What kind of enzyme synthesizes

the new DNA strand?

1) RNA polymerase
2) DNA Polymerase
3) Primase

4) Helicase
5) Topoisomerase
 Eukaryotic chromosomes have
multiple origins of replication

1. True
2. False
 In what direction is the newly
synthesized DNA produced?

1. 5'-3'

2. 3'-5'

3. In the direction of the major groove

4. Both 5'-3' and 3'-5' depending on which

strand is being replicated
 Nucleotides are always added to the growing DNA
strand at the 3’ end, at which the DNA has a free ______
on the 3’ carbon of its terminal deoxyribose.

1. Phosphate group
2. Hydroxyl group
3. Nitrogen base
4. Methyl group
 What is the sequence (1 to 6) in which
these proteins function during DNA
replication

• ____ RNA primase

• ____ DNA ligase
• ____ DNA polymerase
• ____ Topoisomerase
• ____ DNA helicase
• ____ tethering proteins
Why is an RNA primer necessary for DNA
replication?

A. The RNA primer is necessary for the activity of DNA ligase.

B. The RNA primer creates the 5’ and 3’ ends of the strand.

C. DNA polymerase can only add nucleotides to RNA molecules.

D. DNA polymerase can only add nucleotides to an existing

strand
RNA Transcription
DNA strand

Start Stop

3’

5’
3’
RNA strand
5’ RNA
Polymerase 5’
Promoter
3’
 DNA vs RNA
• Components of DNA
• Sugar (2’-deoxyribose)
• Nitrogenous Base (A,G,C,T)
• Phosphate group
• Components of RNA
• Sugar (ribose)
• Nitrogenous Base (A,G,C,Uracil)
• RNA does not contain thymine
• Phosphate group
 DNA vs RNA continued
• Structural Characteristics of DNA
• Double stranded
• Base-pairing rules apply (A:T & G:C)
• Structural Characteristics of RNA
• Primarily single stranded
• Limited base-pairing (G:C & A:U)
Why does DNA contain thymine and RNA
uracil?
1. Uracil is energetically less
expensive to produce than
thymine
2. Uracil is readily produced by
chemical degradation of cytosine
Cytosine Uracil 3. Thymine has a greater
resistance to photochemical
mutation, making the genetic
message more stable.
 Transcription and Translation in
Prokaryotes

• The primary transcript is

equivalent to the mRNA
molecule.
• The mRNA codons on the
mRNA are translated into an
amino acid sequence by the
ribosomes.
• Retroviruses
© John Wiley & Sons, Inc.
 Retrovirus
• single-stranded positive-
sense RNA virus with a
DNA intermediate and, as
an obligate parasite, targets
a host cel
• RNA → DNA → RNA →
polypeptidel.
What is the polymerase used in transcription?(2
pts)
a) DNA polymerase
b) RNA polymerase
c) Promoter
d) helicase
RNA polymerase creates a new strand or RNA
in __ direction(2 pts)
a) 5’- 3’
b) 3’ -5’
c) Bidirectional
d) unidirectional
Give one difference between an RNA from a
DNA. (2 pts)
Give a reason why does DNA contain thymine
and RNA uracil? (2 pts)
What does the “Central dogma” mean? (5 pts)
Translation
Protein Synthesis
Translation (Protein Synthesis)
RNA  protein
 Making a protein

• Many RNAs needed

• mRNA, tRNA, rRNA
 Messenger RNA (mRNA)
• Carries coded instructions for protein synthesis (translation)
• From the DNA in the nucleus to the ribosome
mRNA strand

Start Codons Stop Codons

3’
5’
AUACCGAUGAAGACGAGGCCC…………………….UGA
UAA
Lys-Thr- Arg- Pro UAG

Genetic code -> Codons -> amino acids

The genetic code
Protein Synthesis

Figure 6.8
 Transfer RNA (tRNA)
• Brings amino acids to the ribosome so it can build proteins
• It has Anticodons
• 3 nucleotide sequence
complementary to the mRNA
codon
Protein Synthesis

Figure 6.8
 Ribosomal RNA (rRNA)
• Makes up ribosomes
 Wobble base pair
• A wobble base pair is a pairing
between
two nucleotides in RNA molecules
that does not follow Watson-
Crick base pair rules.
• 5‘ base on the anticodon was not
as spatially confined as the other
two bases.
 Making a protein
• mRNA from nucleus goes through cytoplasm to the ribosome
mRNA start codon AUG signals beginning of protein
 Do we need new mRNA every time?

• NO
• The same mRNA may be used to make many copies of the same protein.
 DNA→RNA→Protein
• DNA is TRANSCRIBED to messenger RNA (mRNA)
• mRNA carries the message to tranfer RNA (tRNA)
• tRNA is TRANSLATED to an amino acid chain, which makes up proteins
• The basic mechanics of transcription and translation are similar in
eukaryotes and prokaryotes.
• Because bacteria lack nuclei, transcription and translation are
coupled.
• Ribosomes attach to the leading end of a mRNA molecule while
transcription is still in progress.

Fig. 17.2a
 In Eukaryotes, transcription and translation
happens in what part of the cell?
a) In the nucleus
b) Outside the nucleus
c) In the ribosome
d) Outside the cell membrane
What is wobble base pair? (5 pts)
Give and tell about the sites in the ribosome
that is needed in translation?
Give the RNA that are needed in translation
and their function (2 pts)
What is a codon? (5 pts)
 In a bacteria, where does transcription and
translation happens? (2 pts)
a) In the nucleus
b) Outside the nucleus
c) In the ribosome
d) Outside the cell membrane
 Given the mRNA strand, what will be the name
of the peptide that will be produced?
5’-AUGACAAACCGUAAA-3’

5’- GCCGUAAUCAAAGAU-3’