Genes and DNA

Picture : C. William Birky, Jr. Department of Ecology and Evolutionary Biology .The University of Arizona

Genes
What is gene?
a) One gene-one enzyme. b) One gene-one protein (polypeptide). c) Genes are segments of DNA that code for polypeptides and RNAs. Answer ...

Experimental procedures demonstrating that DNA is the genetic material 1940s

Proof that DNA is the Genetic Material

Hershey and Chase
Used viral particles (phages) Determined genetic material was contained in DNA rather than protein coat

Genes are DNA

Flourescence micrograph of alga Olisthodiscus (Alga). Chlorophyll autofluoresces red. DNA stained with DAPI fluoresces white.
Chloroplasts and cpDNA Mitochondria and mtDNA Nucleus and nuDNA

Genes are DNA

Genetic information is carried in the linear sequence of nucleotides in DNA Genetic information contains instructions to synthesize proteins

Some Definitions
A gene is a segment of a DNA molecule (or RNA in some viruses). Occur in Pairs - genes found on homologous chromosomes in somatic cells (diploid) Dominant - gene that is always expressed Recessive - gene that is expressed ONLY if 2 are present

Some Definitions
The phenotype of a cell or organism is determined jointly by the organisms genotype and environment. The genotype consists of the genes that control the trait of interest. Codominant - both genes are always expressed

Some Definitions
The genome of an organism is (i) the sum of all of the DNA in one set of chromosomes (broad sense); (ii) the sum of all of the genes in one set of chromosomes (narrow sense).

Genes and Chromosomes in Eukaryotes

Human DNA in one genome It is divided into 23 chromosomes. Somatic cells have two sets of 23 chromosomes.

Genes and Chromosomes in Bacteria

gene 1

gene 2 gene 3

Electron micrograph Very small circular DNA

Structure of DNA : determined by Watson and Crick in1953 DNA and its Building Nucleotides: Guanine (G), Adenine (A), Cytosine (C), Thymine (T). Polarized strand : 5->3 Base inside, sugar outside

 What are some of the important structural features of the DNA double helix?

The Problem
Human genome (in diploid cell) = 6 x 109 bp
6 x 109 bp x 0.34 nm = 2.04 x 109 nm = 2 m/cell Very thin (2.0 nm) extremely fragile Diameter of nucleus = 5 10 m

DNA must be packed to protect it, but still be accessible to allow gene expression and cellular responsiveness

DNA Structure: The Final Simplification

A gene is a sequence of bases in one strand of DNA.
3' OH dR P dR P dR P dR P 5' | | | | T C G A .. ... ... .. A G C T | | | | 5' P dR P dR P dR P dR OH 3

3 T C G A 5 A G C T
.

Gene sequences can be written down and read like any text
Presented here is the sequence of nucleotides in the human -globin gene The three regions of the gene that specify the amino sequence for the -globin protein (EXON)

Human b-globin Gene Determines Amino Acid Sequence of b -globin

1 10 20 30 40 50 60 70 80 90 100 AcatttgcttctgacacaactgtgttcactagcaactcaaacagacaccATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGC 101 AAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAG gttggtatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggag 201 acagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccacccttagGCTGCTGGTGGTCTACCCTTGGACCCAGA 301 GGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTC GGTGCCTTTAGTGA 401 TGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAG AACTTCAGGgtgagt 501 ctatgggacccttgatgttttctttccccttcttttctatggttaagttcatgtcataggaaggggagaagtaacagggtacagtttagaatgggaaaca 601 gacgaatgattgcatcagtgtggaagtctcaggatcgttttagtttcttttatttgctgttcataacaattgttttcttttgtttaattcttgctttctt 701 tttttttcttctccgcaatttttactattatacttaatgccttaacattgtgtataacaaaagcaaatatctctgagatacattaagtaacttaaaaaaa 801 aactttacacagtctgcctagtacattactatttggaatatatgtgtgcttatttgcatattcataatctccctactttattttcttttatttttaattg 901 atacataatcattatacatatttatgggttaaagtgtaatgttttaaaattttgcatttgtaattttaaaaaatgctttcttcttttaatatactttttt 1001 gtttatcttatttctaatactttccctaatctctttctttcagggcaataatgatacaatgtatcatgcctctttgcaccattctaaagaataacagtga 1101 taatttctgggttaaggcaatagcaatatttctgcatataaatatttctgcatataaattgtaactgatgtaagaggtttcatattgctaatagcagcta 1201 caatccagctaccattctgcttttattttatggttgggataaggctggattattctgagtccaagctaggcccttttgctaatcatgttcatacctctta 1301 tcttcctcccacagCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTA TCAGAAAGT 1401 GGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAgctcgctttcttgctgtccaatttctattaaaggttcctttgttccctaagtccaac 1501 tactaaactgggggatattatgaagggccttgagcatctggattctgcctaataaaaaacatttA

Many eukaryotic genes contain intervening sequences (introns)

Many eukaryotic genes contain intervening sequences (introns)

Genes vary greatly in size and intron / exon organization. Some genes dont have any introns. Most common example is the histone genes.

How does genes function?

Central Dogma: DNA to RNA to Protein.

DNA to Protein

Cell Nucleus
Compartmentalized DNA activity Nuclear pores allow communication Nuclear lamina and cytoskeleton mechanically support the nucleus

Nucleus
What kinds of molecules are transported across the nuclear envelope?

Genes
Probably about 30000 35000 genes Gene density varies along chromosomes genes are mostly in euchromatin, not in the heterochromatin near the centromeres or on the short arms of acrocentric chromosomes.

Genes
Most genes (90-95% probably) code for proteins.
There are a significant number of RNAonly genes

Protein-coding Genes
Some genes are quite huge: dystrophin (associated with Duchenne muscular dystrophy) is 2.4 Mbp and takes 16 hours to transcribe. More than 99% of this gene is intron (total of 79 introns). Most exons are short: 200 bp on average. Intron size varies widely, from tens to millions of base pairs.
However, highly expressed genes usually have short introns

RNA Genes
The best known RNA genes are ribosomal RNA and transfer RNA genes. Ribosomal RNA genes: The nucleolus sits on these genes, which are sometimes called nucleolus organizer regions. Transfer RNA genes are dispersed throughout the genome, usually in small clusters. There are 49 families of tRNA genes.

Other RNA Genes

Small nuclear RNA (snRNA) and small nucleolar RNA (snoRNA) genes for ribozymes (catalytic RNA molecules) which are involved with RNA splicing and RNA base modification. Also genes for telomerase, signal recognition, X-chromosome inactivation, imprinting, and probably quite a bit else.

Other RNA Genes

MicroRNAs (miRNA) and small interfering RNAs (siRNA) regulate translation of specific mRNAs miRNA seems to have a role in development. siRNA is a basis for a popular technique called RNA interference, which allows specific genes to be inactivated.

A gene cluster
A gene cluster is a set of two or more genes that serve to encode for the same or similar products. An example of a gene cluster is the Human -globin gene cluster, which contains five functional genes and one non-functional gene which code for similar proteins.

Beta globin gene cluster

the beta-globin cluster, which contains 5 very similar genes. All play the beta role in hemoglobin molecules (22), but in different ways: beta is part of HbA, 99% of adult hemoglobin; delta is part of HbA2, 1% of adult hemoglobin; the two gamma genes (almost identical) are part of HbF, fetal hemoglobin; epsilon is part of embryonic hemoglobin..

Genomic DNA

human genome
all the DNA present in the cell.
the nuclear genome (about 3200 Mbp) and the mitochondrial genome (16.6 kb). that nuclear DNA : a unique fraction and several classes of repeated sequence DNA.

Types of sequences in the human genome

LINEs (long interspersed nuclear elements),

SINEs (short interspersed nuclear elements), Microsatellites (SSRs) are much shorter, 25 bp repeats, and microsatellite arrays are found all over the genome.

Prokaryotic Chromosome
Many prokaryotes contain a single circular chromosome.
Prokaryotic chromosomes are condensed in the nucleoid via DNA supercoiling and the binding of various architectural proteins.

DNA Supercoiling in Prokaryotes

an E. coli cell
A single DNA molecule containing over 4.6 million base pairs encoding approximately 4,300 genes. The small circlets are plasmids.

Prokaryotic Chromosome
Because prokaryotic DNA can interact with the cytoplasm, transcription and translation occur simultaneously.
Most prokaryotes contain only one copy of each gene (i.e., they are haploid).

Prokaryotic Chromosome
Prokaryotic genomes are efficient and compact, containing little repetitive DNA. noncoding sequences account for an average of 12% of the prokaryotic genome, as opposed to upwards of 98% of the genetic material in eukaryotes (Ahnert et al., 2008)

Prokaryotic plasmids
extrachromosomal DNA molecules linear or circular typically smaller (i.e., less than 1,500 kilobases) encode nonessential genes (aid growth in specific conditions or encode antibiotic resistance

Prokaryotic plasmids
Plasmids replicate independently of the rest of the genome. some plasmids are capable of integrating into chromosomes or moving from cell to cell. have a single origin of replication

Most prokaryotic genomes

are organized into polycistronic operons, or clusters of more than one coding region attached to a single promoter, separated by only a few base pairs

The lac operon of E. coli

The lac operon of E. coli is a segment of DNA that includes a promoter, an operator, and the three structural genes that code for lactosemetabolizing enzymes. 2008 by Sinauer Associates, Inc. All rights reserved. Used with permission.

 The retrovirus genome is RNA When it enters a cell, the RNA gets translated to form reverse transcriptase, which copies the viral RNA into DNA. This DNA then integrates into the genome: it becomes a provirus. The provirus DNA is transcribed to make more viral RNAs and proteins. The virus buds out through the cell membrane. Basic structure of retrovirus: 3 genes gag: RNA-binding proteins (virus core) pol: reverse transcriptase and other processing enzymes env: outer coat protein

Chromosomes
What is chromosome?
Chromosome is a complex of DNA, RNA and proteins. Each chromosome consists of one DNA molecule.

Chromosomes become visible as cells prepare to divide

Heterochromatin and Euchromatin

Extreme condensation silences expression

Heterochromatin
Darkly stained region of chromosome Highly compacted even during interphase Usually found in regions near centromere Constitutive heterochromatin remains condensed most of time in all cells (e.g., Y chromosomes in flies and humans)

Euchromatin
Lightly stained regions of chromosomes Contains most genes

Heterochromatin versus euchromatin

Heterochromatin is darkly stained Euchromatin is lightly stained C-banding techniques stains constitutive heterochromatin near centromere
Fig.

Chromosomes in eukaryotes and prokaryotes are different

PROKARYOTES EUKARYOTES

single chromosome plus plasmids

circular chromosome made only of DNA

many chromosomes
linear chromosomes made of chromatin, a nucleoprotein (DNA coiled around histone proteins) found in a nucleus

found in cytoplasm

copies its chromosome and divides copies chromosomes, then the immediately afterwards cell grows, then goes through mitosis to organise chromosomes in two equal groups
2007 Paul Billiet ODWS

The location of DNA in prokaryotic cells.

a. nucleus b. mitochondria c. cytoplasm d. vacuole

DNA PROKARYOTES
Is the following sentence true or false?

Most prokaryotes contain a single, circular DNA molecule.

DNA EUKARYOTES
Eurkaryotic DNA is generally located in the cell_____ in the form of a number of chromosomes.

Is the following sentence true or false?

All organisms have the same number of chromosomes.

When transformation was first discovered in bacteria during the 1940s its investigation by Avery proved that:

a) bacterial cultures can form tumors like animal cells b) pure DNA carries genetic information c) DNA plus protein is needed to transfer genes from one bacterial cell to another d) mutations occur spontaneously that convert harmless bacteria into dangerous virulent strains e) bacteria of two different types must be mixed together for gene transfer to occur

Next we will review how genes replicate