MITOCHONDRIAL DNA ANALYSIS OF NONOSABASUT,

A BEOTHUK INDIAN CHIEF

A THESIS SUBMITTED TO THE GRADUATE
SCHOOL IN PARTIALFULLFILLMENT OF THE REQUIREMENTS
FOR THE DEGREE
MASTER OF SCIENCE IN BIOLOGY
BY
APRIL MAY REED
Date
"7
t/
1
3),/
Date
Date
Departmental Approval:
C2P--, 1-/5-01
Dr. Carl Warnes, Departmental Chairperson Date
Graduate Office Check:
7 / / ~ /D/
.
g ~ 21. ~ 4 ,j;1t4
Dean of the Graduate School Date
BALL STATE UNIVERSITY
MUNCIE, INDIANA
JULY 2001
11
,/MITOCHONDRIAL DNA ANALYSIS OF NONOSABASUT,
A BEOTHUK INDIAN CmEF/
A THESIS
SUBMITTED TO THE GRADUATE SCHOOL
IN PARTIAL FULFILLMENT OF THE REQUIREMENT
FOR THE DEGREE
MASTER OF SCIENCE IN BIOLOGY
BY ,
APRIL MAY REED
-,
CHAIRPERSON
DR. CAROLYN N. V ANN
BALL STATE UNIVERSITY
MUNCIE, INDIANA
JULY 2001
ABSTRACT
....... f',
;i <:I:;"
.R. 1.(1 THESIS: Mitochondrial DNA Analysis ofNonosabasut,
a Beothuk Indian Chief
STUDENT: April May Reed
DEGREE: Master of Science
COLLEGE: College of Science and Humanities
DEPARTMENT: Biology
DATE: July 2001
PAGES: 104
The Beothuk Indians were an extinct group of Amerinds who were among the
earliest founders of Newfoundland. In literature, the Beothuk were described as perhaps
being phenotypically more similar to Europeans than Asians (Gatschet 1890, Lloyd 1875,
1876a, Marshall 1996). In this research, mitochondrial DNA (mtDNA) analysis was
performed on a Beothuk individual in order to determine his haplotype and, perhaps, shed
light on the origins of the Beothuk.
For this analysis, a tooth ofNonosabasut, a Beothuk chief who died in 1819 was
loaned from the Royal Museum of Scotland. Ancient DNA was extracted from 172 mg
of dentin from the tooth. The DNA was cut with two blunt-end restriction enzymes, RsaI
and HaeIII. Double-stranded DNA adapters were ligated to the blunt ends. A single
adapter was used to amplify the resulting fragments using PCR. In this manner, two
libraries ofthe DNA were created that could be readily reamplified using a small amount
111
ABSTRACT
....... f',
;i <:I:;"
.R. 1.(1 THESIS: Mitochondrial DNA Analysis ofNonosabasut,
a Beothuk Indian Chief
STUDENT: April May Reed
DEGREE: Master of Science
COLLEGE: College of Science and Humanities
DEPARTMENT: Biology
DATE: July 2001
PAGES: 104
The Beothuk Indians were an extinct group of Amerinds who were among the
earliest founders of Newfoundland. In literature, the Beothuk were described as perhaps
being phenotypically more similar to Europeans than Asians (Gatschet 1890, Lloyd 1875,
1876a, Marshall 1996). In this research, mitochondrial DNA (mtDNA) analysis was
performed on a Beothuk individual in order to determine his haplotype and, perhaps, shed
light on the origins of the Beothuk.
For this analysis, a tooth ofNonosabasut, a Beothuk chief who died in 1819 was
loaned from the Royal Museum of Scotland. Ancient DNA was extracted from 172 mg
of dentin from the tooth. The DNA was cut with two blunt-end restriction enzymes, RsaI
and HaeIII. Double-stranded DNA adapters were ligated to the blunt ends. A single
adapter was used to amplify the resulting fragments using PCR. In this manner, two
libraries ofthe DNA were created that could be readily reamplified using a small amount
111
of the PCR product. mtDNA type was determined by amplifying specific regions and
performing Restriction Fragment Length Polymorphism analysis and sequencing. It was
determined that the Beothuk individual had a 9-bp deletion at nucleotide position (np)
8272, an AZul restriction site at np 5176, and heteroplasmy for a HincH restriction site at
np 13,259, indicating that the Beothuk individual falls into the Native American
Haplogroup B. Haplogroup B is not present in modem Siberian populations, whereas the
remaining Native American mtDNA haplogroups are. It has been hypothesized that
Haplogroup B arrived in the Americas at a different time than haplogroups A, C, D, and
X, about 16,000-13,000 YBP (Years Before Present) (Starikovskaya et aZ. 1998).
Haplogroup B can be found in some modem Taiwanese, Japanese, Korean, Evenk, and
other Asian populations.
Sequencing ofthe D-Loop region revealed a G to A transition at np 16303. To
our knowledge, this transition was never previously reported in a Native American. This
transition has been reported in Tibetans, Koreans, Hans, and Japanese, all considered to
be southeast Asian Causacoids (Torroni et al. 1993b, 1994b). This transition, also
frequently described in the Caucasian Haplogroup H, is especially prevalent in Spain and
among the Basque. It is described as a root haplotype of Hap log roup H whose
expansion was estimated to be between 12,300-13,200 YBP (Torroni et aZ. 1998). This
time estimate coincides with the expansion ofHaplogroup B. One possible explanation
for this transition may be some admixture of the Beothuk with a Caucasian population.
IV
ACKNOWLEDGEMENTS
Without the encouragement, support, and advise of my family and friends,
completing this project would have been very difficult. I would especially like to thank
my husband, Kris, for his constant support throughout my time at Ball State.
Dr. Carolyn Vann has been my great motivator. Her faith in my abilities has
meant the world to me. I would like to thank her for all that she has taught me. Most of
all, I would like to thank her for her friendship.
I would also like to thank the rest of my thesis committee. Dr. Clare Chatot has
given me advice and encouragement often throughout this project. Dr. James Mitchell
did not hesitate to jump in and help when I needed it.
Without Dr. James Pyle's encouragement, I never would have pursued research
with Dr. Vann. Dr. Carl Warnes has always supported and encouraged me. Fresia
Steiner has been a constant wealth of information. She has also been a good friend.
I would like to thank the Royal Museum of Scotland for loaning us the Beothuk
tooth. I hope they will be pleased that we were able to amplify the DNA. I also hope
they will find the results interesting.
I would like to thank Dr. Neal Lambert for drilling the tooth for me. He was very
generous with his time. His quick response allowed me to get this project finished in
time for graduation. I would also like to thank Tara Angel Keels for starting this project.
She obtained the tooth from the Royal Museum of Scotland. In addition, she sent me an
entire box of background material on the Beothuk Indians.
Lastly, I would like to thank my parents and grandparents. Grandpa, maybe I can
fly the plane now.
v
X. RESULTS AND DISCUSSION 63
Powdering of Dentin 63
Gel Analysis of Library Amplification 63
Gel Analysis of Marker-Specific Amplification 65
RFLP Analysis 76
Sequencing 81
European Marker 85
Analysis of the RsaI Restriction Site Loss at np 16303 85
Apendices A & B- Compilation of Published mtDNA Analyses 95
XI. CONCLUSIONS 96
XII. REFERENCES 100
Vll
- - - - - - - - ~ - - - . - - -
LIST OF FIGURES AND TABLES
Figure
1. Map of Newfoundland and the Areas the Beothuk Were Known
to Inhabit
2. Map of Newfoundland Showing L'Anse aux Meadows, the Viking
Settlement
3. Rendering of Demasduit
4. Replica of a Canoe Taken from Nonosabasut's Burial Hut
5. Shanawdithit's Drawing of the Killing ofNonosabasut
6. Library Creation Flowchart
7. D Loop Replication System Mechanism Model
8. Diagram of Native American mtDNA Polymorphism Locations
9. Distribution of mtDNA Haplogroups Among Native Americans
10. Gel analysis of the Initial Amplification of the RsaI and Haem
Libraries
11. Gel Analysis of Libraries After Ethanol Precipitation
12. Example of Failed Attempts at Marker-Specific Amplification
13. Example of Spurious Bands Observed During Optimization
Attempts
14. Amplification ofAluI-5176, Hinell-13259, and Haem-663
Markers
15. Amplification of 9-bp Deletion Marker
16. Amplification ofD-Loop Region
17. Gel Analysis Showing Contamination in the Negative Controls
18. RFLP Analysis of HaeIll-663, Hinell-13259, and AluI-5176
PCR Products
19. Re-Digestion of Hinell-13259 PCR Product with Hinell and
AluI
20. Re-Amplification of Desired PCR Product from Agarose
Extraction
21. Tibetan Phylogenetic Tree
22. Phylogenetic Tree of Caucasian mtDNAs
23. Diffusion of European Haplogroups
Table
1. Polymorphisms Which Characterize Each Native American
mtDNA Haplogroup
2. Primers and Primer Sequences Used to Analyze the mtDNA
Markers in the Beothuk Chief
3. The Library Used for Amplification of each Native American
mtDNA Marker
4. Final Thermocycling Conditions for the D Loop and Native
American Marker Amplification
Vlll
Page
6
8
13
17
23
29
36
39
40
64
66
67
68
70
71
72
74
76
78
80
87
90
92
Page
41
52
53
55
- ~ . - -
-----
5. Digestion Reaction Conditions for RFLP Analysis of Native
American Markers
58
6. Final Thermocycling Conditions for the AluI-5176 mtDNA
Marker Amplification
60
7. Expected RFLP Products and Results
8. Beothuk mtDNA Sequences
9. Sequencing of Investigator's D-Loop Region
Appendix
A. D-Loop Polymorphisms
B. Previously Published mtDNA Polymorphisms
IX
77
83
85
Page
attached as a disk
attached as a disk
INTRODUCTION
Contemporary Amerindian mitochondrial DNA (mtDNA) types group into 5
mtDNA lineages designated as Haplogroups A, B, C, D, and X based on the presence or
absence of single base pair alterations (Stone and Stoneking 1993). The existence of
these lineages in modem Asian populations is used as evidence for hypotheses that the
founding Native Americans were of Asian descent. Further analysis of Native Americans
can be performed through sequencing ofthe non-coding Displacement Loop (D-Loop)
region of the mtDNA, the most heterogeneic portion of the mtDNA (Anderson et al.
1981).
The objective of this study was to determine ifNonosabasut (No-nos-baw-soot), a
Beothuk (Bee-oth-ick) Indian chief, belongs to a Native American (Asian) or a European
mtDNA haplogroup using DNA extracted from his tooth. The Royal Museum of
Scotland loaned a tooth from the skull ofNonosabasut to Ball State University. The hope
was that mitochondrial analysis of this individual would provide some evidence as to the
origins of the enigmatic group of people, the Beothuk Indians, candidate founders of
Newfoundland.
The origins of the now extinct Beothuk have been argued since the early 1800's.
Based on archaeological evidence, it is believed by some that the Beothuk were a relic
group of Maritime Archaic peoples that separated from a mainland Algonquin population
2
at an early date (Lloyd 1876a). However, others believed, due to the apparent European
reatures ofthe Beothuk, that the Beothuk were descendants of one of the earliest
European outgroups (Marshall 1996). Still others believe that the Beothuk were not
descendants ofthe Maritime Archaic or an ancient European outgroup, but a people
entirely unique (Blake 1888).
The last known Beothuk individual, Shanawdithit (Shaa-naan-dith-it), died of
tuberculosis in 1829. It has been reported that a few surviving Beothuk went back to the
mainland, Labrador, to join other Indian groups. However, such reports have never been
substantiated. Thus, the origin and history ofthe Beothuk remains a mystery. However,
the Beothuk Indians could still possibly communicate their origin to us through their
remains via molecular techniques allowing mtDNA analysis.
The results of this study could have important implications for the current
controversy surrounding the initial colonization of the Americas. The analysis will reveal
if the Beothuk individual belongs to one of 5 Native American haplogroups. This will,
perhaps, answer some questions about the Beothuk's role in American pre-history and
about their relationship to other populations and migration times.
Previous genetic studies have strongly implied that all modem Native Americans
derived from Asian ancestors. Because mtDNA is primarily maternally inherited, has a
high mutation rate, is found in high copy within the cell, and does not undergo
recombination, it is a very useful genetic system for studies into human origins and
migrations. It is particulary useful for studies involving ancient DNA. Ancient DNA is
highly fragmented and degraded. Due to the high copy ofmtDNA versus nDNA in cells,
mtDNA amplification is often more successful than nDNA in ancient DNA.
3
The accumulation of mitochondrial mutations has created continent -specific
po1ymorphisms. The linked occurrence of these polymorphisms within a group of people
bids to the formation of specific mtDNA haplotypes (a collection of all polymorphisms
held by an individual's mtDNA). Groups of related haplotypes are termed a
"haplogroup." Haplogroups are defined by one or more unique mtDNA mutations that
not only relate the individual haplotypes within the haplogroup to each other, but also set
the haplogroup apart from other mtDNA haplogroups.
All mtDNA haplotypes found to date in contemporary and ancient Native
American populations group into 5 categories (Brown et al. 1998). Haplogroup A is
defined by a HaeIlI site at nucleotide position (np) 663, Haplogroup B by a 9-bp deletion
in the intergenic region between COIl (cytochrome oxidase subunit II) and tRNA Lys
(lysine tRNA) at np 8272, Haplogroup C by a combined HindI site loss at np 13259 and
an A luI site gain at np 5176, and Haplogroup X by a HaeIlI site at nps 16223 and 16278
in the D-Ioop region and a loss ofa DdeI restriction site at np 1715.
Two libraries of the individual's DNA will be created to be used as templates for
mtDNA marker-specific amplification as described in Weiss et al. 1994. Library creation
is necessary due to the limited nature of the irreplaceable DNA. The creation of two
hbraries is necessary because the four-base cutters being used, RsaI and HaeIII, are found
frequently in the genome. Thus, if the portion ofthe mtDNA containing the marker of
interest contains, for example, an RsaI site, the HaeIII library can be used as a template
instead.
The libraries will be created by :first digesting the Beothuk DNA with RsaI and
HaeIII. The resulting blunt-ended fragments will be ligated to a common, double-
4
sbanded, blunt-ended adapter. The fragments will then be amplified to form the two
Iiharies using a shorter, single-stranded oligonucleotide within the adapters as a PCR
primer. As needed, the library can be reamplified using the same oligonucleotide as a
, . PCR primer. In this manner, a potentially inexhaustible supply of the irreplaceable
material will be created.
Mitochondrial marker-specific amplification will then be carried out using PCR
primers (modified from Stone and Stoneking 1993) to amplify specific segments of
DNA, less than 250 base pairs (bp) long, which contain previously described markers.
The resulting PCR products will be used in Restriction Fragment Length Polymorphism
(RFLP) analysis and/or sequencing. The Beothuk individual will then placed into a
Native American haplogroup, if possible, based on the mtDNA analysis.
In addition, PCR primers will be designed and used to amplify a 340-bp fragment
of the D-Loop region. This PCR product will then be sequenced and compared to the
Cambridge reference mtDNA sequence (Anderson et al. 1981) to determine any
polymorphisms. Any polymorphisms found in this sequence will be compared to
previously published D-Loop polymorphisms in Asian and European populations. This
information will be used in conjunction with the marker-specific analysis to aid in
demystifying the origins of the Beothuk.
LITERATURE REVIEW
Beothuk Indian Background
The Beothuk Indians were thought to be the aboriginal inhabitants of
Newfoundland (which is about the size of New York state) (Gatschet 1885). There is
evidence that the Beothuk inhabited Labrador and Newfoundland at the same time
(Gatschet 1890). The Labrador Eskimo tradition is that the Beothuk were inhabitants at
one time of Battle Harbour, Labrador (Lloyd 1875).
The Beothuk were nomadic people who were hunters, fishers, and gatherers.
They lived along the Exploits River in the late fall to hunt caribou (see Fig 1). In the
early winter they were together at the eastern end of Red Indian Lake. They were
scattered along the east coast of Newfoundland for the duration of the year. The Beothuk
were thought to be secluded from other Indian people (Lloyd 1875). However, they may
have had peripheral involvement with the Indians on the mainland. For example, it was
reported that the Eskimos crossed Straight of Belle Isle every day in the 1690's
(Gatschet 1886).
The Beothuk lived in a state of isolation far apart from the inhabitants of the
mainland (Lloyd 1876b). The Micmac said that the Beothuk had "magic powers" that
would allow them to know about the approach of strangers. They would flee on their
snowshoes before anyone saw them (Gatschet 1890). Perhaps this ability to avoid
contact is why so little is known about the Beothuk.
.-.. - - - - - - - - - - - - = - - ~ - - - - ~ - - - . ~ - - - - - - ~ ~ - - - -
6
LABRADOR
.... ....... ... ...
aui:8E:C
Figure 1: Map of Newfoundland and the Areas the Beothuk Were
Known to Live (Marshall 1996). The blue asterisk denotes the Exploits River
that the Beothuk inhabited in the Fall. The yellow asterisk denotes eastern Red
Indian Lake, which the Beothuk inhabited in the winter. The Beothuk were
scattered along the east coast for the duration of the year. The orange arrow
points the Straight of Belle Isle the Eskimos were known to cross.
7
Some described the Beothuk as "cruel and austere" (Marshall 1996). However,
others held the same opinion as Captain Hayes that the Beothuk were "altogether
harmless" (Blake 1888). The Beothuk differed from other North American tribes in that
they had a "lightness of complexion" (Lloyd 1876a). The Beothuk were further
described as being different because they had European features (Lloyd 1875). In
addition, the Beothuk Indians are distinguishable in historical literature due to their
extensive use of red ochre. The Beothuk would smear their bodies and, perhaps
inadvertently, their tools and clothes with a mixture of the red ochre and oil. Due to this
ritual, the Europeans called the Beothuk the "Red Indians."
The Beothuk's first encounter with the Europeans was probably with the Vikings,
circa 1000 AD. The Viking Lief Erikson, "Lief the Lucky," built a settlement in what is
now agreed to be L'ans aux Meadows in northwestern Newfoundland (Fig 2). The
Vikings (Nordic) inhabited Newfoundland for about 8 years. During that time they
encountered the aboriginal natives (which were probably Recent Indians, ancestors of the
Beothuk). The Vikings called the red people "Skraelings" (Marshall 1996).
John and Sebastian Cabot recorded an encounter with the Beothuk Indians when
they arrived in Newfoundland in 1497 (Lloyd 1875). In addition, the Beothuk were
described by Gaspar de Corte-Real in 1500 and Jacques Cartier in 1534 (Marshall 1996).
Basque, Breton, Spainish, Portuguese, French, and English fishermen all described the
presence of the native Beothuks (Blake 1888). Captain Richard Whitboume reported that
in 1615 that the Beothuk helped the French kill, cut, and boil whale in exchange for bread
(Lloyd 1875). However, this encounter was most likely with the Micmac rather than the
Beothuk due to the Beothuk's unwillingness to interact with the European settlers.
- ~ - - - - - - ~ - - - - - - - - - - - - - - - - -
Port au:-:: Ch 0 ix:
Gros Morne
National Park
I
I
:' Fenies to Nova Scotia .r ".
J .................
,.
150 km
Figure 1: Map of Newfoundland Showing L'Anse aux Meadows,
the Viking Settlement (htip:!/www.nfld.net/whitefeather/map2.html).
The purple arrow indicates the position of the Viking settlement, circa 1000 a.d.
The Vikings wrote of interactions with the aboriginals they called "Skraelings"
which were probably the Beothuk.
8
9
THE ORIGIN OF THE BEOTHUK INDIANS
About 5000 years ago, the ice increased around Greenland (Blake 1888). Later,
as the glaciers retreated, Ice Age hunters followed them into Labrador. It is believed that
some ofthese individuals migrated across the Straight of Belle Isle from Labrador to the
Northern Peninsula of Newfoundland (see Fig 1) due to the arrival ofthe Palaeo-Eskimos
in Labrador. Those who remained in Labrador and Newfoundland became the Maritime
Archaic Culture. However, most of the Maritime Archaic Indians died or left
Newfoundland before 1050 B.C. (Marshall 1996).
Most scholars believe that a second Indian population (thought to be direct
descendents of the Maritime Archaic) called the Recent Indians migrated from Labrador
into Newfoundland in around 50 B.C. (Marshall 1996). Conversely, a small population
of Maritime Archaic Indians may have remained on Newfoundland when the remainder
of the population left. Then they may have mixed with other surrounding populations
(pastore 1991).
The Recent Indians gave rise to Beaches Complex around 1000 YBP. The
Beaches Complex then gave rise to the Little Passage Complex circa A.D. 1100. Upon
arrival ofthe Europeans to Newfoundland in the 1500's, Little Passage Complex Indians
historically became known as Beothuk. The Beothuk are thought to have derived from
the Little Passage Complex due to the similarities in tools they used (Pastore 1991,
Marshall 1996).
There is much discussion concerning the origins of the Beothuk in historical
literature. William Strong thought that they might be a remnant of an "old stone" archaic
culture (Strong 1930). Frank Speck thought that the Beothuk might have been an archaic
Algonquian remnant. However, he also indicated that they may also be related to the
Eskimos, Labrador Indians, or the Red Paint people (Speck 1922). Others felt that the
appearance, customs & manner of the Beothuk indicated that they were a race separate
from Algonquians & Eskimos (Gatschet 1886).
Charles Willoughby also believed that the Beothuk might have been a surviving
branch of the Red Paint people of Maine (Willoughby 1915, Dixon 1913, and Birket-
Smith 1918). Warren Moorehead, the foremost expert on the Red Paint people
disagreed. He felt that there was little cultural similarity between the Beothuk and the
Red Paint people of Maine (Moorehead 1917)
The conjecture concerning the origins of the Beothuk seemed to have no end.
10
Due to the occasional appearance of blue eyes and the pale skin ofthe Beothuk, some
people even believed they originated in Scandinavia while others thought it was more
probable that they were driven out of Canada by the Iroquois and Hurons (Lloyd 1876a).
It was once stated that "it would not be impossible that ... some ofthe old Viking blood
ran in the veins of the Beothuk tribe" (Blake 1888). The Beothuk have even been
affiliated with Polynesians (Campbell 1892) while Santu, a woman who claimed to be
halfBeothuk and half Micmac said that they were mixed Eskimo (Speck 1912).
Physical Characteristics of the Beothuk
Almost without exception, the Europeans who encountered the Beothuk Indians
took notice of their European-like features. Captain Buchan stated that the skin of the
Beothuk was much fairer than most Indians and closer in fairness to most Europeans
11
(Marshall 1996, Lloyd 1886). Numerous times the appearance of the Beothuk was
compared to that of the Basque or the Spanish. Lloyd stated that the shape of their head
was the same as Europeans, but they had black eyes and hair like Esquimos and skin like
Spaniards (Lloyd 1875). John Peyton stated that the Beothuk were darker than
Spaniards, sometimes having blue eyes. He likened their overall appearance to that of
Spanish gypsies (Busk 1876). The Micmac of Nova Scotia spoke ofthe 'other tribe' (the
Beothuk) that had white faces (Gatschet 1890). In addition, Beothuk skulls purloined
from a grave by McConnack in 1826 were descn"bed as being more European in their
frontal elevation that the skulls of surrounding Indians (Busk 1876).
Shanawdithit, a Beothuk woman who was held captive by the English for 5 years,
was described as having a striking similarity to Napoleon. She had an olive complexion,
black hair and perfect teeth. When she made a sketch of her father, she depicted a
Romanesque nose (Fraser 1886). Elsewhere, the Beothuk were again described as having
aquiline noses (Lloyd 1876a). Another Beothuk woman was captured in 1803 while
collecting bird eggs from a canoe. She was described as being docile, having copper
color skin, black eyes, and the hair of a European (Blake 1888).
The story of two Beothuk men who were captured and taken to the King's court
(Palace of Westminster) is often told as an example of the European resemblance of the
Beothuk. After the men were dressed in fine clothing, someone who had not seen them
in two years had to be told who they were because he did not know they were not
Englishmen (Lloyd 1875).
~ - - - ~ ~ ~ - - -
Beothuk Captives
Most of the known information about the Beothuk derived from the captives
Demasduit (Dee-mas-doo-weet), whom the English called Mary March, and
Shanawdithit, whom the English called Nancy April.
12
Demasduit (Fig 3) was captured on March 5, 1819 (Gatschet 1885). A group of
Beothuk was crossing the Exploits River when a group led by John Buchan began to
pursue them. Demasduit, who was weak from being ill and just delivering a child fell
behind the rest ofthe Beothuk when her snowshoe broke. Buchan captured her on the
ice. Her husband, Nonosabasut, was shot trying to save her. Her infant child died two
days later (Blake 1888, Marshall 1996). Demasduit herself died in less than a year of
tuberculosis (Pastore 1991). Demasduit spent the year of capture living with the family
of Rever and John Leigh in Twillingate. Leigh developed a written record of about 180
Beothuk terms for English words taught to him by Demasduit (Marshall 1996).
Shanawdithit (called Nancy April by the English), her sister, and her mother gave
themselves up to William Cull in the winter of 1823 because they were starving (Pastore
1991). Cull attempted to return them to the Beothuk. However, Shanawdithit, her
mother, and her sister returned because they were afraid they would be killed due to their
contact with the Europeans and the Micmac in the settlement. Shanawdithit's sister and
mother were both sick and died soon after their capture.
Cull sent Shanawdithit to live with John Peyton. She was Peyton's servant for
five years. Shanawdithit was more forthcoming with information on the Beothuk than
Demasduit had been. She communicated with W.E. Cormack ofBeothuk life mainly
through sketches she made. Cormack would then copy the sketches or make notes on the
13
Figure 3: Rendering of Demasduit (Marshall 1996). Miniature
portrait of "A female Red Indian ofNfld. 'Mary March' painted by W. Gosse at
St. Joh's Nfld. July 1941 from an original by Lady Hamilton May 1821." This
rendering portrays Demasduit. Her huband, Nonosabasut, who was killed during
her capture, is the subject of this study.
- ~ - ~ - - - - - - - - - - - - -
14
sketches about Shanawdithit's explanations. Cormack, like John Leigh, made a
dictionary ofthe Beothuk words Shanawdithit spoke and their meanings {Marshall 1996).
Shanawdithit died of consumption on June 6, 1829 in St. John's (Fraser 1886, Pastore
1991, Marshall 1996).
Beliefs and Customs of the Beothuk
The legend among the Beothuk was that they sprang from an arrow{ s) stuck in the
ground {Marshall 1996). Whitbourne said they believed that the Great Spirit struck an
arrow in the ground and they arose from the arrow. These beliefs of the Beothuk were
not unlike the beliefs of other North American Indians. The Choctaws believed they
were from the earth, the Oneidas believed they sprang from a large boulder, and the
Hurons believed they arose from a hole in the mountainside (Blake 1888).
Similarities were noted between the sleeping habits and burial rituals ofthe
Beothuks and other American Indians. A tribe at the foot of the Rocky Mountains, the
"Atnahs," dug holes in ground and would inlay them with grasses or branches. This
strongly resembled the sleeping places (trenches) built by the Beothuk (Blake 1888).
1.P. Howley found a "mummy boy" in 1886 that resembled an Alaskan mummy
preserved in the National museum in Washington, D.C. (Gatschet 1890). It was a nine-
or ten-year old boy wrapped in birchbark, doubled together and laid on his side under a
heap of stones. In addition, the Beothuk disposed of their dead like the Western Indians
of sources of Mississippi by wrapping them with birch bark. They also often put their
dead on scaffolding made up of four posts like the Mississippi Indians (Lloyd 1875).
15
Linguistics of the Beothuk
Many parallels were drawn between the Beothuk language and the languages of
other American Indians. However, few linguists agreed on the basis of the comparisons.
Some stated that the Beothuk language was not unlike Inuit (Eskimo) language. Some
parallels were also found with the Tinne in the Rocky Mountains. No parallels with the
Iroquois, who once lived in St. Lawrence (close to Newfoundland), were found (Gatschet
1886).
Many linguists believe that the Beothuk language is in the Algonquian family of
languages (Pastore 1991, Latham 1862, Hewson 1968, 1971). Lloyd thought that the
Innu (Naskapi or Montagnais) of Quebec-Labrador's language most closely resembled
Beothuk language (Lloyd 1886). Dr. R.G. Latham stated that from the vocabulary ofthe
Beothuk, they were of Algonkin relation rather than Eskimo. However, he thought they
were not a branch of the Micmac, etc, but a division of their own (Lloyd 1876a).
Gatschet was the foremost proponent that the Beothuk were of a separate
linguistic family. Gatschet made many statements in support ofhis belief He stated that
the Beothuk and Algonquin phonetic systems differed largely. The Beothuk language
had an objective case while the Algonquin did not. The words for numbers in the
Beothuk and Algonquin vocabulary differed greatly. The terms for human, body,
celestial bodies, nature, colors, animals, and plants (which would be expected to be
similar if they shared ancestry) differed completely. Additionally, Gatschet stated that
the Beothuk language was a totally separate language from Inuit, Tinne, and the Iroquois,
(the other mainland Indians) (Gatschet 1886).
16
Connack thought that the Beothuk language resembled European language more
than other Indian languages (Gatschet 1885). In support ofGatschet's hypothesis that the
Beothuk language was unrelated to surrounding tribes, the language of the Beothuks was
unknown among Canadian Indians (Lloyd 1875).
Archaeological Evidence
Archaeological excavations, written descriptions, and drawings of the Beothuk
tools, weapons, and canoes were also used to infer the origins of the Beothuk. Some
parallels have been drawn between the Beothuk and the Eskimos. Their harpoons
resembled harpoons used by early Eskimo peoples and the Eskimo of the northeast coast
of Labrador (Lloyd 1876a, Pastore 1991). In addition, stone tools found were similar to
Eskimo stone tools (Lloyd 1876b).
The canoes the Beothuk used were unlike Micmac and Nakaspi canoes. The
Micmac used skin for their canoes, not birch bark like the Beothuk (Lloyd 1875). The
Beothuk canoe had a large, rounded keel (Fig 4). In addition, the Beothuk were the only
Indians to use a sail. However, they may have started using sails after contact with the
Europeans. The Beothuk would often steal sails from European settlements. With these
peculiar canoes, the Beothuk were able to sail as far as Funk Island (about 60 km north of
Newfoundland) to hunt Great Auks and collect sea bird eggs. The Beothuk
craftsmanship of the canoes was so clever that they were able to develop a method to
make a canoe that could fold up for transport and still be waterproof when unfolded
(Lloyd 1876b).
17
Figure 4: Replica of a Canoe Taken From Nonosabasut's
Burial Hut (MarsbaIl1996). A birchbark canoe replica collected in 1827 by
W.E. Cormack from Nonosabasut's burial hut (Copyright The Trustees of the
National Museums of Scotland, 1996, neg. 0418). The distinctiveness of the
Beothuk canoe from the canoes of the surrounding Indians was used as support
for the hypothesis that the Beothuk were not related to the other Native American
populations.
18
The Beothuk made deer fences that were up to 30 miles long. They would do this
by strategically falling trees and tying branches to the trees to create impenetrable fences
alongside rivers. They would then leave small passageways open that the deer would
pass through where the Beothuk would be lying in wait. It was said that the upkeep that
would be required on the miles offences was an indication of the sheer number of the
Beothuk at one time. The Columbians frightened and drove the deer in a method similar
to the Beothuk by placing bright colored rags in the bushes that would wave in the wind
(representing men) and drive the deer (Lloyd 1876a).
The Beothuk differed from other American Indians in that they did not make
pottery (Blake 1888, Lloyd 1886). Scholars pointed to this fact as suggestion that the
Beothuk were a remnant of an ancient group. The Beothuk carved their pots out of
soapstone. However, some believe that many archaeological finds, such as soapstone
dishes, have been attributed to the Beothuk that are, in fact, assemblages of materials
from many aboriginal inhabitants such as the Maritime Archaic and the Paleo-Eskimos
(Holly 1999).
Beothuk Interactions With Other Native Americans
The Beothuk Indians were described in literature as being isolated. However, the
Beothuk interacted with many of the "mainland" Indians. The Beothuk were on good
terms with the Labradorian Algonkins of the coast and interior. The Naskapi and the
Montagnais (whom the Beothuk called "Shoudamunk" meaning "good spirit") traded
with them (Gatschet 1885, Lloyd 1875). Shanawdithit talked oftrade with the Labrador
Indians (Jukes 1842). They were friendly and traded with the Montagnais from the
- ~ - - - - - - - - - - - - - - - - - - - -
North. In fact, there may have been intermarriage among Beothuk: and Indians residing
between Newfoundland and the northern Quebec-Labrador peninsula (Pastore 1991). It
is believed that the last surviving Beothuk: may have joined the Montagnais in Labrador
(Marshall 1996).
19
It was Micmac tradition that the relations with Beothuk: were good in earlier times
(Gatschet 1890). At one time, the Beothuk: may even have intermarried with the Micmac
who were from Nova Scotia (Marshall 1996). However, the relations between the
Micmac and the Beothuk: had soured before the arrival of the European settlers. For
example, Shanawdithit dreaded the Micmac, especially a Micmac named "Mudty Noel"-
Wicked Noel. She said that he shot at her for no reason across Exploits River when she
was cleaning venison. She then showed shot wounds to W.E. Cormack (Gatschet 1890).
Shanawdithit said that the Beothuk: name for Micmac was "Shonack" which meant "bad
Indians" (Lloyd 1875). It is believed that once the Micmacs were given firearms by the
French and moved to southern Newfoundland, relations soured irrepairably (Marshall
1996).
The Eskimos were afraid of the Beothuk: because they were unlike Mountaineers,
the Indians of eastern Canada. The Eskimos thought the Beothuk: were more fierce.
There was an encounter between the Beothuk: and the Eskimos in 1831 in the Bay of
Seven Islands in Labrador (Lloyd 1875). Shanawdithit said that the Beothuk: "hated" the
Eskimo because they were dirty and always harassed the Beothuk: (Blake 1888).
In addition to interacting with the surrounding natives, the Beothuk: were being
forced to interact with the Europeans settling in Newfoundland. Newfoundland became a
- - - ----
sanctuary for deserters from the navy, refugees from Ireland, ''reckless and unruly
characters of all kinds who dare not return to their own country, sought an asylum in
Newfoundland (Blake 1888)."
20
Many seasonal fishing settlements were springing up in Newfoundland in the
1800's. The Basque, Bretons, Spanish, Portuguese, French, and English were all settling
in Newfoundland (Marshall 1996). It is believed that some ofthe Beothuk may have
been raped, captured, and! or killed by the Europeans. There may also have been some
blame on the part of the Beothuk. John Buchan claimed to have seen a captive European
mother with children in a Beothuk camp in 1811 (Howley 1915).
Shanawdithit said that their custom was that the first white men whom they
encountered were called "good spirit" (probably the Vikings), the second white men were
called ''bad spirit," and the Micmac were called ''bad spirit" (Fraser 1886). Some have
even gone so far as to state that it is even possible the Beothuk may have encountered
Turkish pirates in late 1500's (Marshall 1996).
BEOTHUK DEMISE
The largest estimate for the number ofBeothuk on Newfoundland at the time of
the first European contact does not exceed 2000 individuals (Pastore 1991). After the
Micmac began to settle Newfoundland and Europeans began to settle, the Beothuk
withdrew into the interior because the coast was no longer safe. However, there were
few available food sources on the interior.
The ecological system the Beothuk depended upon made them vulnerable. Sea
resources may have been unavailable along the coast for a season due to inclement
weather changes in fish migratory patterns (Pastore 1991). In addition, eventually they
were completely unable to fish, gather oysters, eggs, or catch water fowl because they
were forced to remain in the interior (Fraser 1886).
21
The Beothuk were unable to keep up with their deer fences due to their
diminishing population (Fraser 1886). Shanawdithit said that in the Beothuk settlement
in Exploits River in 1811, 20 men, 22 women, and 30 children were left. There were 20-
30 Beothuk in Newfoundland by 1822 (Pastore1991). By 1823, only 14 of the 72 from
1811 survived (Howley 1915).
It is reported that the French may have offered a reward for Beothuk heads in the
late 17
th
century (Gatschet 1885). However, others said that there was no truth to stories
that the Micmacs were brought to Newfoundland by French to kill Beothuk (Pastore
1991). French and English furriers may also have shot Beothuk for furs they were
wearing (Blake 1888).
In the end the Beothuk were confined to the Southeast interior (Marshall 1996).
Shanawdithit was believed to be the last remaining Beothuk Indian. She died in June
1829 of tuberculosis. Some believe that some surviving Beothuk could have been taken
into the fold ofthe Montagnais of Labrador.
NONOSABASUT
Nonosabasut was described as being a strong and powerful chief Unlike most
Beothuk, he had a beard. He stood well over six feet tall. Shanawdithit said he was the
most powerful hunter and chief in the tribe (Marshall 1996). Others said that
Nonosabasut was "noble" (Fraser 1836).
22
John Peyton, Jr., an important furrier & fisherman in Notre Dame, killed him
while capturing Nonosabasut's wife, Demasduit in March 1819 (Pastore 1991).
Nononsabasut tried to negotiate with the captors, but when they refused, he became
enraged (Marshall 1996). Members of Peyton's group shot Nonosabasut in the head and
killed him. Shanawdithit made a sketch ofthe capture ofDemasduit and the killing of
her husband (Fig 5).
W.E. Cormack found the burial hut which contained the remains ofNonosabasut,
his wife (Demasduit), and their infant child along with others on the northwestern shore
of Red Indian Lake during his last attempt to find any living Beothuk in Newfoundland in
1826. There was a boy wrapped in birchbark. Nonansabut was on a scaffold in the burial
hut. There were two skulls. One skull (Nonosabasut's) appeared to be the skull ofa
warrior. It had several wounds. The lower jaw had been cleaved and reconnected in
healing. Another wound was apparent that had been caused by a shot. Both the female
and the male skull had perfect teeth (Fraser 1836, Marshall 1996, Blake 1888). The two
skulls were presented to the late Professor Jameson by Cormack and placed in the
Edinburgh Museum (Lloyd 1876, Marshall 1996). They eventually made their way to the
Royal Museum of Scotland.
Analysis of Ancient DNA
DNA molecules which are preserved in ancient biological material are considered
to be "ancient DNA" (Brown and Brown 1992). DNA has been extracted from bones as
old as 11,000 years old (Brown and Brown 1992). Short sequences of mtDNA from
50,000 to 100,000 year old mammoths preserved in the permafrost have
-,': _ .... '
/ .. ',
--- .
"
f. "' ... '
"r.. '
/ ;
/"
;- --",
..
...... :. -
....;:
.-
.;.-
.'
Figure 5: Shanawdithit's Drawing of the Killing of Nonosabasut
(Marshall 1996). The blue arrow indicates the dead Nonosabasut lying on the
ice. The yellow arrow indicates the captive Demasduit. The orange asterisk
indicates the paths the remaining Beothuk took as they were fleeing Buchan's
group.
23
24
been retrieved (Lindah11997). The most favorable conditions for DNA preservation are
those that are cold and dry (Stone and Stoneking 1999).
The standard technique for extraction of DNA from bone is to powder the core of
the bone. Then, powdered bone is soaked in a buffered salt solution in order to draw out
the charged biomolecules. Protein is extracted with phenol. The DNA is then
precipitated out using ethanol. More often, molecular biologists trying to isolate ancient
DNA are using teeth. This is because the DNA in the dentin is protected by the enamel
surrounding the tooth. Due to this, sometimes less degradation is observed in DNA
extracted from teeth than, for example, DNA extracted from bones such as a rib.
One of the largest problems in dealing with ancient DNA is fungal, algal, and
bacterial contamination that can occur both before and after excavation (Brown and
Brown 1992). In addition, ancient DNA undergoes fragmentation over time. This
fragmentation varies depending upon the conditions of preservation such as the amount
of heat and humidity and the extent of microbial attack. Most ancient DNA molecules
are about 100 to 200 bp in length, although some have been found to be as large as 500
bp (Brown and Brown 1992). However, this fragmentation appears to occur very soon
after death (within 4 years) (Paabo et al. 1989). Therefore, although more fragmentation
may occur over time, the age of the DNA may be less of a factor than previously
expected. Overlapping fragments of the fragmented DNA can be sequenced and
combined in order to reconstruct longer sequences.
25
Contamination Concerns with Ancient DNA
Contamination can occur with the DNA of those who handle the remains of a
body before it is buried. In addition, contamination from modem DNA may occur during
handling ofthe remains by archaeologists, museum keepers or laboratory personnel.
Ancient DNA can be further contaminated by the sloughing off of modem dead skin
cells, dandruff, sweat, saliva, or blood (Brown and Brown 1992). Other examples of
contamination that can occur are bacteriological, fungal, or algal contamination.
The presence of previous PCR products on tools used in genetic analysis are one
of the most common contaminants of ancient DNA. Many laboratories that work with
ancient DNA have gone so far as to create separate laboratories for this sensitive work.
These laboratories often contain separate ventilation systems. In addition, lab workers
are often required to wear face and hair coverings to prevent modem DNA contamination
(Paabo 1993).
Further methods of preventing contamination of ancient DNA have been
described in the literature. These methods include the use of blocked pipette tips to
prevent aerosol contamination, irradiation ofthe outer surface of bone with UV light,
''negative'' extractions (no sample, but all other components), sequencing ofPCR
products being performed on both the light and heavy strands, and wearing gloves and
surgical masks throughout all procedures (Ribeiro-Dos-Santos et aZ. 1996).
PCR as a Method to Study Ancient DNA
The first time PCR was used to study ancient DNA was the amplification of DNA
from a 7000-year-old brain found in Little Salt Spring in Florida (Paabo et aZ. 1988). It
26
has been stated that PCR products amplified from ancient DNA more than a few hundred
base pairs in length should be considered as suspect (Kurosaki et al. 1993). Due to its
degradation, nested PCR is often required in order to get amplification of ancient DNA.
In nested PCR, an initial amplification is performed using external primers. A
subsequent amplification is then performed using more stringent annealing temperatures
or primers that are more internal to the PCR product.
Whenever PCR is performed on D N ~ there is always a chance that the
polymerase being used will introduce, substitute or skip bases during polymerization.
There are several steps that can be taken in order to minimize this possibility. The first
step is to use higher annealing temperatures to increase stringency. It is also often helpful
to include a G or C residue at the 3' end of a PCR primer. G's and C's have a triple
hydrogen bond versus the double hydrogen bond ofthe A's and T's. This helps to
prevent mis-priming, when the primer matches with sequences of partial homology
during PCR.
Additionally, several types of polymerase can be employed to ensure more
stringent base-pairing during amplification. High fidelity polymerases such as Red Taq
polymerase (Sigma-Aldrich, St. Louis, MO), Biolase polymerase (Midwest Scientific, St.
Louis, MO), and Tjl polymerase can be used. Also, polymerases with proofreading
ability, such as Pfu polymerase (Stratagene, La Jolla, CA), are available for use in PCR.
Finally, PCR results can be verified through repetition ofPCR from the beginning
template to verify the reliability of previous results.
27
Various molecular methods have been used to study ancient DNA. In one
instance, cloning was performed on 23 mummies dating from 2370-2160 BC by Svante
Paabo (1985). DNA was extracted from dried tissues and blunt-ended with Klenow
fragment in the presence of trace amounts of radioactively-labeled nucleotides. The
reaction mixture was then run through a gel. Larger fragments were extracted and cloned
into the bacterial plasmid, pUC8. The clones were then transferred to nitrocellulose
fibers and probed with a radioactively labeled probe containing a member of the Alu
family of repetitive human sequences. The cloned inserts were then sequenced.
However, this cloning method was found to introduce errors into the ancient DNA. In
addition, the specificity of hybridization is reduced by the presence of chemical
modifications within the target DNA (Paabo 1985).
A more recently used method to study ancient DNA is the study of Y-
chromosomes. Y -chromosome analysis allows for information about population
relationships along with information about the paternal genetic contribution. Y-
chromosome analysis was used to study the origins of the Japanese and the origins of
Neolithic European farmers. In Y-chromosome analysis, male-specific DNA fragments
are amplified using PCR primers. The PCR products are sequenced and the individuals
are placed into Y -chromosomal haplogroups based on sequence analysis. This
information is then compared to information provided by maternal lineages. Through Y-
chromosome analysis, a paternal Asian haplotype was found providing evidence of a
paternal Asian contribution to northern European populations (Zerjal et al. 1997). This
method provides a comparison for samples on which mtDNA analysis has already been
performed and will probably become more prevalent in future studies.
28
Another method of studying ancient DNA is micro satellite analysis.
Microsatellites are nucleotide repeats, usually around 10 bp in length, that are highly
polymorphic throughout the genome. In one method of micro satellite analysis, ancient
DNA is amplified using peR primers to areas where the specific micro satellites being
used are more prevalent (micro satellites can be selected from previously published papers
or genome databases). The peR products are then run on gels, transferred to blots, and
probed with radioactively-labeled micro satellite probes. Polymorphisms are evident
between individuals when the probes hybridize to peR products of different sizes.
However, this method has not been found to be easily repeatable between laboratories.
An additional use for peR when working with a limited supply of irreplaceable
DNA is to create a library as described by Weiss et al. (1994) (Fig 6). In order to create
this library, ancient DNA is digested with a four-base specific restriction enzyme (which
is a frequent cutter, such as HaeIII) that produces a blunt end. Adaptors are then ligated
to the blunt ends of the digested fragments. Primers specific to the adaptors can then be
used in order amplify the fragments which were pooled to create a library. Lastly, a
second set of amplification can then be performed using primers specific to areas of the
mtDNA of interest for haplotyping.
Mitochondrial DNA Analysis
Properties of Mitochondrial DNA
The mammalian mitochondrial genome is 16,569 bp in length and encodes 13
proteins (Kiechle et al. 1999, Anderson et al. 1981). The mtDNA is double-stranded,
containing a light and a heavy chain. The light chain is the template for replication while
29
Figure 6: Library Construction Flowchart (adapted from Weiss et ale
1994). Steps in the library creation. (1) Ancient DNA template is digested with
the 4-base cutter restriction enzyme to create blunt ends. (2) A purchased,
double-stranded DNA adapter oligionucleotide is ligated to the blunt ends of the
digested DNA. (3) The ligated fragments are amplified using an oligonucleotide
that contains the sequence of the smaller adapter strand as a PCR primer. (4) The
library is ready for marker-specific PCR amplification.
30
s
..... ~ .
........................ MDNA
~ lone adapter
--"-"--,-,--"., . ,."'_111,. adapter annealing
'1,,,1,., __
~ .
denaturation ==_
Gene-specific primers
annealing
-IIIII1III.
extension
31
the heavy chain is the chain from which protein is transcribed. Most of these proteins are
involved in the electron transport system. Mitochondria are unusual in that all of the
rRNAs and tRNAs needed for mitochondrial translation are encoded for in the mtDNA
(Anderson et al. 1981). Four ofthe genes the mtDNA encodes are the genes for
cytochrome c oxidase subunit I (COl), COIl, ATPase, and cytochrome h. The other
proteins needed for mitochondrial replication are encoded in the nDNA, synthesized in
the cytosol, and imported into the mitochondria (Kiechle et aZ. 1999).
The origin of replication in the mtDNA occurs in the displacement loop (D loop).
The D loop, also referred to as the Control Region (CR) or First Hypervariable Region
(HVI), is the only region of the mtDNA where noncoding bases are prevalent (Anderson
et al. 1981). Because of this, most sequence divergence between individuals in the
mtDNA exists in this region.
Through advances in molecular techniques, it is now sometimes possible to
recover DNA from ancient skeletal remains. Although this DNA is most often highly
fragmented, it is usually possible to amplify revealing regions ofthe DNA using PCR.
The most successful, therefore most widely used, analysis of ancient DNA is
mitochondrial DNA (mtDNA) analysis. Although mtDNA represents only a small
percentage of the DNA in an individual, it is present in high copy number (Brown and
Brown 1992). Therefore, even though nDNA may be highly degraded, there is often
enough mtDNA still present in ancient DNA to be amplifiable. Thus, the use of mtDNA
as a template for polymerase chain reaction (PCR) increases the likelihood of successful
amplification.
32
Mitochondrial DNA has a high mutation rate. This ensures differentiation
between populations. The high mutation rate exhibited by mtDNA facilitates more
informative analysis than nuclear DNA (nDNA). This is due to the greater number of
nucleotide differences observed in the mtDNA when a nDNA and mtDNA sequence
strand ofthe same size are compared. In addition, the mtDNA is inherited maternally
(there is very little, ifany, recombination with the paternal mtDNA) permitting the
tracing of a maternal lineage. This means that mutations occur sequentially with time on
the mtDNA, in essence forming a biological recordbook.
Previously, it was thought that all children inherit maternal mtDNA, but only
daughters will pass that mtDNA on (Kiechle et al. 1999). However, one study has
accredited from one one-thousandth to one one-hundredth of mtDNA in an individual to
paternal mtDNA (Gyllensten et al. 1985). This paternal mtDNA was found to rarely
recombine with the maternal mtDNA. Both normal and mutated forms of mtDNA may
be inherited maternally (Kiechle et al. 1999).
Heterogeneity
Different forms ofmtDNA can exist within the same mitochondrion (Kiechle et
al. 1999). Heteroplasmy, the existence of both normal and mutated mitochondrial DNA
in a cell, was previously described in literature (Liang and Wong 1998). The opposite of
heteroplasmy, homoplasmy, means that a tissue only contains one form ofthe mtDNA,
normal or mutated. It has been found in recent studies that, contrary to what was
previously believed, homoplasmy is very unusual within an individual (Kiechle et al.
1999). Genetic heterogeneity does occur in mitochondrial DNA (Liang and Wong 1998).
Cell fusion studies have shown that at least two mitochondrial genotypes can
coexist in the same cell in vitro (Oliver and Wallace 1982). One study of bovine
mitochondrial D loops concluded that somatic and genn line mammalian cells are likely
significantly heteroplasmic (Hauswirth et al. 1984).
33
Mutations of the mtDNA usually occur more often and accumulate in eukaryotic
cells as aging commences. This heteroplasmy has been shown to occur at different rates
within an individual in different tissues. For example, one study showed that a set of
deletions occurred at a more rapid rate in skeletal muscle than in cardiac muscle
(Kopsidas et al. 2000). However, no study was found in which bone or dentin mtDNA
mutation rates were compared to other tissues.
The presence ofheterplasmic mtDNA in an individual's tissue can complicate
genetic analysis. When using PCR to ampli:fY heteroplasmic mtDNA, one fonn of the
mtDNA can be preferentially amplified over the other, especially if one sequence of
DNA is much more common than another. However, ifboth forms are amplified,
assigning an individual to a specific haplotype by restriction analysis of an amplified
region may be difficult. A study was perfonned that showed that single bands of mtDNA
PCR products could show sequence heterogeneity when they underwent restriction
analysis (Baumer et al. 1994).
Methods Used to Detect Heterogeneic mtDNA
In order to detect heteroplasmic mutations in mtDNA, multiplex PCR has been
perfonned to ampli:fY the area of mtDNA of interest. Then, probes to the mutant and the
normal fonn of the mtDNA were used in a dot blot. Binding of both the normal and
34
mutated probe indicated heterogeneity in the individual (Liang and Wong 1998). In order
to perform this procedure, however, the possible points of mutation would have to be
known to create the appropriate oligonucleotide probes.
Long PCR (XL-PCR) is another method that can be used in order to detect
heterogeneic mtDNA. The entire mtDNA chromosome can be amplified using XL-PCR.
Changes in the sequence length when XL-PCR is performed are indicative ofmtDNA
deletion or insertion mutations (Kopsidas et al. 2000). However, it is possible that the the
DNA may be altered in such a way, such as a point mutation, that size differences
indicative of heterogeneity would not be observed. This is a weakness of this PCR
technique. XL-PCR utilizes a Taq polymerase along with a proofreading polymerase
(such as Plu).
It has been reported that XL-PCR may preferentially amplifY shorter, deleted
mtDNA sequences over full-length mtDNA (Nagley and Wei 1998). There is also a
concern that XL-PCR may generate PCR artifacts that could be interpreted as deletions
(Lightowlers et al. 1999). However, a study addressing the previous concerns was
carried out. It indicated that the use ofXL-PCR to study mtDNA heterogeneity is
reliable if the PCR conditions are optimized, a proofreading enzyme is used, appropriate
controls are used, and good primer design is implemented (Kopsidas et al. 2000).
Mechanism for D Loop Replication
Heterogeneity is often found in a 5' homopolymer-rich region of the D loop. A
mechanism for generation of the heterogeneity has been suggested. In this model, a
primer or template "slips" in relation to its complement because of the presence of a
35
repeating nucleotide to which the primer can align (Fig 7). A DNA polymerase is then
able to generate insertions or deletions due to the slippage. Usually, between 2-6 extra
C's were inserted within a stretch of6 C's found at np 568-573 (Torroni et al. 1994a).
This resulting stretch ofC's is near to two 7-bp repeats at np 302-308 (designated box 1)
and np 567-573 (designated box 2). Box 2 was found to be responsible for the 270 bp
portion between box 1 and box 2 sometimes being replicated twice. This is thought to
occur when a newly synthesized box 2 (which after homoplasmic insertion ofC's
sometimes yields as many as 12 of 13 bp homologous with box 1) aligns with box 1 in
the template strand. In this manner, heteroplasmy in the D-Ioop region is and has been
created (Hauswirth et al. 1984, Torroni et al. 1994a).
Pseudogenes
Another source of difficulty in genetic analysis arises because there are
pseudogenes in the nuclear DNA (nDNA) that may be amplified using primers specific to
the mtDNA (Kiechle et al. 1999). nDNA sequences which are homologous to portions of
mtDNA have been found for almost the entire mtDNA genome. These homologous
regions are evidence of past and continuing evolutionary lateral movement of DNA
within cells. IfPCR is used to amplifY mtDNA and the nucleotide sequence is unusual or
if more than one band or more bands than expected are seen, it is a possibility that a
pseudogene and surrounding nDNA sequences have also been amplified (Hu and Tilly
1995). Other studies have proposed that the previously described heteroplasmic mtDNAs
were, in fact, derivatives of ancient mtDNA variants preserved as nuclear pseudo genes
(Wallace et al. 1997).
36
additional C's
w
Box 1
A
Dllit
,
Daughter light strand i

polymerization
Box 2
0"
B
I 1
,
1""1
-r-
ON
t
,
Mispairing of the newly
C
r= I
synthesized box 2 with
..
10
box 1 and extension
OR
t
, ,
D
J I
....
2 1":-

../ \..J
Next mtDNA replication
/
Loop excision

0"
2 t ,
2 i I liIIop'"l!UNlO'I
r:J
__ .-L ___ __ __
...
;z

l 2
Breakpoint
joI'( ? II Polymerization
and Ligation
Figure 7: D Loop Replication System Mechanism Model (Torroni
et al. 1994a). Hypothesized model of the origin ofthe 270-bp tandem
duplication in mtDNAs with the insertion of2-6 C's in box 2. During the
polymerization of the daughter light strand (thinner line), by use of the parent
heavy strand (thicker line) as a template (A), the newly synthesized box 2 with the
additional C's could pair with box 1 on the parental heavy strand (B and C). The
region between boxes 1 and 2 would then be copied twice (D). A wild-type
mtDNA molecule will be generated if the loop is excised. Otherwise, at the next
DNA replication, an mtDNA molecule with two copies of the 270-bp sequence
that are separated by an additional box 2 would be produced.
ON
,
37
Mitochondrial D Loop
The mtDNA displacement loop (D loop) is a 1,122 bp noncoding region of the
mtDNA in which the initiation of DNA replication occurs (Kiechle 1999). The D loop is
sometimes referred to as the first hypervariable region (HV1) (Stone and Stoneking 1999)
and is the most heterogeneic portion of the mtDNA (Kurosaki et al. 1993). Since no
functioning genes are present, the D-Ioop region is the most variable region of the
mtDNA in both its sequence and its length (Greenberg et al. 1983). Mutations within the
D loop are used to help define haplogroups (individuals grouped by mtDNA due to its
variability). Therefore, sequencing of the D loop is highly informative. It often provides
critical information on the origins of an individual.
NATIVE AMERICAN mtDNA HAPLOGROUPS
Development of American mtDNA Haplogroups
Previous genetic studies ofmtDNA have strongly implied that all modem Native
Americans derived from Asian ancestors. That some mtDNA polymorphisms are
specific to a continent has turned out to be very useful for the purposes of identifying
human origins. For example, the first clear evidence that mtDNA variation correlated
with the geographical origin of an individual came from studies on African mtDNAs.
They showed that roughly 70% of all sub-Saharan African mtDNAs contained a single C
to T base change at mtDNA np 3594. This base change defines the most common
African mtDNA haplogroup, which is designated Haplogroup L. In other words, all
individuals that contain the np 3594 C to T mutation in their mtDNA belong to
38
Haplogroup L. The np 3594 polymorphism (and thus Haplogroup L) is essentially
unique to Africa and thus allow for a rapid assignment of an individual to Africa based on
mtDNA analysis (Batzer et al. 1994)
Most ofthe planet's major population groups (Africans, Asians, Caucasians,
Native Americans) are comprised of only a small number of mtDNA haplogroups which
are typically unique to that group. There is very little overlap between the groups.
Analysis of over 800 Native American mtDNAs from North, Central, and South America
has identified only 5 founding mtDNA haplogroups. These haplogroups are
characterized by the presence or absence of polymorphisms within mtDNA genes (Fig 8).
They have been designated as haplogroups A, B, C, D, and X. Together, these five
haplogroups account for roughly 98% of all Native American mtDNA. However,
mtDNA haplogroups are not found homogeneously among specific Native American
groups (Fig 9). Rather, one haplogroup is usually predominant within a group while
other haplogroups are also present.
Haplogroups A, B, C, and D have also been identified among modem Asians
(Lorenz and Smith 1996). Haplogroup X is rarely found in Asians but is often found in
Europeans. There are 10 mtDNA haplogroups assigned to Europeans: H, I, J, K, M, T,
U, V, W, and X. They account for nearly 98% of European-derived mtDNAs. A
summary ofthe polymorphisms which characterize each Native American mtDNA
Haplogroups is shown in Table 1.
Haplogroup A is characterized by the presence of a HaeIII restriction site at np
663 (Lorenz and Smith 1996, Schurr et al. 1990, Torroni et al. 1993a). Haplogroup A is
the most common haplogroup found in Native Americans. In addition, it is the only

DNA
9-bp deletion
39
Figure 8: Diagram of Native American mtDNA
Polymorphism Locations (Stone and Stoneking 1993) Human
mtDNA genome, showing the approximate location of four of the mtDNA
markers that delineate contemporary Native American mtDNA lineages.
Gene abbreviations: 12S rRNA, 12S ribosomal RNA gene; N2 and N5,
subunits 2 and 5 ofNADH-dehydrogenase, respectively; COIl, subunit II
of cytochrome oxidase; and lys tRNA, lysine transfer RNA gene.
Arctic/
Subarctic
UtD
.5
f ABC 0
Northwest

,$ _____ J
o A Be Q '
- ,'-.,... -- .
,.on
':1l .J
A seD
"':.'
Figure 9: Distribution of mtDNA Haplogroups Among Native
Americans (Lorenz and Smith 1996). Frequency distributions of 4 ofthe
Native American mtDNA haplogroups (Haplogroups A, B, C, and D) by
geographic regions.
40
Table 1: Polymorphisms which Characterize Each
Native American mtDNA Haplogrou
41
MtDNA
Lineage
(Ha logroup)
9-bp Deletion Haell-663 AluI-5176 Hincll-13259
A + + +
B + + +
c +
D +
x + +
haplogroup found in the Arctic/Subarctic region (Lorenz and Smith 1996). This
haplogroup is also commonly found in the Han Taiwanese (Torroni et af. 1994b).
Haplogroup B is characterized by the presence of a 9-bp deletion at np 8272
(Lorenz and Smith 1996, Schurr et al. 1990, Torroni et af. 1993a). It has been reported
that the Southwest Native American groups have the greatest frequency of Hap log roup B
(Lorenz and Smith 1996). Haplogroup B is almost entirely absent in the northern Native
American groups. This haplogroup is also found in modern Asian, Melanesian, and
Polynesian groups (Torroni et af. 1994c).
Haplogroup C is characterized by the presence of an AfuI site at np 13,262 and the
loss ofa HincH site at np 13,259 (Lorenz and Smith 1996, Schurr et al. 1990, Torroni et
af. 1993a). Haplogroup C occurs at a frequency of about 17% in North American Native
Americans (Lorenz and Smith 1996). Haplogroup C is also found at high frequencies in
the Aboriginal Siberian populations (Torroni et at. 1993b).
Haplogroup D is characterized by the absence of an AfuI site at np 5176 (Lorenz
and Smith 1996, Schurr et al. 1990, Torroni et af. 1993a). In addition to Native
Americans, haplogroup D is found in numerous Asians and Siberians.
42
Haplogroup X is characterized by the creation of HaelII restriction sites at np
16223 and 16278 in the D-Ioop region along with the loss of a Ddel restriction site at np
1715 (Stone and Stoneking 1999, Brown et aZI998). Haplogroup X has been found
primarily in northern Amerindian groups of the North American plains. Unlike the more
common Native Amerian haplogroups A, B, C, and D, Haplogroup X appears to be
absent in northeastern and eastern Asia (where the origin for the remainder of the Native
American haplogroups has been assigned). Haplogroup X is also found in low
frequencies (about 4%) in modem European populations (Brown et aZ. 1998).
Thus, this mtDNA lineage is found in Europe and the Americas, but not in Asia. This
implies the possibility that some Native American founders were of Eurasian ancestry
(Stone and Stoneking 1999).
European Haplogroups
Haplogroup H does not have the Ddel site at np 10394 while Haplogroups I-K
have this site at this position (Torroni et aZ. 1994a). Haplogroup H, which also lacks an
AZul site at np 7025, represents 40% ofall Caucasians (Torroni et aZ. 1994a). The
markers which define Haplogroup H have rarely been found in Africans or Asians.
About 7 Ya % of all Caucasians belong to Haplogroup I. Haplogroup I is found to
a greater extent in Northern Europeans. This haplogroup has the np 10394 Ddel
restriction site. In addition, it is characterized by G to A transition at np 1629, 16223,
and 16391 in the D loop, a HaeIII site loss at np 4529, a Ddel site loss at np 1715, anAZul
site gain at np 10028, and an AvaIl site gain at np 8249 (Torroni et al. 1994a).
"\
~ - - ~ --. -... ~ -. - - ; - ~ ~ - : .. - - ~ -. :.. .. ~ --- ---
About 9% of all Caucasians fall into Haplogroup J. Haplogroup J has the DdeI
restriction site at np 10394. In addition, it is characterized by a BstNI site loss at np
13704 and a HinjI site loss at np 16065 (Torroni et al. 1994a).
43
About 7 ~ % of all Caucasians belong to Haplogroup K. Along with the presence
of the DdeI site at np 10394, Haplogroup K is characterized by a HaeIII site loss at np
9052 (Torroni et al. 1994a).
- - - - - - . ; ~ - - . - - ~ . - - ~ - - . -- - -.- y y- -
MATERIALS AND METHODS
SAMPLE
A tooth belonging to the Beothuk chief, Nonosabasut, was obtained from the
Royal Museum of Scotland. W.E. Cormack obtained the skull containing the tooth in
1826. It was presented to Dr. Jameson in 1921 and eventually placed in the Royal
Museum of Scotland.
In order to rid the tooth of surface contaminants, the following procedure was
performed. The tooth was washed in a 10% bleach solution for 2 min. It was then rinsed
in RNase- and DNase-free water for 3 min. The outside of the tooth was irradiated with
ultraviolet light (260 run) for 7 min (Ribeiro-Dos-Santos et al. 1996).
Dr. Neal Lambert, DDS powdered the remaining dentin of the tooth (a previous
drilling had been performed on the tooth). Dr. Lambert washed the burr used for the
drilling in alcohol and autoclaved it. Dr. Lambert wore powder-free gloves, a long-
sleeved lab coat, and a face mask while drilling the tooth. The integrity of the crown
remaining was maintained. Dr. Lambert stated that the enamel of the tooth was worn
completely off in some spots.
Precautions Taken When Working With the Ancient DNA
Several precautions were taken when working with the Beothuk DNA in order to
prevent contamination. From the time the tooth was drilled, only one individual handled
the tooth or any of the reagents involved in the research. That individual's D loop was
sequenced for comparison with the Beothuk sequence to confirm that there was no
contamination.
45
Negative control extracts were carried throughout the entire process. If
contamination was seen in the negative control, all results were considered suspect.
Reagents such as molecular grade water and the PCR lOX buffer were irradiated with
UV light (260 nm) for 15 min along with pipettemen, pipette tips, and all tubes used.
Gloves were worn at all times when working with the ancient DNA. In addition, hair was
pulled back and a long-sleeved lab coat was worn at all times. Separate pipettemen were
used for negative controls. Pipette tips had aerosol barriers and were set aside for ancient
DNA research.
DNA Extraction
The powdered dentin was first preincubated overnight in a soaking solution of
proteinase K (Promega, Madison, WI). The proteinase K was reconstituted in 50 mM
Tris-HCI (PH 8.0) and 10 mM CaCh (calcium chloride). The overnight soaking solution
composed of 5 mL of 0.5 M EDTA (PH 8.0), 200 f-lL of 10% SDS, and 200 f-lL of20
mg/mL proteinase K. The powdered dentin was rotated at 37C overnight in the
overnight soaking solution. It was then placed in a 65C water bath for 15 min to
inactivate the proteinase K.
DNA was extracted from the dentin using the GENECLEAN Kit for Ancient
DNA (Bio 101, Vista, CA). In parallel to the extraction, a negative control was
performed in which the same procedures were carried out without the powdered dentin.
46
One rnL of the Dehybridization A solution from the GENECLEAN Kit for Ancient DNA
was added to the tooth/proteinase K solution. It was rotated for 2 ~ hr at 60C. The
sample was then centrifuged at 14,000 x g for 5 min in order to pellet the particulate
material. The supernatant was transferred to a new micro centrifuge tube and 1.2 mL
glassmilk: and 3 mL Dehybridization A solution were added. The sample was then
rotated at 37C for 2 hr. The samples were centrifuged for 1 min at 5,000 x g in order to
pellet the Ancient DNA Glassmilk containing the DNA. The supernatant was discarded
and 0.5 mL of Salton Wash #1 was used to resuspend the pellet. The suspension was
then transferred to a Spin Filter and centrifuged at 14,000 x g in order to clean the
Glassmilkl DNA complex. A second wash was performed in the same manner using 0.5
rnL of Salton Wash #2.
In order to ensure a clean product, a 1: 1 acetone:ethanol wash was performed that
was not called for in the GENECLEAN Kit for Ancient DNA protocol (Sambrook and
Russell 2001). Then, 0.5 rnL of Ancient DNA Alcohol Wash was added and the solution
was centrifuged. The Glassmilk Spin Filter was dried by additional centrifugation. The
dry filter was placed into a new microcentrifuge tube and 50 ~ L of DNA-free Elution
Solution was added to the filter. The pellet was resuspended by a 2 s vortex. The tube
was centrifuged for 1 min to transfer the eluate to a catch tube. An additional 50 ~ L of
the Elution Solution was heated and added to the filter. Centrifugation ensured complete
elution ofthe DNA. The two 50 ~ L eluates were combined to create eluate #1. A third
elution was then carried out using 1 00 ~ L heated Elution Solution to create eluate #2.
Eluates # 1 and #2 were stored at -20C.
-- -- _ __ ~ . r - ~ _ ~ ~ . _ - ~ . .._. _ ._
47
Library Creation
The library was created as descnbed in Weiss et al. 1994 as follows:
Digestion
The DNA extracted from the sample was digested in order to create blunt -ended
DNA for ligation with the blunt-ended adaptors. A parallel procedure was performed on
the negative control from the DNA extraction. The reaction mixture consisted of 100 flL
of the DNA from eluate #1, 11.3 fLL of the lOX buffer provided with RsaI, and 1.5 fLL
of 10 U/fLL (15 U total) RsaI (New England Biolabs, Beverly, MA). The total reaction
volumes of 113 fLL were incubated overnight in a 37C water bath to insure complete
digestion. The reactions were then inactivated at 65C for 20 min. This was done to
prevent the RsaI from re-digesting the DNA and, thus, preventing the adaptors from
ligating.
A second library was needed in order to amplifY areas of the mtDNA (containing
the markers of interest) that, it was determined from the Cambridge reference sequence
(Anderson et al. 1981), had RsaI restriction sites. A parallel procedure was performed
with the negative control from the DNA extraction. Therefore, eluate #2 was digested
with HaeIII (New England Biolabs). The reaction mixture consisted of 100 fLL of eluate
#2, 11.3 fLL of the lOX buffer provided with the HaeIII, and 1.5 fLL of 10 UI fLL HaeIII
(15 Units total). The DNA was digested overnight at 37C. The HaeIII was inactivated
at 80C for 20 min. The eluate were not quantitated because most of the material would
have been lost during quantitation.
-
-- ~ - ~ - . . . - - ~ - - ~ -
48
Ligation
Two single-stranded, complementary oligonucleotides, LLSa12A and LLSa12B
(5'-pTCGAGTCGACTATATGTACC-3' and 5'-pGGTACATATAGTCGACT-3',
respectively) described by Weiss et al. 1994 were purchased (Integrated DNA
Technologies, Inc. Coralville, IA) that, when annealed, became double-stranded blunt-
end adaptors with a three nucleotide overhang on one side. The oligonucleotides were
purchased phosphorylated on the 5' end in order to block the ligation of the adaptors to
themselves. In addition, the phosphorylation would aid in the ligation of the blunt-ended
adapters to the blunt-ended fragments. The single-strand oligonucleotides were added in
equal portions (10 f-LL each) to a microcentrifuge tube. They were placed in an 80C
water bath for 5 min. The water bath was removed from the heat and allowed to slowly
cool to room temperature. This allowed the single-stranded oligonucleotides to anneal to
each other to form double-stranded adaptors with a protruding, phosphorylated 5' end
and a blunt end for ligation with the blunt-ended (digested) DNA
The blunt-ended DNA and the separate negative control was ligated to the blunt-
ended adaptors using T4 DNA Ligase (New England Biolabs). Fifty f-LL of the RsaI or
HaeIII-digested DNA (or the corresponding negative controls) were placed in a
micro centrifuge tube with 2 f-LL of adaptors (final concentration of each of the primers
was 0.5 mglmL), 6 f-LL 10X buffer with ATP provided with the T4 DNA Ligase and 2
f-LL ofthe 400 VI f-LL T4 DNA Ligase (800 Vnits total). Ligation was performed at room
temperature for 15 min, at 15C for 2 Y2 hr, and then at 4C overnight in an effort to
maximize ligation of adaptors.
Library Amplification
In order to amplifY the entire hbraries prior to haplotyping, DNA fragments with
the adaptors ligated to them were amplified using the shorter single-stranded
oligonucleotide, LLSa12B. Again, a parallel procedure was performed on the negative
controls. The 100 pL PCR reaction mixture contained 20 J1L of the ligated material, 10
J1L of the 10 X buffer provided by the manufacturer, 5 J1L of 50 mM MgCh, 2 uM:final
concentration ofLLSal2B, 2 J1L of 12.5 uM dNTP master mix, 1.0 mL of 100 X BSA, 4
Units ofBiolase Red Taq polymerase (Midwest Scientific, St. Louis, MO), and
autoclaved molecular grade water to volume. Master mixes (excluding the polymerase
and nucleotides) were made in order to ensure consistency between samples. A second
master mix containing the heat-sensitive polymerase and nucleotides was added after an
initial hotstart of 5 min at 94C in a Perkin Elmer 2400 Thermal Cycler. PCR conditions
were as follows: 30 cycles of 94C for 30 s, 53C for 1 min, 72C for 2 min and, finally,
72C for 7 min. Twenty J1L of each PCR product was electrophoresed on a 3.5%
agarose gel in 1 X TBE prestained with 2.5 J1L of 1 mg!mL ethidium bromide (EtBr) in
order to determine if the library had amplified. The remaining 80 J1L of each sample
was stored at -20C until needed for haplotyping.
Ethanol Precipitation
An ethanol precipitation was performed on the ligated material due to what
appeared to be excess salts observed in the gel analysis of the PCR products. Two
49
50
volumes of cold 95% ethanol and 1110 volume of3 M sodium acetate (pH 5.4) was
added to each ligation mixture. The mixture was placed in a -70C freezer for 20 min.
The mixture was spun at 14,000 x g until the DNA pelleted. The supernatant was poured
off and the pellet was allowed to dry completely (about 10 min). The pellet was
resuspended in 50 f-LL of molecular grade water. Ten f-LL of the ligated, ethanol-
precipitated DNA was used as template to repeat the PCR to amplifY the hbrary. The
remainder ofthe ethanol-precipitated DNA was stored at -20C.
Additional Library Purification
Two additional methods of purification were used on the amplified library to
remove excess buffer (salts), nucleotides, and primers that would have interfered with
subsequent amplifications. A kit already available in our laboratory, Wizard PCR Preps
DNA Purification System (Promega, Madison, WI), and a newly purchased product,
Microcon PCR (Millipore, Bedford, MA) were both used.
The library amplification products were originally cleaned with the Wizard PCR
Prep. The entire PCR product (50-100 f-LL) was added to 100 f-LL of Direct Purification
Buffer in a 1.5 f-LL micro centrifuge tube. One mL of the resin was added and the mixture
was vortexed 3 times over 1 min. A 30 cc syringe barrel was attached to a Wizard
minicolumn. The resin and PCR product mixture were pipetted into the syringe barrel
and slowly pushed through the minicolumn. The syringe was detached and the plunger
removed. The barrel was then reattached to the minicolumn. Eighty percent isopropanol
was added to the barrel and slowly pushed through the minicolumn using the syringe
plunger to rinse the DNA adhered to the resin. The minicolumn was removed and
51
transferred to a clean 1.5 mL microcentrifuge tube. Then 50 pL of molecular grade
water was added to the minicolumn. After waiting 1 min, the minicolumn was
centrifuged at 10,000 x g for 20 s to elute the bound DNA fragments. The purified
amplified horary was used in a subsequent gene-specific amplification or stored at -20C.
Microcon PCR was used in order to purifY and concentrate PCR products rather
than the Wizard PCR Purification Prep after contamination was observed in subsequent
PCR negative controls and poor sequencing results were obtained. The Microcon PCR
column was placed in a 1.5 mL micro centrifuge tube. The PCR product and 400 ILL of
molecular grade water were placed in the sample reservoir. Additional water was added
to bring the total volume up to 500 ILL. The column and tube with the sample were spun
in a centrifuge at 1000 x g for 15 min. The column was removed from the tube, inverted,
and placed in a clean 1.5 mL microcentrifuge tube. Twenty ILL of molecular grade water
was added to the reservoir without touching the membrane surface. The column and tube
were centrifuged at 1000 x g for 2 min. One ILL of the cleaned, concentrated PCR
product was then used for subsequent gene-specific PCR amplification or for sequencing.
The remainder ofthe PCR product was stored at -20C.
ANALYSIS OF NATIVE AMERICAN MARKERS
Marker-Specific Amplification
A hierarchical strategy was employed in order to analyze the mtDNA of the
Beothuk chief The most definitive sites for Native Americans were looked at first.
These sites included the HindI site at np 13259, the AZul site at np 5176, the HaeIII site
52
at np 663, and the 9-bp deletion in the gene for subunit II of the cytochrome oxidase. In
addition, the D-Ioop region, where most heterogeneity is seen was amplified.
When testing for Caucasian- European mtDNA haplogroups, the 7025 AZul
restriction site was examined first. The absence of the site in large part defines Caucasian
Haplogroup H (the most common mtDNA haplogroup in European-derived populations).
Haplogroup H is found in about 40% of all modem Europeans and North American
CaucaSian. In addition, it is the most common mtDNA haplotype found in ancient
Basque samples.
All of the Native American primer sequences are shown below in Table 2. The
D-Ioop and the European Alul-7025 primer sequences were designed using the primer
Table 2: Primers and primer sequences used to analyze the
mtDNA markers in the Beothuk chief
Marker Primers 5'->3' Sequence
9bp-deletion 9bpLI ACAGTTTCATGCCCATCGTC
9bpH
I
ATGCTAAGTTAGCTTTACAG
HincII-13259 HincIIL
l
CCCTTACACAAAATGACATCAA
HincIIH
2
TCCTATTTTTCGAATATCTTGTTC
HaeIII-663 HaeIIIL
l
ACCTCCTCAAAGCAATACACTG
HaeIIIH2 GTGCTTGATGCTTGTTCCTTTTG
AluI-5176 AlulL
l
TAACTACTACCGCATTCCTA
AluIH
2
GTGCTTGATGCTTGTTCCTTTTG
D Loop* L15997 CACCATTAGCACCCAAAGCT
H16401 TGATTTCACGGAGGATGGTG
AluI-7025* 7025L ACATCGTACTACACGACACGT
7025H GGCGTAGGATTGGACTAGGGT
IL denotes a primer to the light chain of the mtDNA,
while H denotes a primer to the heavy chain.
2Primer sequences taken from Stone and Stoneking 1993
Those primers with an * were designed in our laboratory using the
Integrated DNA Technologies website (www.idtdna.com)
53
design program on the Integrated DNA Technologies website (www.idtdna.com). The
Cambridge mtDNA sequence was used as reference sequence (Anderson et al. 1981).
When possible, primers were designed that were between 18-25 bp long, had about 50%
GC content, had annealing temperatures between 45 and 60C, did not form primer
dimers, did not form hairpin loops, had more G's and C's at the 5' end and more T's and
A's at the 3' end. In addition, the primer pair had annealing temperatures within 5 of the
each other. Lastly, the area of the mtDNA being amplified had to be free of either HaeIII
or RsaI restriction sites.
Four PCR reactions were set up in order to amplify regions of the Beothuk
mtDNA containing the Native American markers that were less than 250 bp long. In
addition, a PCR reaction was set up to amplify a 440 bp portion of the D loop. The initial
reactions were performed as described in Stone and Stoneking 1993. The 100 J-LL PCR
reactions contained 5 J-LL of the appropriate cleaned library (Table 3), 10 J-LL ofl0 X
buffer supplied with the polymerase, 2.5 mM:final concentration of the dNTPs, 40
pmoles each primer, 1 J-LL 100 X BSA (New England Biolabs), 5.0 J-LL 50 mM MgCh,
2.0 Units of Red Taq polymerase (Sigma-Aldrich, St. Louis, MO), and molecular grade
water to volume.
TabJe 3: The library used for amp1i1ication of each Native American mtDNA marker
mtDNA Marker Library
HaeIII-663 RsaI library
AluI-5176 RsaI library
9-bp deletion RsaI library
HincII-13259 HaeIII library
D-Ioop region HaeIII library
54
A master mix ofthe lOX buffer, MgCh, BSA, and water was made in order to
ensure consistency. The negative controls for each library were carried throughout the
extraction and hbrary creation process. The samples were placed in the Perkin-Elmer
2400 Thermocycler for 30 cycles of denaturation at 94C for 1 min, annealing at 50C for
1 min, and elongation at 72C for 1 min. A:final elongation at 72C for 7 min was then
performed.
Each PCR reaction required optimization in order to initially obtain PCR products
and then to increase specificity. A series of reactions were performed in which the
following PCR reaction conditions were optimized: MgCh concentration, primer
concentration, amount of polymerase, type of polymerase, amount of template, and
thermo cycling conditions. The following conditions were varied in order to optimize the
thermocycling conditions: presence/absence and length of time ofthe hot start,
lowering/raising annealing temperature, and single annealing temperature versus
touchdown, a PCR reaction in which annealing temperature drops from highly stringent
to less stringent during the PCR reaction.
The final, optimized thermo cycling conditions for the D loop and Native
American mtDNA markers are listed in Table 4. The library templates were reamplified
and cleaned as needed. The final, optimized 100 J-LL PCR reaction for the amplification
of the mtDNA markers was 5 J-LL library template, 10 J-LL lOX buffer supplied with the
polymerase, 5' J-LL 50 mM MgCh, 2 J-LL 50 X dNTP Master Mix (250 J-LM final
concentration), 1 J-LL 10 mglmL BSA, 0.4 J-LM each primer, 4 Units Biolase Red Taq
polymerase, and autoclaved, molecular grade water to volume.
55
Table 3: Final Thennocycling Conditions for the D loop and
Native American Marker Amplification
Marker Hotstart Touchdown Cycling Final
Extension
HincII- 94C for None 94C for 30 seconds 72C for 7
13259 5 minutes 48C for 1 minute minutes
72C for 2 minutes
for 40 cycles
AluI-5176 94C for 94C for 30 seconds 94C for 30 seconds 72C for 7
5 minutes 66->47C (-1 oC) 48C for 1 minute minutes
for 1 minute 72C for 2 minutes
72C for 2 minutes for 30 cycles
for lO cycles
HaeIII-663 94C for None 94C for 30 seconds 72C for 7
5 minutes 54C for 1 minute minutes
72C for 2 minutes
for 40 cycles
9-bp 94C for 94C for 30 seconds 94C for 30 seconds 72C for 7
deletion 5 minutes 57->48C (-loC) 47C for 1 minute minutes
for 1 minute 72C for 2 minutes
72C for 2 minutes for 30 cycles
for lO cycles
Dloop 94C for None 94C for 30 seconds 72C for 7
5 minutes 54C for 1 minute minutes
72C for 2 minutes
for 40 cycles
An initial hotstart of 94C for 5 minutes was used. A second master mix ofthe
polymerase and dNTPs was added to each reaction after the hotstart. The tubes were
cooled to 4C, removed from the thennocycler, and spun in a centrifuge briefly before the
second master mix was added. This was done in order to avoid cross-contamination of
the samples. In addition, aerosol-barrier tips and a separate pipetteman for the negative
controls only were used.
56
There was a problem with contamination in the negative controls at one point of
time in the process of optimization. However, this contamination was traced through the
process of elimination (new reagents, new molecular grade water, and new primers) back
to the Wizard PCR Purification Prep Kit. After the contamination was traced, a new
method, previously described, employing the use of Micro con PCR devices was used to
clean and purify PCR product. Due to the contamination, the remaining ligated material
was amplified to create new hbraries. The contaminated libraries were disposed of The
new libraries were then successfully used as templates for the marker-specific
amplification.
Gel Analysis of peR Products
The PCR products were electrophoresed on a 3.5% NuSieve 3: 1 agarose gel
(FMC Bioproducts, Rockland, ME) in 1 X TBE. NuSieve 3: 1 is a high-resolution gel
suggested for analysis oflow molecular weight products. The manufacturer suggested a
3.5% gel for products in the 100 bp range. Fifteen fLL of each PCR product was mixed
with 3 fLL 6 X sample buffer and loaded in the gel. A 100 bp ladder (0.5 fLg)
(Invitrogen, Carlsbad, CA) was used as a molecular weight and concentration reference.
The gel was electrophoresed in 1 X TBE [40 mM tris-borate, 1mM EDTA] at 50V until
the blue tracking dye was three-quarters of the way down the gel.
The gel was post-stained in 60 mL of 1 X TBE and 6.0 fLL of 10,000 X GelStar
(FMC Bioproducts, Rockland, ME) for 20 min. The gel was rinsed in tap water. A
photograph of each gel was taken using a transilluminator and UV light at 260 nm.
57
RFLP Analysis
After the mtDNA of interest was amplified, restriction digests were performed on
the amplified products containing the markers HaeIII-663, HincII-13259, and AluI-5176.
This was performed in order to determine if the markers contained the definitive
restriction sites. Initially, the peR products were digested without purifying as described
in Stone and Stoneking 1994. Later, the peR products were purified using the Microcon
peR device in order to remove the excess salts, dNTPs, and primers from the mixture.
This was done in order to prevent these contaminants from interfering with the complete
digestion of the peR products.
Several steps were taken in order to ensure complete digestion. All of the
digestions were performed overnight. An excess of restriction enzyme was used in each
reaction. Each digestion was repeated at least 3 times. Along with each digestion, a
control was performed in which all of the components of the restriction digest were
present except for the restriction enzyme. This was to ensure that the cutting was not
occurring due to contamination of a buffer or water. Although the peR products were
purified using the Microcon peR device, BSA was added to the digestion to prevent the
interference of any contaminant in the cutting action of the enzyme.
The digestion conditions for all of the RFLP analyses are listed in Table 5. The
HaeIII -663 product was digested with HaeIII. The HincII -13259 product was digested
with HincH in one reaction and AluI in another reaction. The AluI digestion was
performed because the mutation responsible for the HincII site loss (an A to G
substitution at np 13263) creates an AluI-13262 site gain (Stone and Stoneking 1993).
The AluI-5176 product was digested with A luI.
Table 5: Digestion Reaction Conditions for
RFLP Analysis of Native American Markers
15.0 fLL cleaned PCR product
2.0 fLL 10 X buffer supplied by manufacturer
0.2 fLL 10 mglmL BSA
2.0 fLL of appropriate 10 UI fLL restriction enzyme
0.8 fLL autoclaved molecular grade water
20.0 fLL total volume
* All digestions were performed overnight at 37C
Sequencing
58
The PCR products (except AluI-5176) were sent to Davis Sequencing (Davis, CA)
to be sequenced in order to verify the validity ofthe RFLP results, or, in the case ofthe
D-Loop region PCR products, to obtain sequence results. The initial PCR products were
cleaned and concentrated using the Microcon PCR device before sequencing.
Re-Amplification of peR Products from Agarose Gel
In some cases, sequencing ofPCR products was not possible due to multiple
signals. Therefore, an attempt was made to extract a small portion ofthe band containing
the marker of interest from the gel and reamplify it for sequencing in order to obtain a
59
clearer signal. The PCR products were run on a 1 % Low Melting Point (LMP) agarose
gel (FMC Bioproducts, Rockland, ME) in 1 X TAE [40 mM tris-acetate, 1mM EDTA].
The gel was run in a cold room at 50 V in order to keep it from melting. The end of a
1000 ILL pipette tip was cut off. The tip was then pushed into the band of interest in the
gel. A plug of agarose containing the product of interest was drawn up into the tip and
released into a microcentrifuge tube. Fifty ILL of 1 X TE was added to the plug. The
tube was then heated to 65C for 5-10 minutes (until melted). Twenty ILL of the melted
solution was used as template for a duplicate PCR reaction. The new PCR products were
analyzed by gel electrophoresis.
GenElute Minus EtBr Spin Columns
When the previous approachs yielded poor results, all subsequent PCR products
that were to be sequenced were prepared in a different manner. Forty ILL ofthe PCR
product was electrophoresed on a 1 % Low EEO Agarose Gel (Midwest Scientific) in 1 X
T AE. The band of interest was cut from the agarose using a sterile scalpel. A GenElute
Minus EtBr Spin Column (Sigma-Aldrich, St. Louis, MO) was prepared by adding 100
ILL of 1 X TE to the column, placing the column in a 1.5 mL micro centrifuge, and
performing a 5 s spin at 14,000 x g in a centrifuge. The column was then removed and
placed into a new 1.5 mL micro centrifuge tube. The extracted agarose containing the
band of interest was placed in the prepared column. The device was centrifuged at
14,000 x g for 10 min to elute the DNA and the column was thrown away. DNA in the
eluate was subsequently sequenced.
60
After analysis of the Native American markers was completed, the European
marker AluI-7025 was amplified using the primers listed in Table 1. The HaeIII lIbrary
was used as a template. Amplification was carried out using the optimized PCR reaction
for the other markers. The thermocycling conditions used are listed in Table 6. The PCR
product was then extracted from the gel using the GenElute Minus EtBr Spin Columns
previously described. The cleaned PCR product was sent to Davis Sequencing to be
sequenced.
Table 6: Final thermo cycling Conditions for the
AluI-5176 mtDNA Marker Amplification
Marker Hotstart Cycling Final Extension
AluI-5176 94C for 94C for 30 seconds 72C for 7 minutes
5 minutes 54C for 1 minute
72C for 2 minutes
for 40 cycles
AMPLIFICATION AND SEQUENCING OF INVESTIGATOR'S D-
LOOP REGION
After all ofthe PCR work was finished with the Beothuk DNA, a sample of the
investigator's cheek cells was taken. A sterile toothpick was used to scrape the inside of
the cheek. The cheek cells were then place on the triangle of an IsoCode Stix (Schleicher
& Schuell) where the triangle was allowed to dry for 10-15 min. The triangle was then
placed in a 1.5 mL microcentrifuge tube with 500 fLL of distilled water using the cap of
the tube to break off the triangle. The tube was vortexed 3 times over 6 s in order to
remove any PCR inhibitors. The triangle was then removed from the micro centrifuge
tube (any excess water was wrung from the triangle by twisting the triangle around the
tweezers and pushing against the inside of the micro centrifuge tube) and placed into a
PCR tube containing the first master mix previously used for amplification of the
Beothuk D loop. This was performed using isopropanol and flame-sterilized forceps.
61
The triangle and master mix were heated to 95C in a thermo cycler for 30 minutes
in order to elute off the DNA. The PCR reaction was then cooled to 4C, removed from
the thermo cycler, and centrifuged. The second master mix containing the nucleotides and
the polymerase was pipetted into the mixture. The PCR reaction was then replaced in the
thermo cycler and the cycling was performed as with the Beothuk D loop.
The PCR product was analyzed by gel electrophoresis. A one percent Low EEO
Agarose gel in 1 X T AE stained with 0.5 ILL of 10 mg/rnL EtBr was run at 90 V for 25
minutes. The resulting PCR product band (about 420 bp) was cut from the gel using a
sterile scalpel. The PCR product was eluted from the agarose using the Gene1ute EtBr
Minus Spin Column described previously. The cleaned PCR product was then sent to be
sequenced.
CONSTRUCTION OF mtDNA HAPLOTYPE CHARTS
Throughout the process of this study, two charts were created using EXCEL
(Microsoft Office 2000), which compiled mtDNA data from previously published
research since the data in the published research was not reported in a consistent format
(the papers the data was compiled from are marked with a superscript letter in the
Reference section that refers to the letter representative in the chart reference column).
This made it difficult to glean information needed from the papers. These charts were
created in order that the results ofthe Beothuk mtDNA analysis could be readily
compared to previous findings when the analysis was finished. The charts were also
created for eventual use by other groups in the laboratory who are performing mtDNA
analysis on additional Native American groups.
62
All of the markers reported in the published reports were converted to a format in
which a "1" denotes the presence of a restriction site (or presence of the 9-bp deletion),
and a "0" denotes the absence of a restriction site (or absence of the 9-bp deletion). D
loop sequences were reported in this same form (as having or not having restriction sites
at certain nucleotide positions) in this chart (Appendix A). In a second chart, some D
loop sequences were entered as reported differences from the Cambridge (Anderson et a.1
1981) sequence (Appendix B). In all cases, a reference to the paper and the haplotype
and/or haplogroup assigned were entered also. In addition, after the mtDNA analysis was
completed, the Beothuk sequence was entered. All markers in the chart in common with
the Beothuk were highlighted. Ifa marker was not looked at for an entry, a "-" or a blank
space was entered (Appendices A & B, attached as a disk).
RESULTS AND DISCUSSION
POWDERING OF THE DENTIN
We were able to obtain 172 mg of powdered dentin from the previously drilled
Beothuk tooth. We had hoped to obtain 116 to 113 of the beginning tooth material. We
began with 1479 mg of material. Therefore, with the second drilling, we were able to
obtain only about 118 to 119 of the beginning material. The tooth had split at a fracture
during the previous drilling. However, we were able to maintain the integrity of the
crown remaining during the second drilling.
GEL ANALYSIS OF LIBRARY AMPLIFICATION
After the libraries were amplified, the peR products were run on a 3.5% agarose
gel in 1 X TBE with 2.5 fJ.L of 1mg/mL ethidium bromide (EtBr) in order to determine if
the library had amplified (Fig 10). Although we expected to see a broad smear of
different sizes of amplified fragments, this was not clearly seen. This suggested that
sufficient amplification had not occurred. In addition, spreading of the bands near the
bottom of the lanes with samples of amplified material (lanes 2, 3,5, & 6) was apparent
but not seen in the molecular weight marker lane (lane I), suggesting excessive salt was
present. Therefore, an ethanol precipitation was performed. The library was reamplified
M RsaI
library
NC HaeIII NC
library
M
64
Figure 10: Gel Analysis of the Initial Amplification of the RsaI
and HaeIII Libraries. Lanes 1 & 7 contain 0.5 f-Lg of a 100 bp molecular
weight marker (Midwest Scientific, St. Louis, MO). Lanes 2,3,5, and 6 contain
15 f-LL ofa 100f-LL PCR reaction. The lanes labeled "M" (Lanes 1 & 7) contain
the molecular weight marker. The lanes labeled ''NC'' contain the no DNA
negative controls (Lanes 3 & 6). The arrow at the left indicates the spreading
occurring in the sample lanes not present in the molecular weight marker lanes.
65
and analyzed by gel electrophoresis (Fig 11). A broad smear was observed in the lanes
containing the libraries (lanes 2 and 6). No such smear was seen in the negative control
for the RsaI library. A smear was also observed in the HaeIII library negative control
(Lanes 5 & 6), perhaps as a result of lane spillage or contamination in this control. The
low molecular weight smear at the bottom of the RsaI hbrary negative control (Lane 3),
also observed in the RsaI Library (Lane 2), was due to primer-dimers and excess
adapters. Although it appeared some library amplification had occurred, a reference was
found later that stated the library may not be visible until the second, gene-specific
amplification (Weiss et aI1994).
GEL ANALYSIS OF MARKER-SPECIFIC AMPLIFICATION
Initially, many failed attempts were made to perform marker-specific
amplification of the libraries. In the first few amplifications, only very small bands near
the bottom of the gel were seen which were believed to result from primer-primer
interaction (Fig 12). Once peR products were obtained, they often were not specific
enough conditions, and spurious bands were sometimes observed (Fig 13). The 150 bp
band in Lane 1 is the desired peR product. The 95 bp band in Lane 1 is a spurious band.
A peR product of 400 bp was desired in Lane 2. However, peR products of 460 and 260
bp were observed. Reaction conditions were optimized and annealing temperatures were
lowered until specific amplifications occurred.
M RsaI NC M
library
HaeIII NC
library
M
66
Figure 11: Gel Analysis of Libraries After Ethanol
Precipitation. Lanes 1, 4, & 7 contain 0.5 j.Lg of 100 bp DNA
Molecular Weight Marker (M). Lanes 2,3,5, & 6 contain 15j.LL ofa 100
j.LL PCR reaction amplifying the RsaI & HaeIII hbraries and their
negative controls (NC). The arrow to the left indicates the area of primer-
dimer and adapter amplification.
67
M 9-bp NC HincII NC HaeIII NC M
Figure 12: Example of Failed Attempts at Marker-
Specific Amplification. Lanes I and 8 contain 0.5 fLg of 100
bp molecular weight marker (M). Lanes 2,4, & 6 contain IS fLL
of 100 fLL marker-specific PCR reactions. Lanes 3, 5, & 7 contain
15 fLL of a 100 fLL PCR reaction of the respective negative
controls (NC). The arrow at the bottom indicates primer-dimers.
68
AluI D Loop M
It--- -460 bp *
11--- -260 bp *
-150 bp ---.
-95 bp*---'
Figure 13: Example of Spurious Bands Observed
During Optimization Attempts. Lane 3 contains 0.5 jLg
of a 100 bp molecular weight marker (M). Lanes 1 & 2 contain
15 JLL of 100 JLL peR reactions. The negative controls are not
shown. The asterisks indicate the spurious bands.
----:;;=--- - ~ - - - - - - - - - - ~
69
First Successful Amplification
The first successful amplification of a specific product that occurred was with the
AluI-5176, HincII-13259 and HaeIII-663 PCR products (Fig 14). The amplified bands
were the sizes expected and no spurious bands were observed. The AluI-5176 PCR
product (Lane 2) was 150 bp as expected, the HincII-13259 PCR product (Lane 3) was
210 bp as expected, and the HaeIII-663 PCR product (Lane 4) was 180 bp as expected.
Smaller bands (primer-dimers, less than 100 bp indicated by the blue arrows) were
present in both these lanes and the negative controls (lanes not shown). The 9-bp
deletion would not amplify even at very low annealing temperatures (42C). The primers
for the 9-bp deletion region were re-examined. It was determined that the primer
sequences were incorrect on the initial order form. The correct primers were ordered and
the PCR reactions were quickly optimized (Fig 15). The 9-bp deletion PCR product
(Lane 2) was ~ 1 2 0 bp, as expected. The blue arrow indicates prime-dimers present in
both the sample and the negative control.
When the D-Ioop region was amplified, 2 bands were observed, one at 440 bp as
expected, but another at 650 bp (Fig 16). Repeated amplifications were performed at
various annealing temperatures. Both bands amplified even when the annealing
temperature was increased. Whenever the annealing temperature was changed by a few
degrees, additional bands ranging in size from 100 bp to 650 bp were present. It was
determined that those conditions which were optimal for amplification of the desired 440
bp product also yielded the ~ 6 5 0 bp product. Three attempts were made to extract the
650 bp band from the gel and sequence it. Informative sequence information was not
obtained.
-210 bp
-150 bp ~
70
M AluI HincH HaeIH
-180 bp
Figure 14: Amplification of AluI-5176,
HincH13259, and HaeHI-663 Markers. Lane 1
contains 0.5 fLg of a 100 bp DNA molecular weight marker
(M). Lanes 2,3, & 4 contain 15 fLL of 100 fLL PCR
reactions. The black arrows indicate PCR products of
desired size. The blue arrows indicate bands also observed
in the negative control lanes (not shown) due to primer-
dimers.
71
M 9bp
-120 bp
Figure 15: Amplification of 9-bp Deletion
Marker. Lane 1 contains 0.5 f-ig of 100 bp DNA
molecular weight marker (M). Lane 2 contains 15 f-iL of a
100 f-iL PCR reaction. The desired PCR product in Lane 2
is marked with a black arrow. The blue arrows indicate
low molecular weight bands also present in the negative
control lane (not shown) due to primer dimers.
72
M DLoop NC
-650bp
--440 bp
Figure 16: Amplification of D-Loop Region.
Lane 1 contains 0.5 fLg ofl00 bp DNA molecular weight
marker (M). Lanes 2 & 3 contain 15 fLL of 100 fLL PCR
reactions. The black arrows indicate the desired 440 bp
PCR product and the additional 650 bp band that was
amplified. The blue arrows indicate low molecular weight
bands also present in the negative control (NC) due to
primer-dimers.
73
There are several possible explanations for this additional 650 bp band. One
explanation is that slippage mechanism occurred as described earlier whereby a
homoplasmic insertion of C's creates an opportunity for misalignment of primers. In the
published research, this led to a 270 bp insertion (Torroni et af. 1994a). However, it is
possible that the Beothuk D Loop differs enough from the Cambridge sequence (we only
analyzed about 200 bp of the Beothuk D Loop) that an insertion of about 110 bp could be
observed. An additional explanation may be that a pseudo gene in the nDNA was also
amplified by the primers to the D Loop. One last possible explanation is that there may
have been some sort of contamination in the PCR reaction. However, this is unlikely due
to the absence of the 650 bp band in the negative (no DNA) control.
Contamination in the Negative Controls
At one point in the research, strong PCR products were observed in all of the
negative controls (Fig 17). For example, a 150 bp band was observed in the AluI-5176
negative control (Lane 3). This indicated that there was marker-specific amplification
without the presence of the library template. In addition, bands ranging in size from 100
to 200 bp were observed in the negative controls and not observed in the marker-specific
amplification of the library (Lanes 5 & 7). These bands were also attributed to
contamination of the negative controls. It was determined by the process of elimination
(as described before) that this resulted from contamination of the Wizard PCR
Purification Prep by a previous researcher. The contaminated libraries were discarded.
The remaining ligated material (which had never been cleaned with the Wizard PCR
74
M AluI NC HincH NC HaeIH NC M
i i i
Contamination in the Negative Controls
Figure 17: Gel Analysis Showing Contamination
in the Negative Controls. Lanes 1 & 8 contain 0.5 f.-Lg of 100
bp DNA molecular weight marker. Lanes 2-7 contain 15 f.-LL of
100 f.-LL peR reactions. These reactions were performed directly
after cleaning the initial libraries with a contaminated Wizard peR
Prep Kit. Notice the amplification of the marker-specific band 150
bp band (red arrow) in the negative control (Ne, Lane 3) and
additional bands not observed in the marker-specific amplification
of the library in the negative control lanes (Lanes 5 & 7) indicated
by green arrows.
Purification Kit) was amplified to create new libraries. The new libraries were used as
template to reamplify using gene-specific primers and the optimized peR conditions.
The resulting peR products were purified for sequencing using new Microcon peR
devices.
RFLP ANALYSIS
Initial Results
75
The HaeIII-663, HincII-16259, and AZul-5176 peR products were digested
overnight as previously described. The undigested controls and digested products were
run on an agarose gel (Fig 18). Lane 2 contains the uncut, 175 bp HaeIII-663 peR
product. After digestion with HaeIII, the peR product remained uncut at 175 bp (Lane
3). This indicates that the Beothuk individual did not have the HaelII-663
polymorphism.
Lane 4 of Fig 18 contains the uncut, 210 bp HincII -13259 peR product. After
digestion with HincH, a digested band of about 180 bp was observed (Lane 5). In
addition, a band was remaining at 210 bp in Lane 5 (the yellow asterisk indicates the 210
bp peR product remaining after digestion of HincII-13259 peR product with HincII). It
was initially thought that this was due to incomplete digestion. It was decided that this
peR product should be digested again to verify the results (discussed later).
The HincII-13259 peR product was also digested with AZul. This was performed
because the during the transition in which the HincII site is lost, an AZul site is created.
Therefore, if the HincH does not digest the peR product, then the AZul should (and vice
.

M uncut HaeIII uncut HincII AluI uncut AluI
cut cut cut cut
76
Figure 18: RFLP Analysis of HaeIII-663, HincII-
13259, and AluI-5176 peR Products. Lane 1 contains 0.5
ILg of 100 bp DNA molecular weight marker (M). Lanes 2, 4, & 7
contain 15 ILL of20 ILl digestion controls in which the restriction
enzyme was not added and, therefore, cutting did not occur. Lanes
3, 5, 6, & 8 contain 15 ILL of20 ILL digestions of cleaned peR
products. Two bands of21O bp and 180 bp are apparent in Lane 5.
The yellow asterisk indicates a partial digestion.
77
versa). After digestion of the HincH-13259 peR product with AZul, a remaining, uncut
210 bp product was observed (Lane 6 of Fig 18). This indicated that the HincH-13259
peR product did not contain an AZul restriction site. This was thought to be further
verification that the HincH site was present and the partial cutting with the HindI was a
problem with the digestion.
After digestion of the AZul-5176 peR product with AZul, the 150 bp band
observed. in the undigested control (Lane 7) was no longer present (Lane 8). The digested
bands of 77 and 72 bp migrated along with the primer-dimers and adapters. This
indicated that the AZul-5176 peR product contained an AZul restriction site. This
indicated that the Beothuk individual had the AIuI-5176 polymorphism. The RFLP
results are summarized in Table 7.
Table 7: Expected RFLP Products and Results
(+) (-) Beothuk
9-bp deletion
112 bp 121 bp (+)
(deletion present) (deletion absent)
AluI-5176
77 & 72 bp 149bp (+)
HincII-13259
158 & 53 bp 211 bp Partial digestion (+1-)
(AIuI should cut) AIul (-)
heteropZasmic
HaeIII-663
101 & 75 bp 176 bp (-)
Redigestion of HincII-13259 and AluI-5176
Because of evidence of a partial digestion of the HincH -13259 peR product, it
was redigested overnight (Fig 19). At first, it was assumed that the partial digestion
(indicated by the presence of both 210 bp product and 180 bp product) was due to a
problem with the digestion reaction and that the HincH restriction site was present. In
addition to an extended period of digestion, a different stock of excess enzyme was used
M HincH AluI M
digested
78
210bp ____ ~
180bp
~
Figure 19: Re-Digestion of HincII-13259 PCR
Product with HincII and the AluI-5176 PCR
Products with AluI. Lanes 1 & 4 contain 0.5 J-Lg of
100 bp DNA molecular weight marker (M). Lane 2
contains 15 iLL of the HincII-13259 PCR product digested
with an excess of the new HincII restriction enzyme
overnight. Lane 3 contains 15 J-LL ofthe Alul -517 6 PCR
product digested with and excess of AZul overnight.
79
in order to rule out the possibility of a faulty enzyme. The uncut 210 bp band was still
present along with the 180 bp digested band. This indicated that the partial cutting of the
HincII-13259 PCR product was not a problem with the digestion, but indicative of
heteroplasmy. The AZul -517 6 PCR product was again completely digested with AZul
verifying the presence of an AZul restriction site at np 5176 (Lane 3).
Re-Amplification of peR Products from Agarose Gel
An attempt was made to re-amplifY PCR products from Low Melting Point
(LMP) agarose gels (Fig 20). This was performed in order to isolate bands of interest for
sequencing. For example, in order to determine if the HincII-13259 site was
heteroplasmic, the 210 bp undigested band was extracted from the agarose and
reamplified for sequencing. This was performed in order to verify that the HincII site
was not present. In addition, sequences for the other PCR products were difficult to
obtain due to multiple signals probably from background. Therefore, the PCR product of
interest was extracted from the gel and reamplified for sequencing. However, this was
largely unsuccessful. In the gel analysis of the reamplification, more background was
observed rather than less. Lane 2 contains the reamplifiedAZul-5176 PCR product, Lane
3 contains the undigested 210 bp HincII-13259 PCR product reamplified, Lane 4 contains
the HaeIII -663 PCR product reamplified, Lane 5 contains the 9 bp product reamplified,
and Lane 6 contains the 440 bp D-Loop region PCR product reamplified. Background
smears (green brackets) and a spurious band (yellow asterisk) can be observed. The use
of GenElute Minus EtBr Spin Columns previously described, however, was successful at
isolating the PCR products of interest without the background for sequencing.
80
M AluI Haem DLoop M
Figure 20: Re-Amplification of Desired peR Product
from Agarose Extraction. Lanes 1 & 7 contain 0.5 f-Lg of
100 bp DNA molecular weight marker (M). Lanes 2-6 contain 15
f-LL of 100 f-LL peR reactions. The green brackets indicate
examples of non-specific background. The yellow asterisk
indicates a non-specific band.
81
SEQUENCING
Sequencing was performed in order to verify RFLP results. The HaelH -663 PCR
product was sequenced to verify that the HaeHI site was not present. The absence of the
HaeHI site was verified through a hand search of the sequence obtained.
The entire HincH-13259 PCR product was sequenced in both directions (Table 7).
When the heavy chain, the chain of mtDNA that is transcribed, was sequenced, a HincH
restriction site was found at np 13259. When the light chain, the template chain for
replication, was sequenced, there was noise (the sequence was ambiguous) around np
13259.
In order to ascertain the cause of the partial digestion of the HincH-13259 PCR
product with HincH, sequencing was obtained on the 210 bp band remaining after
digestion (extracted from the agarose and purified). The sequencing of the 210 bp band
was performed only once, yielding a partial sequence (Table 8). The undigested band did
not have the HincH site at np 13259. The sequencing obtained from the 210 bp band
indicated that there was an A to G transition at np 13263 that created an AZul site gain and
a HincH site loss. The RFLP results correlate in that the HincH-13259 210 bp PCR
product (Lane 6, Fig 18) when digested with AZul appears to be less intense than the
uncut 210 bp product in Lane 4. If the AZul digested the HincH-13259 PCR product at np
13263, fragments the size of 154 and 57 bp would have been expected. The 57 bp
fragment would not be visible because it would migrate along with the primer-dimers.
The 154 bp band, however, should be visible at about half the intensity as the remaining
210 bp band in Lane 5. Although the Cambridge reference sequence (Anderson, et aZ.
1981) does not contain an A lui site within the mtDNA sequence the HincH-13259
82
primers amplified, the Beothuk individual may have had an additional AZul site within the
first 154 bp. A simple one base transition at np 13245, 13280, 13311, or 13347 would
have created this site. In this case, the HincH -13259 PCR product would be cut two
times and the resulting fragments would all migrate along with the adapters and primer-
dimers. The sequencing ofthe remaining HincH-13259 210 bp band in Lane 5 was not
complete enough to indicate if this had occurred.
The 9-bp deletio-n PCR product was sequenced (Table 8). Through a hand search
of the sequence, it was determined that the Beothuk individual did not have the repeat,
CCCCCTCTA, at np 8272 to np 8280. In previous studies, when this repeat was not
present, the individual was characterized as having a 9-bp deletion. Therefore, the
Beothuk individual has a 9-bp deletion.
This was unexpected because the size of the PCR product as about 130 bp was
extrapolated from an EXCEL (Microsoft Office 2000) chart plotting the logarithm ofthe
molecular weights versus the distance migrated of the standard. This indicated that the 9-
bp deletion was probably absent. However, the measuring of the distance migrated
across the gels is objective making misinterpretations of up to 25 bp common. The 9-bp
deletion is the definitive marker for Native American Haplogroup B. Haplogroup B is
further characterized by the absence ofthe HaeIH-663 polymorphism, presence ofthe
HincII-13259 polymorphism, and presence of the AZuI-5176 polymorphism. After
complete characterization of the Native American mtDNA markers essential for
haplogrouping, it was concluded that the Beothuk individual belonged to Native
American Haplogroup B. Haplogroup B is prevalent in Southwestern and Central
American Native Americans (Fig 9), indicating that the Beothuk may share ancestors
83
Table 8: Beothuk mtDNA Sequences
PCRProduct Starting np* Sequence
HaeIII-663 590 5' -CCTCCTCAAAGCAATACACTGAAAAT
GTTTAGACGGGCTCACATCACCCCATAA
ACAAATAGGTTTGGT* CCTA GCCTTT*CTAT
TAGCTCTTAGTAAGATTACACATGCAAG
CATCCCCGTTCCAGTGAGTTCACCCTCTA
AATCACCACGATCAAAAGGAACAAGCAT
CAAGCAC-3'
* The HaeIII site is not here.
HincII-13259 13211 5' -GCCCTTACACAAAATGACATCAAAAAA
ATCGTAGCCTTCTCCACTTCA*GTCAAC*TAG
GACTCATAATAGTTACAATCGGCATCAAC
CAACCACACCTAGCATTCCTGCACATCTG
TACCCACGCCTTCTTCAAAGCCATACTATT
TATGTGCTCCGGGTCCATCATCCACAACCT
TAACAATGAACAAGATATTCGAAAAATAGG-3'
* The HincII site is here},2
9-bp Deletion 8204 5' -ATGCCCATCGTCCTAGAATTAATTCCCC
TAAAAATCTTTGAAATAGGGCCCGTATTTA
CCCTATAGCA*CCCCCTCTAGAGCCCACTG
TAAAGCTAACTTAGCAT -3'
* The 9-bp deletion is here
D-Loop 16005 5' -T AATTT AAACTATTCTCTGTTCTTTCATG
Region GGGAAGCAGATTTGGGTACCACCCAAGTA
TTGACTCACCCATCAACAACCGCTATGTAT
TTCGTACATTACTGCCAGCCACCATGAATA
TTGTACGGTACCATAAATACTTGACCACCT
GTACGGTACCATAAATACTTGACCACCTGT
AGTACATAAAAACCCAATCCACATCAAAA
CCCCCTCCCCATGCTTACAAGCAAGTACAG
AATCAACCCTCAACTATCACACATCAACT
GCAACTCCAAAGCCACCCCTCACCCACTAG
GATACCAACAAACCTACCCACCCTTAACA*A*
TACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCC
CCATGGATGACCCCCCTCAGATAGGGGTCC
CTTGACCACCATCCT -3'
* At 16303 there is a G-> A transition which deletes an
RsaI restriction site.
" The bght chain sequence obtaIned was amblguous around the HincH slte .... GNNAAC ... (np
13259-13264)
2The 210 bp portion sequence at np 13259-13264: ... GTCAGC ... An A to G transition at np
13263.
84
with these groups. Also, no Innuit in several studies, to our knowledge, has ever been
reported as belonging to Haplogroup B. This indicates that, despite what Santu said, the
Beothuk probably were not part Eskimo.
In order to perform some further characterization, sequencing on the D-Loop
region 440 bp PCR product was obtained (Table 8). The D-Loop 440 bp PCR product
was extracted from the gel and purified using spin columns. It was then sent for
sequencing. A hand search of the obtained D-Loop sequence was then performed against
the Cambridge reference sequence (Anderson et a1. 1981). The only variance observed in
a hand comparison with the Cambridge D loop sequence in the area sequenced was a G to
A transition at np 16303, this created an RsaI site loss. This analysis was performed for
comparison ofthe Beothuk sequences in this hypervariable region to previously
published results (Appendix A). The D loop was sequenced two times from different
PCR products for verification.
After the amplification of the Beothuk mtDNA markers was completed, the D-
Loop region of the mtDNA of the investigator was amplified using the D-Loop region
PCR primers. This was performed in order to determinate if contamination had occurred.
The PCR product was extracted from an agarose gel (not shown) and sequencing was
obtained. Hand analysis indicated the investigator did not have the same G to A
transition at np 16303 as the Beothuk individual (Table 9).
85
Table 8: Sequencing ofInvestigator's D-Loop region
Investigator's D- 16008 5' -TTTAAACTATTCTCTGTTCTTTCATGGGGA
Loop Region AGCAGATTGGGTACCACCCAAGTATTGACTC
ACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTAC
CATAAATACTTGAACCTGTAGTACATAAAAAC
CCAATCCACATCAAAACCCCCTCCCCATGCTTA
CAAGCAAGTACAGCAATCAACCCTCAACTATC
ACACATCAACTGCAACTCCAAAGCCACCCCTCA
CCCACTAGGATACCAACAAACCTACCCACCCTT
AACA *G*TACATAGTACATA-3'
No changes from the Cambridge reference sequence.
np 16303 where the G to A transition occu"ed in the
Beothuk individual is indicated in red and with
asterisks.
EUROPEAN MARKER
The European marker, AluI -7025 was PCR amplified and run on a gel (not
shown). A smear around 100 bp (the expected size ofthe PCR product) was extracted
from the gel and sent to be sequenced (Davis Sequencing). According to Davis
sequencing, the signal was too weak for sequencing. Optimization of the PCR reaction
would be required in order to sequence this marker.
ANALYSIS OF THE RSAI RESTRICTION SITE LOSS AT NP 16303
The loss of the RsaI restriction site at np 16303 of the D loop of the mtDNA has
been observed in various haplotypes. The Tibetan haplotypes AS142-A145, AS147, and
AS154 also have this transition (Torroni et al.1994b). In addition, these haplotypes do
not have the HindI and HpaI sites at np 12406. The Beothuk individual was only
analyzed for the Native American mtDNA sites. Therefore, these sites were not
examined. These Tibetan haplotypes are found at a high frequency in southeastern Asian
86
populations. AS154 does not fall into a haplotype category. AS142-145 and 147 are
placed in Haplogroup F (Fig 21). Figure 21 depicts distance-based phylogenetic analysis
showing the closeness of the genetic relationship of the Tibetan haplotypes to each other.
The rationale of phylogenetic analysis is that the more mutations required to
change one sequence into the other, the more unrelated the sequences and the lower the
probability that they share a common ancestor. The length of a branch on the
phylogenetic tree is proportional to the number of sequence changes in the branch. The
nodes (where the branches meet) are representative of a common genetic ancestor. The
further to the left the branch is (the closer to the node), the more its sequence is in
consensus with the genetic ancestor. Conversely, the further the branch is to the right of
the node, the greater the number of sequence changes from the genetic ancestor.
Figure 21 indicates that Haplogroup F, which the Tibetans haplotypes with the G
to A transition at np 16303 belong to, and Haplogroup B, which the Beothuk individual
belongs to, have a common ancestor (denoted in the figure by a blue asterisk). It is
possible the G to A transition at np 16303 occurred before the divergence of the two
haplogroups.
87
Figure 21: Tibetan Phylogenetic Tree (Torroni et al. 1994b) A
phylogenetic tree including 42 Tibetans, 106 Asian, and 34 Siberian haplotypes.
A-G are the six major haplogroups observed in Tibetans. The numbers at the end
of the branch represent haplotypes. The further the branch from the node, the
greater the amount of mutational events that have occurred since divergence from
the common ancestor (represented by the node). The blue asterisk denotes a
common ancestor of Haplotype F and Haplotype B.
517
--- A1
AS56

AS17
AS18
AS90
..
A524
__ AS32
ASS' AS611 A5154

r-ASln
! AS126 AS127
:..ilI..-_- 519
Am

AS50
A530
A547
====mo iAsi3iAsa5"
AS86
-10394 Odel :
I
XS91
AS46
A548
-10397 Alul j

I
L
A553
XS98
A569 , AS72
AS120
l ASI411
ASI43 I ASI44
A5145

AS39
AS45
AS"
S20
AS147 l-
ASl"
'AS55 AS60
ASloo
AS49
A5St
AS84
AS57
AS58
:-. -8- ASS4
A5711
AS115
AS10l
AS116
AS12B
l!h:iii
ASI29
AS110
A5121
AS21
A597
ASI33
AS135
AS2S1S13 USl37
I ASl3B
ASI36
-0-
. S10
A5132
ASl34
- 515
, AS131
S16
--- AS95
514 AS64
LS12
- S11
S2S
AS26 . AS37
AS42
AS43
ASIl2
1----
- AS63
AS52
A5159
I
A5107
AS40
- S9
A570
sa
A5148
, A5150
I--G -: AS9CI AS149
AS77
A5104
A5140
I
I A5139
AS141
S23
ASleD
ASI52
- A5153 AS76
AS157
-534
i
"-c
AS6S1S2L S30 i
- ---. S32 .. _ AS73
!
-- -- S27 A575 ;

AS118
JoS82

!
AS156
=
2!'_06
.-
-- AS109
Odelj
f----
A522
i . ASS9 -. AS119
AS158
7 At,:,. i
AS8B
ASI22
;
- - AS92
- ASIOB
i
-. - . AS113
AS114
AS38
! ---= A 1
. ASISI
i

-Lin.......-.-
522
-- -- AS117
A5155
- ASSl
-- AS94
--------- AS34
L----- --- __ 55
Af1"OSISl 56
-------. 51 ... AFRICAN OUTGROUP
------_ ....
88
A519
AS29
A5142
AS3I5
___ AS102
89
In addition, this transition was observed in haplotypes 5, 13, 31-34, 74, 76, 98,
108, and 111 (Torroni et al. 1994a). Nine of these mtDNA haplotypes clustered together
on a phylogeny tree (arrow on Fig 22). All of these haplotypes were of Caucasian
individuals that had Alzheimer's disease or Parkinson's disease. These individuals were
grouped in Haplogroup H. The genetic relationships on this tree are interpreted in the
same manner as Fig 21. Again, the Beothuk individual was not successfully analyzed for
the additional marker, AluI-7025, just the Native American mtDNA markers. The
Beothuk individual had a transition that was observed in the most common Caucasian
haplogroup, Haplogroup H. In addition, all of the individuals in the haplotypes in this
study that had the G to A transition at np 16303 also had Alzheimer's or Parkinson's
disease. It is a possibility that this transition is a marker for these diseases. In that case,
it could further be possible that the Beothuk individual tested carried the genetic marker
for or even had Alzheimer's or Parkinson's disease.
Siberian mtDNA Haplotypes S6, S7, and S20 also have the loss ofthe RsaI site at
np 16303 (Torroni et al. 1993b). Like the Beothuk individual, these haplotypes do not
have the np 663 HaeIH site. In addition, they have the np 13259 HincH and np 5176 AluI
site in common with the Beothuk individual (the 9-bp deletion was not analyzed in the
Siberian study). The S20 is an Evenk Haplotype that has also been seen in Koreans and
Hans. The S6 and S7 are Nivkh and Udegey Haplotypes. These haplotypes are similar to
those observed in the Japanese. S6 and S7 are not in any of the Native American
haplogroups. In the phylogenetic tree (which was constructed in the same manner as the
previous phylogenetic trees described) in Fig 23, Haplotypes S6 and S7 are grouped
together. Their common ancestor branches directly off of the African outgroup. From
90
Figure 22: Phylogenetic Tree of Caucasian mtDNAs (Torroni et al.
1994a). A phylogenetic tree including 34 Siberian (S) and 106 Asian (AS)
haplotypes. Four of the Native American haplotypes are represented, A, B, C,
and D .. The numbers at the end of the branch represent haplotypes. The further
the branch from the node, the greater the amount of mutational events that have
occurred since divergence from the common ancestor (represented by the node).
The arrow indicates those haplotypes that have the G to A transition at np 16303.
.
i
,
I
I
--.,.--Itt
I
H
.-r-=--- ,
r- 11,_ :
! __ II
.. __ _
'--_."" ';., 1.1:
'-
__ --t-.IIIII----...-;;--.... L:.:.r--'-- 41'
'':'; 1.-
---- 11'
. - 11 b"-rf....-- !II'
,--;'ii' I'f'
L", .!IIII.IJJ: .all J ;.r was IL1
, ..
., 11
I iif III
.. I - III
- l __ --""'""-- tl"
r' ::::: ..
I,. ...: u: .
____ r.-----
i-i,_ -___ __ ; If'

:
,-=' -g .
! :;=. A
!
___ 'Wi < ==- ..
to=- ___ .f:;n'--_- :
At.n outgroup
91

92
Figure 23: Siberian Phylogenetic Tree (Torroni et al. 1993b). A
phylogenetic tree including Siberian (S) and Asian (AS) haplotypes. Four ofthe
Native American haplotypes are represented, A, B, C, and D. . The numbers at
the end of the branch represent haplotypes. The further the branch from the node,
the greater the amount of mutational events that have occurred since divergence
from the common ancestor (represented by the node). The blue asterisk denotes
the early divergence from the common ancestor with the Native American
haplogroups. The green asterisk denotes the divergence ofHaplogroups A and B
before which the G to A transition at np 16303 could have occurred.
93
AS18
L_-===.:;;o.=,--- AS81
A8102
S5
___ African outgroup
this analysis, it appears that Haplotypes S6 and S7 diverged very early on from the
common ancestor of the Native American haplogroups (see blue asterisk on Fig 23).
94
This opens up the possibility that the Beothuk may have been remnants of a very ancient
group of people. In addition, Haplotype S20 is in Haplogroup A. This indicates that
there is a possibility that the G to A transition at np 16303 occurred before the divergence
ofHaplogroups A and B (see green asterisk on Figure 23).
Lastly, European Haplotypes 15, 17 and 67 also have the loss ofthe RsaI site at
np 16303. Haplotype 15 was made up of two Swedes and one Basque individual.
Haplotype 67 was made up of one Basque individual. Torroni et al. (1994) suggested
that these were Haplogroup H-founder root haplotypes commonly found in Spain and
among the Basques.
As previously mentioned, this transition was also observed in the European
Haplogroup H haplotypes that had Alzheimer's and Parkinson's disease. This indicates
that there is a possibility that there was some European admixture in the Beothuk. It
would be necessary to perfonn analysis of European mtDNA markers to draw further
comparisons to European mtDNA haplotypes.
Due to the nature of maternal inheritance in mtDNA, it is more likely that this G
to A transition at np 16303 occurred in the founding, Native American haplotype.
However, as previously described, some paternal recombination has been observed. One
possible scenario is that, at some point in time, admixture between a woman belonging to
Native American Haplogroup B and a Caucasian male carrying the G to A transition at
np 16303 occurred. This is more likely than admixture of a Native American male with a
Caucasian female due to the large amount of recombination that would have had to of
occurred in order for the female to have offspring with the Native American markers
described for Haplogroup B. However, this scenario would be possible, but unlikely,
over a number of generations of admixture solely with the Beothuk beyond the initial
Caucasian mother.
APPENDICES A & B-COMPILATION OF PUBLISHED mtDNA
ANALYSES.
The published results of previous studies of mtDNA polymorphisms were
95
difficult to compare because they were reported in different formats. The charts were
made in order to facilitate the analysis of the Beothuk polymorphisms. In addition, these
tables will be used in future studies in the laboratory involving other Native American
groups. The tables were designed so that an individual's polymorphisms, once
determined, could be entered into a row, and all haplotypes and haplogroups that have the
same polymorphisms as the subject of the study would be immediately identified.
Results were interpreted from studies (those studies marked with a superscript
reference letter in the References section were used) and entered into an EXCEL
(Microsoft Office 2000) chart. The first chart contains a listing of restriction site
polymorphisms (Appendix A). The top row is the site of the restriction site
polymorphism. The appearance of a "1" denotes the presence of a restriction site (or
deletion). The appearance of a "0" denotes the absence of a restriction site (or deletion).
Those polymorphisms shared with the Beothuk individual are highlighted. The second
chart contains D-Loop sequence differences (Appendix B).
CONCLUSIONS
The purpose of this project was to detennine the mtDNA haplogroup of the
Beothuk chief, Nonosabasut. It was hypothesized that the Beothuk Indian would belong
to one of the Native American mtDNA haplogroups. The Beothuk Indians have been
largely overlooked in the discussion over the founding of the Americas due to the lack of
knowledge about their origins. Through this research, some information about the origins
of the Beothuk can be inferred. Perhaps the interest and additional questions this study
raises will lead to future studies involving a larger sample size ofBeothuk individuals'
remams.
In this study, the mtDNA markers (HaeIII-663, HincII-13259, AluI-5176, and the
9-bp deletion) that definitively place an individual into a Native American Haplogroup
were examined for the Nonosabasut, the Beothuk representative. It was detennined that
the Beothuk individual had the AluI-5176 and 9-bp deletion polymorphisms. In addition,
he had HincII-13259 heteroplasmy. Nonosabasut did not have the HaeIII-663
polymorphism. The cumulative result is that Nonosabasut belongs to Native American
Haplogroup B.
In addition, the mtDNA D-Loop region ofNonosabasut was analyzed. The
analysis indicated a G to A transition at np 16303. Through comparison with previously
published D-Loop sequences, it was detennined that this transition is primarily found in
Caucasians. In addition, to our knowledge, this transition has never been reported in a
97
Native American. This indicated that there may be some Caucasian admixture with the
Beothuk. Additional studies should be performed on older Beothuk remains and on
European mtDNA markers to determine the age and the origin of this possible admixture.
Also, the G to A transition at np 16303 is a transition that appears to have occurred very
early in divergence. This supports the belief held by some that the Beothuk were the
remains of an archaic group of people.
There are many possibilities for future studies using the Beothuk DNA libraries.
It would be interesting to look for any ofthe polymorphisms that are definitive for
European Haplogroups. In addition, the HincII-13259 polymorphism of this individual
could be studied more in depth. Several digestions could be performed using HindI.
The remaining 210 bp band could be collected from three or four gels using the GenElute
EtBr Spin Columns. Then, an ethanol precipitation could be performed in order to
concentrate the PCR product. The concentrated product could be digested with AluI to
see is any cut product is apparent on a gel. Also, this PCR product could be sequenced to
look for any additional A luI sites. It would also be interesting to obtain a sequence for
the D-Loop region being amplified along with the 440 bp PCR product to determine if
there are two copies of a portion of the D Loop due to homoplasmic insertion.
The creation of a library from the ancient DNA proved to be successful. With the
creation of two libraries, all of the markers of interest could be analyzed. In future
studies, it would be plausible to create as many as four or five libraries. In addition, the
library method proved useful when analyzing irreplaceable DNA. It allowed for
reamplification as needed. Therefore, ample ancient DNA was available for optimization
of reactions without exhausting the supply of DNA.
98
The methods optimized in this study are currently being used in Dr. Carolyn
Vann's laboratory for a study on the Miami Indians. The study is also using ancient
DNA extracted from teeth. The Miami Indians have struggled to gain recognition as an
American Indian Tribe by the Federal Government. If the molecular study currently
being performed shows that they belong to a Native American Haplogroup, it may have
important ramifications for the Miami Indians. Along with recognition as an Indian tribe,
Federal recognition would give them rights and opportunities to preserve their unique
heritage.
With the continuing improvements in sequencing, more straight-forward methods
of placing individuals in mtDNA haplogroups should be considered for future studies.
One method that has been used successfully is amplification of the entire mtDNA using
overlapping fragments and nested PCR. Primers are designed to overlapping segments of
DNA between 300 and 400 bp long. A second PCR is performed using primers internal
to the first set of primers. The PCR products are then sequenced. When the sequences
are obtained, the entire mtDNA sequence can be constructed using the overlapping
sequences.
Technology in molecular biology is rapidly evolving. When performing future
studies that involve extracting DNA, care should be taken not to use all of the sample, or
to keep it in a form that could most likely be used as new, more efficient, and more
informative techniques evolve.
REFERENCES
HAlves-Silva, J., Santos, M., Pena, S., and Prado, V. 1999. Multiple Geographic Sources
of Region V 9-bp Deletion Haplotypes in Brazilians. Human Biology 71(2): 245-259.
Anderson, S, Bankier, A, Barrell, B., de Bruijn, M., Coulson, A, Drouin, J., Eperon, I.,
Nierlich, D., Roe, B., Sanger, F., Schreier, P., Smith, A, Staden, R, Young, I. 1981.
Sequence and Organization ofthe Human Mitochondrial Genome. Nature 290: 457-465.
Batzer, M., Stonking, M., Alegria-Hartman, M., Bazan, H., Kass, D., Shaikh, T., Novick,
G., Ioannou, P., Scheer, W., Herrera, R, and Deininger, P. 1994. African Origin of
Human-Specific Polymorphic Alu Insertions. Proceedings of the National Academy of
Sciences USA 91: 12288-12292.
Baumer, A, Zhang, c., Linnane, A, and Nagley, P. 1994. Age-Related Human mtDNA
Deletions: A Heterogeneous Set of Deletions Arising at a Single Pair of Directly
Repeated Sequences. American Journal of Human Genetics 54: 618-630.
JBertranpetit, J., Sala, J., Dalafell, F., Underhill, P., Moral, P., and Comas, D. 1995.
Human Mitochondrial DNA Variation and the Origin of Basques. Annuals of Human
Genetics 59: 63-81.
Birket-Smith, K. 1918. A Geographic Study of the Early History of the Algonquian
Indians. Intemationales Archives fur Ethnographie 24: 171-222.
Blake,E. 1888. The Beothuks of Newfoundland. The Nineteenth Century 24: 889-918.
Brown, M., Hosseini, S., Torroni, A, Bandelt, H., Allen, J., Schurr, T. Scozzari, R,
Cruciani, F., and Wallace, D. 1998. mtDNA Haplogroup X: An Ancient Link Between
Europe/Westem Asia and North America? American Journal of Human Genetics 63:
1852-1861.
MBrown, M., Hosseini, S., Torroni, A, Bandelt, H., Allen, J., Schurr, T., Scozzari, R,
Cruciani, F., and Wallace, D. 1998. mtDNA Haplogroup X: An Ancient Link Between
Europe/Westem Asia and North America? American Journal of Human Genetics 63:
1852-1861.
Brown, T., and Brown, K. 1992. Ancient DNA and the Archaeologist. Antiquity 66:
10-23.
Busk, G. 1876. Description of Two Beothuc Skulls. The Journal of the Royal
Anthropological Institute of Great Britain and Ireland 5: 230-233.
Campbell, J. 1892. Remarks on Preceding Vocabularies. Transactions oftheRoyal
Society of Canada 10(2): 26-32.
Dixon, R. 1913. Some Aspects of North American Archaeology. American
Anthropologist 15(4): 549-577.
100
Fraser, A. 1962. The Beothiks of Newfoundland. Canadian Geographical Journal 65(5):
156-159.
Gatschet, A. 1885. The Beothuk Indians (First Article). Proceedings of the American
Philosophical Society 22:408-424.
Gatschet, A. 1886. The Beothuk Indians (Second Article): Robinson's Vocabularies.
Proceedings of the American Philosophical Society 23: 411-432.
Gatshet, A. 1890. The Beothuk Indians. Proceedings ofthe American Philosophical
Society. 28(132): 1-15.
Greenberg, B., Newbold, J., and Sugino, A. 1983. Intraspecific Nucleotide Sequence
Variability Surrounding the Origin of replication in Human Mitochondrial DNA. Gene
21: 33-49.
Greenman, E. 1963. The Upper Palaeolithic and the New World. Current Anthropology
4(1): 41-91.
Gyllensten, U., Wharton, D., and Wilson, A. 1985. Journal ofHeridity 76: 321-324.
Kopsidas, G., Kovalenko, S., Islam, M., Gingold, E., and Linnane, A. 2000. Preferential
Amplification is Minimised in Long-PCR Systems. Mutation Research 456: 83-88.
Hauswirth, W., Van De Walle, M., Laipis, P., and Olivo, P. 1984. Heterogeneous
Mitochondrial DNA D-Loop Sequences in Bovine Tissue. Cell 37: 1001-1007.
Hewson, J. 1968. Beothuk and Algonkian: Evidence Old and New. International
Journal of American Linguistics 34(2): 85-93.
Hewson, J. 1971. Beothuk Consonant Correspondences. International Journal of
American Linguistics 37(4): 244-249.
Howley, J. 1915. The Beothuks or Red Indians: the Aboriginal Inhabitants of
Newfoundland. Cambridge University Press, Cambridge, MA.
Hu, G and Thilly, W. 1995. Multi-copy Nuclear Pseudogenes of Mitochondrial DNA
Reveal Recent Acute Genetic Changes in the Human Genome. Current Genetics 28:
410-414.
Jukes, J. 1842. Excursions In and About Newfoundland During the Years 1839 and
1840. Volume 2. London: John Murray.
101
Keichle, F., Zhand, X., and Malinski, T. 1999. The Molecular Pathology Laboratory of
the 21
st
Century. Annals of Clinical and Laboratory Science 29(1): 59-77.
Kurosaki. K., Matsushita, T., and Ueda, S. 1993. Individual DNA Identification from
Ancient Human Remains. American Journal of Human Genetics. 53: 638-643.
Lindahl, T. 1997. Facts and Aritfacts of Ancient DNA. Ce1l90: 1-3.
Latham, R. 1862. Natural History of the Varieties of Man. London: J. Van Voorst.
Lightowlers, R., Jacobs, H., and Kajander, o. 1999. Mitochondrial DNA-- All Things
Bad? Trends in Genetics 15: 91-93.
Lindahl, T. 1997. Facts and Artifacts of Ancient DNA. Cell 90: 1-3 (Minireview).
Lloyd, T. 1875. On the "Beothucs," a Tribe of Red Indians, Supposed to be Extinct,
Which formerly Inhabited Newfoundland. The Journal of the Royal Anthropological
Institute of Great Britain and Ireland 4: 20-39.
Lloyd, T. 1876a A Further Account of the Beothucs of Newfoundland. The Journal of
the Royal Anthropological Institute of Great Britain and Ireland. 5: 222-229.
Lloyd, T. 1876b. On the Stone Implements of Newfoundland. The Journal of the Royal
Anthropological institute of Great Britain and Ireland 5: 233-249.
Lorenz, J. and Smith, D. 1996. Distribution of Four Founding mtDNA Haplogroups
Among Native North Americans. American Journal of Physical Anthropology 101: 307-
323.
Marshall, I. 1996. A History and Ethnography of the Beothuk. London: McGill-
Queen's University Press.
Moorehead, W. 1917. Prehistoric Cultures in the State of Maine. Proceedings of the
Nineteenth International Congress of Americanists. F.W. Hodge, ed. pp.48-51.
Washington.
Nagley, P and Wei, Y. 1998. Ageing and Mammalian Mitochondrial Genetics. Trends
in Genetics 14: 513-517.
102
Oliver, N. and Wallace, D. 1982. Assignment of Two Mitochondrially Synthesized
Polypeptides to Human Mitochondrial DNA and Their Use in the Study oflntracellular
Mitochondrial Interaction. Molecular Cell Biology 2: 30-41.
Paabo, S. 1985. Molecular Cloning of Ancient Egyptian Mummy DNA Nature 314:
644-645.
Paabo, S., Gifford, J., and Wilson, A 1988. Mitochondrial Sequences from a 7000-Year
Old Brain. Nucleic Acis Research 16: 9775-9787.
Paabo, S. 1989. Ancient Dna: Extraction, Molecular Cloning, and Enzymatic
Amplification. Proceedings of the National Academy for Science USA 86: 1939-1943.
Paabo, S. November 1993. Ancient DNA Scientific American 86-92.
BPassarino, G., Semino, 0., Bernini, L., and Santachiara-Benerecetti, A 1996. Pre-
Caucasoid and Caucasoid Genetic Features ofthe Indian Population, Revealed by
mtDNA Polymorphisms. American Journal of Human Genetics 59: 927-934.
Pastore, R. 1979. The Beothuks: Information Sheets from the Newfoundland Museum.
Museum Notes No.1.
Pastore, R. 1991. Shanawdithit's People: the Archaeology o/the Beothuks. St. John's:
Atlantic Archaeology Ltd.
GRibeiro-Dos-Santos, A, Santos, S., Machado, A, Guapindaia, V., and Zago, M. 1996.
Heterogeneity of Mitochondrial DNA Haplotypes in Pre-Columbian Natives ofthe
Amazon Region. American Journal of Physical Anthropology 101: 29-37.
Sambrook and Russell. 2001. Molecular Cloning: A Laboratory Manual, 2
nd
Edition.
Cold Spring Harbor Press, New York, NY.
Schurr, T., Ballinger, s., Gan, Y., Hodge, J., Merriweather, D., Lawrence, D., Knowler,
W., Weiss, K., and Wallace, D. 1990. Amerindian Mitochondrial DNAs have Rare
Asian Mutations at High Frequencies, Suggesting they Derived from Four Primary
Maternal Lineages. American Journal of Human Genetics 46: 613-623.
Speck, F. 1912. The Beothuks of Newfoundland. The Southern Workman 41: 559-563.
Speck, F. 1922. Beothuk and Micmac. Indian Notes and Monographs, 22. New York:
Museum ofthe American Indian, Heye Foundation.
LStarikovskaya, Y., Sukernik, R., Schurr, T., Kogelnik, A, and Wallace, D. 1998.
mtDNa Diversity in Chukchi and Siberian Eskimos: Implications for the Genetic History
of Ancient Beringia and the Peopling of the New World. American Journal of Human
Genetics 63: 1473-1491.
103
Stone, A, and Stoneking, M. 1993. Ancient DNA From a Pre-Columbian Amerindian
Population. American Journal of Physical Anthropology 92: 463-471.
Stone, A and Stoneking, M. 1994. Analysis of Ancient DNA from a Prehistoric
Amerindian Cemetery. Philosophical Transactions of the Royal Society of London B
354: 153-159.
Stone, A and Stoneking, M. 1999. Analysis of Ancient DNA From a Prhistoric
Amerindian Cemetery. Philosophical Transactions of the Royal Society of London 354:
153-159.
Strong, W. 1930. A Stone Culture From Northern Labrador and its Relation to the
Eskimo-Like Cultures of the Northeast. American Anthropologist 16(3): 376-412.
KSukernik, R, Schurr, T., Starikovskaya, E., and Wallace, D. 1996. Mitochondrial DNA
Variation in Native Siberians with Special Reference to the Evolutionary History of
American Indians: I. Studies on Restriction Polymorphism Russian Journal of Genetics
32(3): 376-382.
FTorroni, A., Schurr, T., Yang, c., Szathmary, E., Williams, R, Schanfield, M., Troup,
G., Knowler, W., Lawrence, D., Weiss, K., and Wallace, D. 1992. Native American
Mitochondrial DNA Analysis Indicates That the Amerind and the Nadene Populations
Were Founded by Two Independent Migrations. Genetics l30: 163-162.
ETorroni, A, Schurr, T., Cabell, M., Brown, M., Neel, J., Larsen, M., Smith, D., Vullo,
C., and Wallace, D. 1993a. Asian Affinities and Continental Radiation ofthe Four
Founding Native American mtDNAs. American Journal of Human Genetics 53: 563-
590.
DTorroni, A., Sukernik, R, Schurr, T., Starikovskaya, Y., Cabell, M., Crawford, M.,
Comuzzie, A, and Wallace, D. 1993b. mtDNA Variation of Aboriginal Siberians
Reveals Distinct Genetic Affinities with Native Americans. American Journal of Human
Genetics 53: 591-608.
Torroni, A., Lott, M., Cabell, M., Chen, Y., Lavergne, L., and Wallace, D. 1994a.
mtDNA and the Origin of Caucasians: Identification of Ancient Caucasian-Specific
Haplogroups, One of Which Is Prone to a Recurrent Somatic Duplication in the D-Loop
Region. American Journal of Human Genetics 55: 760-776.
ATorroni, A., Miller, J., Moore, L., Zamudio, S., Zhuang, J., Droma, T., and Wallace, D.
1994b. Mitochondrial DNA Analysis in Tibet: Implications for the Origin of the Tibetan
Population and Its Adaptation to High Altitude. American Journal of Physical
Anthropology 93: 189-199.
Torroni, A, NeeL J., Barrantes, R, Schurr, T., and Wallace, D. 1994c. Mitochondrial
DNA "Clock" for the Amerinds and Its Implications for Timing Their Entry Into North
America. Proceedings of the National Academy of Sciences USA 91: 1158-1162.
104
PTorroni, A, Huoponen, K, Francalacci, P., Petrozzi, M., Morelli, L., Scozzari, R,
Obinu, D., Savontaus, M., and Wallace, D. 1996. Classification of European mtDNAs
From an Analysis of Three European Populations. Genetics 144: 1835-1850.
CTorroni, A, Bandelt, H., D'Urbano, L., Lahermo, P., Moral, P., Sellitto, D., Rengo, C.,
Forster, P., Savontaus, M., Bonne-Tamir, B., and Scozzari, R 1998. mtDNA Analysis
Reveals a Major Late Paleolithic Population Expansion from Southwestern to
Northeastern Europe. American Journal of Human Genetics 62: 1137-1152.
Wallace, D., and Torroni, A 1992.American Indian Prehistory as Written in the
Mitochondrial DNA: A Review. Human Biology 64(3): 403-416.
Wallace, D., Stugard, C., Murdock, D., Schurr, T., and Brown, M. 1997. Ancient
mtDNA Sequences in the Human Nuclear Genome: A Potential Source of Errors in
Identifying Pathogenic Mutations. Proceedings of the National Academy of Sciences 94:
14900-14905.
NWard, R, Frazier, B., Dew-Jager, K and Paabo, S. 1991. Extensive Mitochondrial
Diversity Within a Single Amerindian Tnbe. Proceedings of the National Academy of
Sciences 88: 8720-8724.
Weiss, K, Buchanan, A, Daniel, C., and Stoneking, M. 1994. Optimizing Utilization of
DNA from Rare or Archival Anthropological Samples. Human Biology 66(5): 789-804.
Whitefeather Newfoundland Map. 18 February 2001. Online. Microsoft Internet
Explorer. Available: http://www.nftd.net/whitefeather/map2.html
Willoughby, C. 1915. The "Red Paint People" of Main. American Anthropologist 17:
406-409.
Zerjal, R, Dashnyam, B., Pandya, A, Kayser, M., Roewer, L, Santos, F., Schiefenhovel,
W., Fretwell, N., Jobling, M., Harihara, S., Shimizu, K., Semjidmaa, D., Sajantila, A.,
Salo, P., Crawford, M., Ginter, E., Evgrafov, 0., and Tyler-Smith, C. 1997. Genetic
Relationships of Asians and Northern Europeans, Revealed by Y -Chromosomal DNA
Analysis. American Journal of Human Genetics 60: 1174-1183.