Rekayasa genetika dan prinsip

rekayasa protein

Budiman Bela dan T. Mirawati Sudiro

Departemen Mikrobiologi FKUI
Genetic engineering deals with the ability of scientists to
manipulate DNA through the use of an expanding repertoir of
recombinant DNA techniques. These techniques allow DNA to be
cut, separated by size and even sequenced to determined the
actual composition and order of nucleotides.
Topics:
Tools and techniques of genetic engineering
Methods in Recombinant technology
Genome and protein analysis
Other techniques
Tools and techniques of genetic engineering
Struktur DNA
 Semiconservative replication of DNA

DNA denaturation:
Double strand-DNA separated into 2 single
strand DNA
In vitro : dsDNA heated 90-95oC will be
denatured.
Restriction endonuclease:
Enzim (endonuklease) yang dapat memotong untai DNA pada posisi
tertentu
Memotong ikatan fosfodiester pada diantara nukleotida pada kedua untai.
Tempat pemotongan tersebut (restriction site) : palindrom
Contoh :

DNA yang terpotong dapat berujung rata

blunt end atau berekor (sticky end,
cohesive end).
Potongan-potongan DNA ini disebut :
restriction fragment
Ligase:
Enzim yang menautkan 2 fragmen DNA dengan cohesive end yang
sesuai dengan menyambung ikatan gula fosfat yang terpotong oleh
endonuklease.
Contoh : Penggunaan restriction
endonuclease dan ligase untuk
menginsersikan fragmen DNA
pada vektor plasmid
 [GENETYX-WIN: Search Restriction Map]
Date : 2008.11.28
Filename : ns1 den2 jakarta.bio
Sequence Size : 1056
Sequence Position: 1 - 1056
670 680 690 700 710 720
aaaagctgccactggccaaagtcacacactctctggagtaatggagtgctagaaagtgag
/
AluI
730 740 750 760 770 780
atgataattccaaagaattttgcaggaccagtgtcacaacacaactacagaccaggttat

790 800 810 820 830 840

catacacaaacggcaggaccctggcatctaggtaagcttgagatggactttgatttctgc
/ /
HindIII
AluI
850 860 870 880 890 900
gaaggaaccacagtggtagtgactgaggactgtggaaatagaggaccctctttaagaaca

910 920 930 940 950 960

actactgcttctggaaaactcataacagaatggtgctgccgatcttgcacattaccaccg

970 980 990 1000 1010 1020

ctaaggtacagaggtgaggatggatgctggtatggaatggaaatcagaccattgaaagag

1030 1040 1050 1060

aaagaagagaacttggtcaactctttggtcacagcc
/
HincII
DNA polymerase III:
Adding bases to the new DNA chain ------ DNA replication
Unable to synthesizing a chain of nucleotides, but can only continue to add
nucleotides to an already existing chain (or start with a primer)
Can only add nucleotide in one direction (5 to 3)
Reverse transcriptase
Produce complementary DNA (cDNA) from an RNA template.
From retrovirus
Analisis DNA dengan elektroforesis jel
Elektroforesis dapat dilakukan pada jel agarosa atau
poliakrilamida
Grup fosfat pada DNA menyebabkan DNA bermuatan negatif,
arus listrik akan menggerakkan DNA ke kutub positif.
DNA akan bergerak dan terpisah berdasarkan ukurannya.
Fragmen berukuran besar akan bergerak lebih lambat.
M DV1 DV3 DV2 DV4 N N +
Hasil elektroforesis DNA Lambda yang dipotong dengan EcoRI
Hibridisasi asam nukleat dan pelacak (probe)
Dua untai asam nukleat dengan urutan basa yang saling
komplementer dapat melekat/ bergabung.
Dapat terjadi : DNA-DNA; DNA-RNA; RNA-RNA
Sifat ini digunakan untuk merancang oligonukleotida yang
dapat mengenali fragmen/sekuens DNA tertentu yang
ingin dicari ----- pelacak/ probe.
 Contoh

Sekuens daerah 3 virus dengue tipe 3:

..CAAAGGACUAGAGGUUAGAGGAGACCCCCCGCAAA
UAAAAACAGCAUAUUGACGCUGGGAGAGACCAGAGAUC
CUGCUGUCUCCUCAGCAUCAUUCCAGGCACAGAACGCCA
GAAAAUGGAAUGGUGCUGUUGAAUCAACAGGUUCU

..CUGUCUCCUCAGCAUCAUUCCAGGCACAGAAC

GCCAGAAAAUGGAAUGGUGCUG UUGAAUCAACAGGUUCU

T TACCACGACAACTTAGTTG
Agar dapat dilihat, probe dilabel dengan radioaktif atau enzim
Teknik mendeteksi asam nukleat tertentu dengan pelacak RNA atau
DNA disebut hibridisasi

Southern blot:
Sampel DNA dilarikan pada elekroforesis jel agarosa ---- blot ke
membran --- hibridisasi dengan pelacak berlabel ---- visualisasi

Northern blot:
Sampel DNA dilarikan pada elekroforesis jel agarosa ---- blot ke
membran --- hibridisasi dengan pelacak berlabel ---- visualisasi
Southern blot
Reverse hybridization with non-radioactive label
DNA sequencing
- Untuk mengetahui urutan nukleotida pada DNA

Metoda Sanger:
Fragmen DNA ----- denaturasi ---- ssDNA sebagai cetakan
----- + 4 dNTP + ddATP/ ddTTP/ ddCTP/ ddGTP
Dideoksinukleotida tidak memiliki molekul O pada 3karbon
dari ribose ---- pemanjangan rantai DNA terhenti bila
rantai mengikat ddNTP ------ terbentuk DNA dengan
gradasi ukuran dari 1 maksimal ----- elektroforesis ----
baca.
Automated DNA sequencing
Polymerase chain reaction
A molecular copy machine for DNA
Primer : Oligonukleotida sintetis yang dirancang untuk mengenali
bagian DNA yang akan diamplifikasi, dan memungkinkan terjadinya
polimerasi/ pemanjangan untai DNA.
Diperlukan suhu tinggi untuk denaturasi DNA
Digunakan enzim DNA polimerase yang tahan pada suhu 95oC (misal
enzim taq polymerase dari Thermus aquaticus)
PCR

Terdiri atas 30-40 siklus 3 tahap dasar, yaitu:

Denaturasi :
90-95oC, terjadi pemisahan DNA rantai ganda, menjadi 2 untai
rantai tunggal

Annealing/ priming
50-65oC, perlekatan primer pada DNA target

Elongation
68-72oC, reaksi polimerasi, pemanjangan rantai DNA
Polymerase chain reaction
 Metoda untuk membuat DNA rekombinan
----- DNA cloning
Strategi :
1. Mengambil gen/ bagian gen yang diinginkan dari 1 organisme (donor)
- Memotong dengan restriction endonuclease
- dari RNA, menggunakan reverse transcriptase untuk
mendapatkan cDNA
- Amplifikasi dengan PCR
- Sintesis DNA

2. Insersi gen yang diinginkan ke vektor (plasmid, virus, cosmid)

3. Memasukkan vektor yang telah mengandung insert DNA ke sel
hospes yang sesuai (cloning host) - bakteri, jamur, sel mamalia
4. Seleksi sel berisi DNA yang diinginkan
5. Konfirmasi dengan analisis DNA / protein
Gene cloning
! E. coli is the most widely used cloning host for amplification
of recombinant DNA
11/14/2017 29
http://www.bmb.psu.edu/courses/micro106/biotech/biotechover.jpg
11/14/2017 30
http://www.bmb.psu.edu/courses/micro106/biotech/biotech.htm
 Early 1970's, Herbert Boyer, Stanley Cohen,
Paul Berg and co-workers Started
Recombinant DNA Technology:
insertion of foreign pieces of DNA in to host
cells and cloned those host cells to produce
multiple copies of the inserted DNA.
Currently, there are many sophisticated
techniques available for doing essentially the
same thing: inserting DNA from one species into
another species, and allowing that recipient
species to replicate, producing multiple copies of
the new RECOMBINANT DNA.

11/14/2017 31
http://www.bio.miami.edu/dana/250/25003_10.html
 Some of the Goals of the DNA Technologist:
1. Isolation of a particular gene, part of a
gene or region of a genome
2. Production of a desired RNA or protein
molecule in large quantities
3. Increased production efficiency for
commercially made enzymes and drugs
4. Modification of existing organisms so that
they express a particularly desirable trait
not previously encoded in the genome.
5. Correction of genetic defects in complex
organisms, including humans.
11/14/2017 32
http://www.bio.miami.edu/dana/250/25003_10.html
Sifat penting vektor untuk kloning gen, a.l.:
Punya ori (origin of replication)
Dapat menerima DNA insert, kecil, tidak mudah terdegradasi
Mempunyai restriction site yang dapat digunakan untuk insersi gen
yang akan diklon
Membawa gen marker, misal pembawa sifat resistensi antibiotika
---- untuk seleksi

Sifat penting vektor untuk kloning gen untuk ekspresi protein

Sama dengan di atas
Mempunya promoter dan
ribosome binding sequence
VECTOR YANG DIGUNAKAN UNTUK KLONING GENE

a.l.:
retroviruses
adenoviruses
adeno-associated viruses (AAV)
herpes simplex virus
rhinoviruses
Human Immunodeficiency Virus (HIV)
plasmids of various types (misal : plasmid pBR322,
pUC
faga lambda
cosmid (hibrid plasmid dan faga lambda)
Introduksi klon gen ke sel hospes

Sel : Bakteri, sel mamalia, sel serangga, sel tanaman

Syarat : - Tumbuh cepat, mudah dibiak
- Non-patogen
- Genomnya sudah dipetakan
- Dapat menerima vektor plasmid atau faga
- Mempertahankan gen asing selama multiplikasinya
- Mengekspresi dan mensekresi protein klon dalam
jumlah besar

Metoda : Transformasi, transfeksi, elektroporasi, biolistik,

transduksi dll.
Sifat penting mikroba sebagai cloning host
Tumbuh cepat
Mudah dibiak
Non-patogen
Genomnya sudah dipetakan
Dapat menerima plasmid atau faga
Mempertahankan gen asing saat replikasinya
Mengekspresikan protein yang diinginkan dalam jumlah besar
 Transformation
(this term is used for introduction of DNA to bacterial or plant cells)

Transformation: DNA picked up

directly from the medium and
recombined into the genome

heteroduplex

! Competent cell:
bacterial cell
capable of picking
up DNA
Introducing recombinant plasmid to
cells host
Transformation ---> introduce naked DNA to cell host

http://www.odec.ca
Introducing recombinant plasmid to cells host (continued)

Transfection
- The introduction of foreign material into eukaryotic cells.
- Transfection typically involves opening transient pores
or 'holes' in the cell plasma membrane, to allow the
uptake of material.
- Transfection is frequently carried out by mixing a
cationic lipid with the material to produce liposomes,
which fuse with the cell plasma membrane and deposit
their cargo inside.
- The term transfection is most often used in reference
to mammalian cells.
Introducing recombinant plasmid to cells host (continued)

Lipid mediated transfection in mammalians cells

http://www.microscopyu.com

Contoh reagen: lipofektamin

 ELECTROPORATION
if host cell has cell walls, enzymes are used to dissolve
the walls, leaving only a protoplast (cell without walls)
Foreign DNA is introduced via ELECTROPORATION--
protoplasts are exposed to a short electrical pulse which
opens transient membrane channels through which DNA
can pass
transformed cells can then be cultured in media that
allows re-formation of cell walls and normal growth into a
whole organism (plants, fungi, some protists).
Animal cells lack cell walls, and so are easily
transformed via electroporation.

11/14/2017 42
http://www.bio.miami.edu/dana/250/25003_10.html
Introducing recombinant plasmid to cells host (continued)
Electroporation machine Electroporation cuvette

http://medicalexpo.com
http://www.btxonline.com/ecm-630-exponential-decay-wave-electroporation-system/

The phenomenon of electrophoration

http://gmcrops.yolasite.com/methods-of-genetic-engineering
 TRANSDUCTION
Viruses with affinity for certain cell types can also be
used as vectors if they are "loaded" with desired foreign
DNA and allowed to infect target host cells

11/14/2017 44
http://www.bio.miami.edu/dana/250/25003_10.html
Seleksi klon yang
mengandung
insert DNA yang
dikehendaki

- Sel bakteri : Ampisilin,

kanamisin
- Sel mamalia : Geneticin/
neomycin
Introduction of DNA into mammalian cells

Selection of clone in mammalian cells: neomycin resistance

Untuk konfirmasi klon
Pemotongan dengan endonuklease restriksi
Southern blot
PCR
Western blot
Western blot:
Protein di-elektroforesis pada gel poliakrilamida
Blot protein/ gel ke membran nitroselulosa
Adanya protein dikenali dengan antibodi spesifik
Antibodi sekunder berlabel radioaktif atau enzim
Visualisasi
 Application of molecular
technique on Vaccine production
IMMUNE RESPONSE

-Innate immunity
-Adaptive immunity (acquired immunity)
Innate Immunity

- Non-specific immune response

- First defence against pathogens
- Dont rely on the clonal expansion of antigen-specific
lymphocytes
- Induced effector that will activate adaptive immune
system
Adaptive immunity (= acquired immunity)

- Cellular and humoral immunity against a particular

antigen
- Occurs during the lifetime of an individual as
an adaptation to infection with that pathogen
- In many cases, confers life long protective immunity
to reinfection with the same pathogen
Table 1. The principal recognition molecules of the
immune system. Note that some of them act together,
e.g. antibody and complement, the T cell receptor and
MHC molecules
Molecule and location Nature Structures recognized
Receptors on phagocytic cells Mostly protein General microbial features, e.g.
bacterial sugars
Most foreign or denatured molecules.
e.g. carbon, effete red cells
Receptors on natural killer Protein Virus-infected cells and some tumour cells
cells
Complement Numerous protein 1). Some bacterial cell walls
2). Antibody bound to antigen
Major histocompability Protein Short intracellular peptides (transported
complex (MHC) molecules to cell surface and presented to T cell
T cell receptor (on T cell) Protein Short peptides bound to MHC
Glycolipids bound to CD1
Antibody (on B cells) Protein Three-dimensional shape of protein,
(immunoglobulin) carbohydrates, etc
The activity of
specific antibody
Immunization
= deliberate induction of an immune response

Passive immunization : by giving antisera/

immunoglobulin against certain pathogen (e.g.
antitetanus serum, antidiphteri serum)

Active immunization : by vaccine

Vaccine : imitate natural (first) infection to induce

adaptive immune response ---- formation of
immunological memory --- protective immunity to
reinfection with the same pathogen
Antigen = any substance that can bind to a specific
antibody

Any substance that can elicit an immune response is

said to be immunogenic, and is called an immunogen.
Not all antigens are immunogenic

Carbohydrates, nucleic acids, and other types of

molecules are all potential antigens, but will often only
induce an immune response if attached to a protein
carrier
Factors that influence the immunogenicity of proteins

Parameters Increased immunogenicity Decreased immunogenicity

Size Large Small (MW<2500)

Dose Intermediate High or low
Route Subcutaneous > intraperitoneal > intravenous or intragastric
Composition Complex Simple
Form Paticulate Soluble
Denatured Native
Similarity to Multiple differences Few differences
self protein
Adjuvants Slow release Rapid release
Bacteria No bacteria
Interaction Effective Ineffective
With host MHC
Hapten
Hapten = a small molecule of simple structure that do
not provoke antibodies when injected by themselves,
but antibodies can be raised to them if they are
attached to a protein carrier ----> antibodies formed :
- Carrier-specific
- Hapten-specific
-Conjugate-specific

Hapten: aniline, biotin, digoxygenin, hydralazine

Hapten-protein conjugate specific

http://classes.midlandstech.edu
Ideally, immunizing agents characters:

1. The antigen being pure and defined

2. The specific response elicited should protect the
individual against the disease
3. The antigen should be administrable in a simple,
painless, single step procedure
4. Induce lifelong protection, without the necessity of
booster
5. Absence of any adverse immediate or long term
effects
6. Mutually acceptable to recipiens and medical
personels
7. inexpensive
Figure 14-22
Figure 1-2
Figure 1-33 part 1 of 3
Figure 1-33 part 2 of 3
Figure 1-20
 Types of vaccine

Inactive virus
Live attenuated vaccine
Recombinant vaccine
DNA vaccine
 Figure 14-24
Live attenuated vaccine
Figure 14-25
Recombinant vaccine
 INFLUENZA VIRUS

Family : Orthomyxoviridae
Genus : Influenza
Species :
Influenzavirus A : influenzavirus type A strains of human and
animals
Influenzavirus B : influenzavirus type B strains of human
Influenzavirus C : influenzavirus type C strains of human and
swine
Genetically engineered Live and killed influenza vaccines
- In development
- Contain 6 genes from attenuated virus and 2
modified or unmodified genes (HA & NA)
from circulating virus
- Can be prepared relatively quick for new
emerging influenza virus
- Risk for re-assortment of the vaccine virus
with circulating influenza virus --- novel
subtype that could spread in the human
population

From : CJ Luke, Emerging Infectious Diseases 12(1), 2006

 DNA Vaccine

http://triplehelixblog.com/2011/01/medical-innovation-future-promise-of-dna-vaccines/
 Examples: Some current dengue vaccine
candidates
Approach Vaccine developer DENV genes/antigen
Live, attenuated, PDK cells Mahidol/ Sanofi Pasteur All 10 DENV genes
Live, attenuatd, FRhL cells WRAIR/ GSK Biologicals All 10 DENV genes
Live, rationally attenuated, 3 US NIAID, John Hopkins All 10 DENV genes
deletion University
Live, 3 deletion, DEN/DEN US NIAID, John Hopkins 8 DENV4, 2 chimeric
chimeric University
Live, rationally mutated, 3 point US FDA All 10 DENV genes
mutations
Live, attenuated DENV vector, InViragen/ Shanta 8 DENV2, 2 chimeric
DEN/DEN chimeric
Live, attenuated YF17D vector, Acambis, Sanofi Pasteur 8 YF genes, 2 chimeric
YFh/DEN chimeric DENV genes

Subunit recombinant antigen Hawaii Biotech 2 (80%E and NS1)

DNA vaccines Kobe University 2 (prM and E)

 Rationally attenuated/Attenuated chimera
virus (NIAID)
Introduction of mutations into the 3-untranslated region
(UTR) of DENV-4 and DENV-1 cDNA clones for
attenuation.
TheDENV-1 and DENV-4 vaccine candidates containing
a 30-nucleotide (nt) deletion (nt 172-143), D 30, have a
balance between attenuation and immunogenicity in
nonhuman primate models.
Insertion of the prM and E proteins of DENV-2 and
DENV-3 into the same region of the DEN4D30 candidate
vaccine.
A second DENV-3 candidate vaccine was developed by
replacing the 3 UTR of a DENV-3 wild-type virus with
that of the DEN4D30 UTR.
 Live attenuated chimera vaccine
(The ChimeriVax) Acambis-Sanofi Pasteur

Substitution of the prM and E genes from each of the

four DENV serotypes into the YF17D vaccine strain of
yellow fever virus.

(Guirakhoo,2004)
 Vaccine-related issues that must be
addressed
Safety, immunogenicity and efficacy of the final
vaccine product
Genetic stability of live attenuated vaccines
Environmental safety of genetically modified
viruses
Consensus among national regulatory
authorities and WHO on the regulatory issues
that define the manufacture, clinical testing and
licensure of live DENV vaccines

(WHO, 2010)
 Factors to be considered in an
environmental risk assessment for the
recombinant GMO DENV vaccines
Include
i) genetic stability of the viruses (reversion to virulence)
ii) potential for transmission from vaccinated person
iii) the potential for recombination between the vaccine
virus and other flaviviruses, which may be present in
mosquitoes
iv) the immune status of population to be vaccinated
(WHO, 2010)
THANK YOU