Ch 12

 To know how
genes work
 We must know
what they are
made of.
 DNA is very long!
 It is a polymer, made up of
nucleotides.
•A polymer is a large molecule that
consists of smaller units, usually chained
together.

The total length of DNA present in one

adult human  is the equivalent
distance from the earth to the sun and
back.
 DNA made of units called
Nucleotides
◦ (Remember: nucleotides are made up
of nucleic acids = sugar, phosphate,
and a n-base)
 Double Helix Structure:
◦ Bases of nucleotides are paired together
◦ Attached by sugar and phosphate backbone
4 types of nitrogenous bases in 2 categories:
◦ Purines: 1. Adenine (A)
2. Guanine (G)
◦ Pyrimidines: 3. Cytosine (C)
4. Thymine (T)
 Base Pairing
◦ Adenine and thymine are connected by 2 weak
hydrogen bonds
A T
◦ Guanine and cytosine are connected by 3 weak
Hydrogen bonds
G C
• The variation in organisms comes from the way
the nitrogen bases are arranged.
– A-T or T-A
– G-C or C-G
– The sequence of nucleotides in DNA codes for proteins
– this is the key to cell function and life.

– Imagine how many possible combinations there are?

– ATTTTTTAAAGCCGTAATTTTACGCGCGCGATT……
– TTTTACCGTCGTACATCG……………………………….
 The DNA of every organism is initially found in one
single fertilized cell.
 DNA must replicate (copy) itself for cell division.
 The 2 strands of DNA are called complimentary
because
Adenine Thymine
Guanine Cytosine.
 Begins when an enzyme (DNA helicase)
breaks the hyrdogen bonds between bases 
two strands begin to come apart.
◦ Hydrogen bonds are relatively weak, so they are
easy to break.
 As the DNA “unzips”, nucleotides attach to the
exposed bases on the original DNA strand.
 This process continues until the whole molecule
has been unzipped and then replicated or
copied
 The result of replication is two new strands of
DNA exactly like the original!
 DNA provides the information necessary to produce
all of the proteins in our body.
 These proteins are used for:
Muscle tissue
Walls of blood vessels
Enzymes
Hair and more!
 In this way, DNA controls the cell
 Ribonucleic Acid
 RNA is essential in the
production of proteins
 RNA and DNA Similarities:
1: nucleic acid
2: Four bases
3: Sugar-phosphate
backbone
 3 main differences in DNA and
RNA
1. Uracil instead of Thymine
2. Single strand, not double strand
3. Ribose instead of deoxyribose
 Ribonucleic Acid
 Language of mRNA
◦ A, U , C, G
 Codon: 3 nucleotides that code for
an amino acid
◦ These codes are universal throughout biology!
 In a dog, a human, in algae, or in a slug.
Ex of a Codon: A-G-C or C-C-C
Do slugs and algae have the same DNA as
us??
1. Messenger RNA (mRNA):
Carries copies of info from
nucleus to the site of protein
synthesis at the ribosomes.
Compared to workers on an
assembly line
The production of mRNA from
DNA happens in a process called
transcription (occurs in nucleus).
2. Ribosomal RNA (rRNA):
makes up the ribosome
•Considered the tools or the builder
that puts together the proteins
•The ribosomes clamp onto the
mRNA and become the site for
protein synthesis.
3. Transfer RNA (tRNA): transfers each
amino acid (a.a.) to the ribosome
 found in cytoplasm.
 Attaches to and then transports the
a.a. to the site of protein synthesis at
the ribosome
 Each piece of tRNA only attaches to
one and only one specific amino acid
Anticodon - three bases found on the
tRNA that match the code on the
mRNA
DNA RNA
1. Double Strand 1. Single Strand
2. Deoxyribose 2, Ribose
3. A,T,C,G 3. A,U,C,G
 Transcription: Making mRNA from
DNA
◦ Occurs in the nucleus
◦ Once created, mRNA moves from nucleus to
ribosomes.
 The process of proteins being built by amino
acids
 tRNA carrying amino acids binds with
mRNAat the ribosome to build a protein
◦ mRNA codon binds to tRNA anticodons

ex. mRNA CAU

tRNA GUA
 Takes place at the ribosomes.
 Start & stop codons
◦ Sequence of three bases (codons) that start and
stop DNA replication
 Introns: pieces of DNA that is NOT used to
make proteins: “Cut out”

 Exons: DNA that is coded or (read) to make

proteins: These proteins are “Expressed”
 DNA RNA
Sugars Deoxyribose Ribose
Strands Double Single
Size Large Small
Site Nucleus Nucleus
Cytoplasm
Ribosome
Type DNA mRNA, rRNA,
tRNA
Base A-T G-C A-U C-G