocessed primary peptide. Addition of the ER vesicles allows translocation of the primary into the vesicles lumen where they can be processed. Glycosylation of the Wnt protein causes an increase in molecular weight to 48 KDa. Question 7: (5 marks)

Biology problem paper specimen

When the translation product produced in the presence of ER vesicles is subsequently treated with the enzyme N-glycosidase the size of the product shifts to 38 Kd. Why is the product now smaller than the predicted primary product size of 40 Kd? The N-glycosidase enzyme removes the glycosylation from the product synthesized in the presence of the ER vesicles causing a reduction in the size. The resulting product is smaller than 40 KDa because during translocation into the ER the signal peptide is cleaved from the amino terminus of the protein. Question 8: (6 marks) A region upstream of the transcriptional start site of the eWnt gene has been isolated and cloned upstream of a minimal eukaryotic promoter designed to drive expression of the luciferase enzyme based reporter gene. This construct is termed eWnt luc. Figure 3A shows the profile of the relative levels of expression from the endogenous Xenopus eWnt gene at a number of time points post fertilization. Figure 3B shows the profile of the relative levels of reporter activity in Xenopus embryos carrying the eWnt-luc transgene. What do these data tell us about the eWnt-luc transgene and the upstream sequence that it contains? Figure 3A Figure 3B

The temporal expression profile for the endogenous gene is closely matched by that of the reporter transgene. This indicates that the reporter is able to recapitulate the expression of the endogenous gene. Therefore the identified upstream region of eWnt within the eWntluciferase transgene contains all the regulatory information necessary to drive the normal expression pattern of this gene. Question 9: (6 marks) In subsequent experiments eWnt protein is overexpressed from injected mRNA in embryos carrying the eWnt-luc transgene and in embryos carrying modified eWnt-luc transgenes in which either bases 1 to 30 or bases 31 to 54 have been deleted from the upstream region (eWnt-delta30-luc and eWnt-delta54-luc respectively). The sequence of the complete upstream region of eWnt-luc is shown in Figure 4A. Figure 4B shows reporter activity in embryos carrying these transgenes in the absence or presence of overexpressed eWnt protein. Present an hypothesis to explain the observed effects on reporter activity. Examination of the sequence 31 to 54 reveals the presence of 2 consensus TCF binding sites for TCF/Lef transcription factors. These are likely to be involved in mediating the reporter response to Wnt signaling. Removal of these sites renders the reporter unresponsive to Wnt signaling.

Biology problem paper specimen

Figure 4A

Upstream region of eWnt

Figure 4B
Reporter expression
Relative expression

600 500 400 300 200 100 0 eWnt-luc eWntluc+eWnt protein eWnt-delta 30-luc eWnt-delta 30-luc+eWnt protein eWnt-delta 54-luc eWnt-delta 54-luc+eWnt protein

Biology problem paper specimen

CELL AND ORGANISMAL BIOLOGY 2

This question concerns the use of oxygen by diving mammals. The first part of the question is to investigate the relation between metabolic rate and size, and how this may be influenced by their diving habits. The second part of the question concerns the use of oxygen by human divers. Table 1 Type of animal Common Seal Grey Seal Walrus Lesser Rorqual Humpback Whale Greenland Whale Human Horse Elephant Live mass of Rate of use of Oxygen stored by animal (kg) oxygen (ml / min.) the animal (ml / kg) 100 170 46 500 560 52 1 100 1 000 46 5 000 3 150 52 22 500 9 700 50 66 000 21 800 45 70 250 8 650 1800 unkn 3800 4460 unkn Heart beats / minute At surface | Diving 92 14 51 8 40 unkn. 27 unkn. 18 3 14 unkn. 80 50 35 28 unkn. : Unknown

1. Mammals that dive under water at 10C use oxygen during submergence at the rates shown in Table 1. a. Draw graphs to show the relationship in Table 1 between the size of a mammal, its oxygen consumption and heart rate. (9 marks)

100000
acquatic terrestrial
rate of oxygen use (ml/min)

10000

1000

100 10 a. 100 1000

mass (kg)

10000

100000

Biology problem paper specimen

80 70
oxygen capacity (ml/kg)

acquatic terrestrial

60 50 40 30 20 10 0 1 10 100 1000 10000 100000 mass (kg)

100

heart rate (beats / min)

10 acquatic surface terrestrial surface acquatic dive terrestrial dive 1 1.0 10.0 100.0 1000.0 mass (kg) 10000.0 100000.0

Summarise in words the differences in oxygen consumption between acquatic and terrestrial animals, and the effects of diving on oxygen consumption. (9 marks) Rate of oxygen use is a log log function of mass (very good straight line) Terrestrial mammals above their acquatic friends (though the whales etc live in colder water, energetically easier to move through water than on land)

Biology problem paper specimen

Oxygen capacity is independent of size, and is much more than humans. Need this to store oxygen to use while diving Heart rate declines in log-log fashion with size, and it appears that the terrestrial animals have a lower heart rate at the surface During diving, heart rate reduces (bradycardia), very substantially greater drop for acquatic than terrestrial 2. Suggest why the rates of heart beat, where known, are so low when diving compared with values at the surface and any other aspect of physiological adaptation associated with this. (5 marks) While diving, no air outside and probably not much oxygen will be in lungs (compressed by pressure) so dont need heart to pump blood around the muscles to transfer oxygen from air to muscle. Most oxygen probably stored in muscle myoglobin anyway, 3. Human divers commonly breathe compressed ordinary air (21% O2, 78% N2 and 1% Argon) when diving in shallow water. The hydrostatic pressure in water increases steadily by 1 atmosphere for each 10 metres below the surface a. How does the partial pressure of oxygen increase with depth? (2 marks) linearly, at 0.2 atm for each 10 m b. What would you expect the partial pressure of oxygen to be in the human body at 70 metres depth (show calculations)? (6 marks) partial pressure at 70 m = 0.2 * (70 / 10 * 1 (for water) + 1 (for atmosphere) atm ) = 1.6 atm c. Oxygen is quickly toxic at a partial pressure of about 2 atm. At what depth would this be reached? (2 mark) if d is depth; 2 = 0.2 * (d / 10 * 1 (for water) + 1 (for atmosphere) atm ) 2 = 0.2 * d /10 + 0.2 2 0.2 = 0.02 * d 1.8 / 0.02 = d = 90 m

Biology problem paper specimen

MOLECULAR BIOLOGY AND BIOCHEMISTRY 1

Loss of function mutations were generated on plasmids and investigated using yeast cultures. Measurements were made so that the effect of the mutations could be determined and hypotheses devised to explain the observations. Two point mutations, Mut1 and Mut2 were generated in gene X in separate copies of shuttle vector plasmids based on bioinformatics data that suggested that these mutations would result in loss of function mutations. An experiment was designed to measure the rate at which plasmids containing the Mut1 and Mut2 mutations were lost from the yeast Saccharomyces cerevisiae. Yeast cells were transformed with the constructs outlined in Figure 1. The plasmids possessed a centromere sequence (CEN), which allows them to exist at low copy number but be accurately segregated at mitosis and an Autonomously Replicating Sequence (ARS) that allows replication of the plasmid in yeast. The URA gene encodes a protein required for uracil production that is missing in the host yeast strain. S. cerevisiae cells containing the plasmids were selected for on complete medium plates that did not contain uracil. Colonies were inoculated into liquid cultures without uracil and grown into the log phase. Aliquots of these cultures were inoculated onto plates with and without uracil, and the liquid culture was used to inoculate another liquid culture that DID contain uracil. The cells were grown for a further four generations and then two further aliquots were plated onto media with and without uracil. The plates were incubated until colonies were visible, and the number of colonies on each plate was counted (Table 1).

Table 1 Plasmid No. of colonies before growth in non-selective media media WT Mut1 Mut2 1189 467 904 media-ura 1322 504 655 No. of colonies after 4 generations without selection media 2055 1521 1505 media-ura 2263 489 441

1. Calculate the stability of each plasmid under non-selective conditions using the formula (6 marks): % cells that lose plasmid per generation X = (1 e ) 100 A ln( ) B Where: r N and A=% cells containing plasmid after N generations without selection, B=% cells containing plasmid before non-selective growth
r

Biology problem paper specimen

WT= 0.3% cells that lose plasmid/ generation Mut1= 26% cells that lose plasmid/ generation Mut2=22.9% cells that lose plasmid/ generation 2. Identify which of the three plasmids is most stable and which is most unstable (5 marks). Most stable is WT with 0. 3% of cells losing plasmid/generation and most unstable is Mut1 with 26% loss.

The plasmids used to generate the plasmid stability data were digested with HindIII, SmaI and EcoRI. The resulting DNA fragments were separated on an agarose gel, stained with ethidium bromide and visualised under UV light. The results are shown in Figure 2. 3. Construct a plasmid map for the Mut1 plasmid (10 marks). Answer:

Eco RI 580 Bam HI 900

Xba I 5050

URA 3

Amp

pCEN-Gene X-URA 5450 bp

Hind III 1625 ori CEN

ARS

Sma I 2220

Eco RI 2690 Gene X

Biology problem paper specimen

4. Suggest a hypothesis for why the Mut1 and Mut2 plasmids are unstable (6 marks). Mut1: the effect likely to be due to loss of part of CEN and not Gene X. Or Mut1 is a dominant negative of a gene required for plasmid maintenance. Mut2: the effect is due to a mutation in the Gene X, (dominant negative effect). 5. In the case of Mut1 how could you test your hypothesis (6 marks)? Mut1: Put the WT Gene X in the CEN deletion plasmid and Mut1 Gene X in the fulllength plasmid to separate the effects of the Mut1 mutation from the effect of only having a partial CEN.

0 Xba I 6120

Eco RI 580 Bam HI 900 URA 3

Amp

ori Eco RI 5090

pCEN-Gene X-URA 6500 bp

Hind III 1625

ARS
Bam HI 4351 CEN Sma I 2220

Sma I 4060 Gene X

Eco RI 2690

Figure 1. Map of plasmids used to investigate the function of gene X in yeast. Three plasmids were generated and tested. The plasmids possessed either the WT Gene X or one of two mutations believed to result in loss of function.

Biology problem paper specimen

Figure 2. Restriction enzyme digestion of plasmids recovered from yeast.

Biology problem paper specimen

MOLECULAR BIOLOGY AND BIOCHEMISTRY 2

Overexpression of protein at different temperatures: this problem concerns the synthesis of a specific protein in a bacterial expression system. It deals with analysis of bacterial growth, and characterisation of the product by gel chromatography. Introduction During overexpression of recombinant proteins in Escherichia coli, misfolded proteins may aggregate and form insoluble inclusion bodies. One factor that can affect the tendency of a bacterially overexpressed protein to aggregate is the temperature of cell growth. Rapid growth at 37 C leads to high rate of protein expression, and generally a greater tendency of the protein to aggregate and form inclusion bodies than when cells are grown at lower temperature, where the rate of protein synthesis is slower. The aim of this study was to assess the effect of temperature on the rate of protein expression and it solubility A plasmid coding for the protein under study was transformed into a suitable Escherichia coli strain and grown at 37 C in LB medium containing 100 g/ml ampicillin. Cell density was monitored, and when the value of A600 was 0.2 protein expression was induced by the addition of IPTG. At this point the culture was divided into two equal portions, one of which was cooled to 25 C and the other was left to grow at 37 C. Measurement of cell density was continued, and the results are shown in Table 1. Samples were taken from the 37 C culture at 0, 1, 2 and 3 hours after induction, and from the 25 C culture at 0, 1 , 3 and 5 hours after induction. Time (mins) 0 30 60 90 120 150 180 210 225 240 270 300 315 360 390 480 A600 37 C 0.04 0.038 0.042 0.048 0.05 0.1 0.2 0.4 0.8 1.6 1.7 1.8 1.03 1.8 25 C

INDUCTION

0.2 0.28

1 hr post-induction 1hr post-induction 2 hr post-induction 3 hr post-induction 5 hr post-induction

0.4 0.56

Biology problem paper specimen

Table 1. Cell density at 600 nm (A600) for growth at 37 C and 25 C. Note that cells were grown at 37 C for 3 hours before the cultures were divided for growth at the two temperatures.

Question 1 (12 marks 4 for each part) Using an appropriate form of graphical plot evaluate: (i) the lag time before the onset of logarithmic growth at 37 C Lag time = 115 mins (ii) the doubling time for the cell cultures at 37 C and 25 C Doubling time at 37 C = 30 mins (iii) stating any assumptions, estimate the value of A600 for the 25 C sample taken at 3 hours after induction of protein expression. Doubling time at 25 C = 90 mins Cells were harvested from 100 ml samples of the cell cultures grown for 3 hours at 37 C and 5 hours at 25 C (under the same conditions as Table 1, Part 2), lysed by sonication, and centrifuged to yield a supernatant fraction (S) and pellet fraction (P) for each growth temperature. A sample of total cell extract (T) was also taken before centrifugation. Small samples (from equivalent cell densities) were taken for protein analysis by denaturing polyacrylamide gel electrophoresis (SDS-PAGE). All three samples (T, P and S) from each growth temperature were denatured by boiling in SDS. The resulting gels were stained for total protein with Coomassie blue, and the results are shown diagrammatically in Figure 2. T S P T S P

(37 C)

(25 C)

(A)

(B)

Biology problem paper specimen

Figure 1. SDS-PAGE gels of the total cell protein(T), and the soluble (S) and pellet (P) fractions of expressed protein from (A) the 37 C cell growth and (B) the 25 C cell growth cultures. The protein MW ladder is shown on the left of each gel. Question 2 What conclusions do you draw from the SDS-PAGE results about the form of the expressed protein at the two temperatures? (5 marks) There is a lot more soluble protein a produced at 25 C than at 37 C, as evidenced by the band intensities Samples of soluble protein fractions from 100 ml of the 37 C and 25 C cell cultures were dialysed for purification on a Ni-nitriloacetate (Ni-NTA) column, which binds His-tagged proteins. The his-tagged protein proteins were eluted by imidazole gradients (in separate experiments) as pure protein, as demonstrated by SDS-PAGE. The total amount of pure protein from the 37 C cells was 3.0 mg, and from the 25 C cells it was 25.2 mg. Question 3 From the total protein yield from the Ni-NTA column, calculate the concentration of soluble protein per ml of cell culture in the 37 C and 25 C cultures. (10 marks) At 37 C 3.0 mg soluble protein were produced from 100 ml culture. Therefore concentration of soluble protein per ml = 30 g/ ml At 25 C 25 mg of soluble protein from 100 ml, so the concentration is 250 g/ml Question 4 Outline how would you quantitatively assess the proportion of protein that was produced in soluble form at the two temperatures? (6 marks) By scanning the gels and estimating the proportion of soluble to total protein.